BCRC Strain Collection Catalog & Shopping Cart

  Home / BCRC Content / 12900 / 

Return

  Research Article

The information shown in this page was generated using the cross-referenced linkage within public domain database between their strains and BCRC related strains. Usually the information provided from public domain databases varies with different confidences and errors, BCRC provides the related information here at best effort, but BCRC doesn't take the responsibility about the correctness of the information provided here.

1. Millikan  DS, Ruby  EG,     ( 2003 )

FlrA, a sigma54-dependent transcriptional activator in Vibrio fischeri, is required for motility and symbiotic light-organ colonization.

Journal of bacteriology 185 (12)
PMID : 12775692  :   DOI  :   10.1128/jb.185.12.3547-3557.2003     PMC  :   PMC156232    
Abstract >>
Flagellum-mediated motility of Vibrio fischeri is an essential factor in the bacterium's ability to colonize its host, the Hawaiian squid Euprymna scolopes. To begin characterizing the nature of the flagellar regulon, we have cloned a gene, designated flrA, from V. fischeri that encodes a putative sigma(54)-dependent transcriptional activator. Genetic arrangement of the flrA locus in V. fischeri is similar to motility master-regulator operons of Vibrio cholerae and Vibrio parahaemolyticus. In addition, examination of regulatory regions of a number of flagellar operons in V. fischeri revealed apparent sigma(54) recognition motifs, suggesting that the flagellar regulatory hierarchy is controlled by a similar mechanism to that described in V. cholerae. However, in contrast to its closest known relatives, flrA mutant strains of V. fischeri ES114 were completely abolished in swimming capability. Although flrA provided in trans restored motility to the flrA mutant, the complemented strain was unable to reach wild-type levels of symbiotic colonization in juvenile squid, suggesting a possible role for the proper expression of FlrA in regulating symbiotic colonization factors in addition to those required for motility. Comparative RNA arbitrarily primed PCR analysis of the flrA mutant and its wild-type parent revealed several differentially expressed transcripts. These results define a regulon that includes both flagellar structural genes and other genes apparently not involved in flagellum elaboration or function. Thus, the transcriptional activator FlrA plays an essential role in regulating motility, and apparently in modulating other symbiotic functions, in V. fischeri.
KeywordMeSH Terms
DNA-Binding Proteins
DNA-Directed RNA Polymerases
Genes, Bacterial
Sigma Factor
2. Rowe-Magnus  DA, Guerout  AM, Biskri  L, Bouige  P, Mazel  D,     ( 2003 )

Comparative analysis of superintegrons: engineering extensive genetic diversity in the Vibrionaceae.

Genome research 13 (3)
PMID : 12618374  :   DOI  :   10.1101/gr.617103     PMC  :   PMC430272    
Abstract >>
Integrons are natural tools for bacterial evolution and innovation. Their involvement in the capture and dissemination of antibiotic-resistance genes among Gram-negative bacteria is well documented. Recently, massive ancestral versions, the superintegrons (SIs), were discovered in the genomes of diverse proteobacterial species. SI gene cassettes with an identifiable activity encode proteins related to simple adaptive functions, including resistance, virulence, and metabolic activities, and their recruitment was interpreted as providing the host with an adaptive advantage. Here, we present extensive comparative analysis of SIs identified among the Vibrionaceae. Each was at least 100 kb in size, reaffirming the participation of SIs in the genome plasticity and heterogeneity of these species. Phylogenetic and localization data supported the sedentary nature of the functional integron platform and its coevolution with the host genome. Conversely, comparative analysis of the SI cassettes was indicative of both a wide range of origin for the entrapped genes and of an active cassette assembly process in these bacterial species. The signature attC sites of each species displayed conserved structural characteristics indicating that symmetry rather than sequence was important in the recognition of such a varied collection of target recombination sequences by a single site-specific recombinase. Our discovery of various addiction module cassettes within each of the different SIs indicates a possible role for them in the overall stability of large integron cassette arrays.
KeywordMeSH Terms
3. Stabb  EV, Ruby  EG,     ( 2003 )

Contribution of pilA to competitive colonization of the squid Euprymna scolopes by Vibrio fischeri.

Applied and environmental microbiology 69 (2)
PMID : 12571000  :   DOI  :   10.1128/aem.69.2.820-826.2003     PMC  :   PMC143614    
Abstract >>
Vibrio fischeri colonizes the squid Euprymna scolopes in a mutualistic symbiosis. Hatchling squid lack these bacterial symbionts, and V. fischeri strains must compete to occupy this privileged niche. We cloned a V. fischeri gene, designated pilA, that contributes to colonization competitiveness and encodes a protein similar to type IV-A pilins. Unlike its closest known relatives, Vibrio cholerae mshA and vcfA, pilA is monocistronic and not clustered with genes associated with pilin export or assembly. Using wild-type strain ES114 as the parent, we generated an in-frame pilA deletion mutant, as well as pilA mutants marked with a kanamycin resistance gene. In mixed inocula, marked mutants were repeatedly outcompeted by ES114 (P < 0.05) but not by an unmarked pilA mutant, for squid colonization. In contrast, the ratio of mutant to ES114 CFUs did not change during 70 generations of coculturing. The competitive defect of pilA mutants ranged from 1.7- to 10-fold and was more pronounced when inocula were within the range estimated for V. fischeri populations in Hawaiian seawater (200 to 2,000 cells/ml) than when higher densities were used. ES114 also outcompeted a pilA mutant by an average of twofold at lower inoculum densities, when only a fraction of the squid became infected, most by only one strain. V. fischeri strain ET101, which was isolated from Euprymna tasmanica and is outcompeted by ES114, lacks pilA; however, 11 other diverse V. fischeri isolates apparently possess pilA. The competitive defect of pilA mutants suggests that cell surface molecules may play important roles in the initiation of beneficial symbioses in which animals must acquire symbionts from a mixed community of environmental bacteria.
KeywordMeSH Terms
Fimbriae Proteins
Symbiosis
4. Lupp  C, Hancock  RE, Ruby  EG,     ( 2002 )

The Vibrio fischeri sapABCDF locus is required for normal growth, both in culture and in symbiosis.

Archives of microbiology 179 (1)
PMID : 12471505  :   DOI  :   10.1007/s00203-002-0502-7    
Abstract >>
Inactivation of the sapABCDF genes results in a loss of virulence in several bacterial pathogens of animals and plants. The role of this locus in the growth physiology of Vibrio fischeri, and in the symbiotic colonization of the squid Euprymna scolopes was investigated. In rich medium, a V. fischeri sapA insertion mutant grew at only 85% the rate of its wild-type parent. While a similar effect has been attributed to a potassium-transport defect in sap mutants of enteric bacteria, the V. fischeri mutant grew more slowly regardless of the potassium concentration of the medium. Similarly, the growth-rate defect was independent of the source of either carbon, nitrogen, or phosphorous, indicating that the V. fischeri sap genes do not encode functions required for the transport of a specific form of any of these nutrients. Finally, while a delay in colonizing the nascent light organ of the squid could be accounted for by the lower growth rate of the mutant, a small but statistically significant reduction in its final population size in the host, but not in medium, suggests that the sap genes play another role in the symbiosis. All of these phenotypic defects could be genetically complemented in trans by the sapABCDF genes, but not by the sapA gene alone, indicating that the insertion in sapA is polar to the four downstream genes in the locus. Thus, while the sap locus is important to the normal growth of V. fischeri, it plays different physiological roles in growth and tissue colonization than it does in enteric pathogens.
KeywordMeSH Terms
Symbiosis
5. Kasai  S, Sumimoto  T,     ( 2002 )

Stimulated biosynthesis of flavins in Photobacterium phosphoreum IFO 13896 and the presence of complete rib operons in two species of luminous bacteria.

European journal of biochemistry 269 (23)
PMID : 12444973  :   DOI  :   10.1046/j.1432-1033.2002.03304.x    
Abstract >>
Photobacterium phosphoreum IFO 13896 emits light strongly when cultured in medium containing 3% NaCl, but only weakly in medium containing 1% NaCl. It is known that dim or dark mutants appear frequently and spontaneously from this parent strain. To confirm that riboflavin biosynthesis is stimulated when the lux operon is active, the amount of light emitted and flavins synthesized under strongly or weakly light emitting conditions was determined. In comparison with the parent strain cultured in 3% NaCl, the same strain cultured in 1% NaCl emitted 1/36 the light and produced 1/4 the flavins, while three dim or dark mutants, M1, M2 and M3 cultured in 3% NaCl, emitted almost no light, 1/58 the light and 1/10 the light and produced 1/8, 1/5 and 1/3 the amount of flavins, respectively. From these results, we deduced that the genes for riboflavin synthesis, rib genes, are organized in an operon in this strain. In P. phosphoreum NCMB 844, it has been reported that a rib gene cluster is present just downstream of the lux operon. However, among rib genes, the gene for pyrimidine deaminase/pyrimidine reductase, ribD, was not found in this cluster. Because a complete rib operon seems to be necessary for efficient regulation at the transcriptional level, we expected ribD to be present downstream of this cluster and sequenced this region, using SUGDAT, Sequencing Using Genomic DNA As a Template. We could not find this gene but found a gene for hybrid-cluster protein (prismane protein). To find ribD in a different region, a partial ribD sequence was amplified and sequenced using a PCR-based method, and subsequently the genomic DNA was sequenced in both directions from this partial sequence using SUGDAT. Because ribC was found just downstream of ribD, we sequenced further downstream of ribC and confirmed that another complete set of rib genes, ribD, ribC, ribBA, and ribE, is present in P. phosphoreum. The presence of a complete rib operon in P. phosphoreum explains why this species can synthesize flavins at enhanced levels to sustain a strong light emission. Furthermore, we sequenced the rib operon in Vibrio fischeri, another representative luminous bacterium, in a manner similar to that described above, and confirmed that a complete operon is present also in this species. The organization of rib genes in an operon in the Proteobacteria gamma-subdivision is discussed.
KeywordMeSH Terms
Genes, Bacterial
Operon
6. Fidopiastis  PM, Miyamoto  CM, Jobling  MG, Meighen  EA, Ruby  EG,     ( 2002 )

LitR, a new transcriptional activator in Vibrio fischeri, regulates luminescence and symbiotic light organ colonization.

Molecular microbiology 45 (1)
PMID : 12100554  :   DOI  :   10.1046/j.1365-2958.2002.02996.x    
Abstract >>
Vibrio fischeri is the bacterial symbiont within the light-emitting organ of the sepiolid squid Euprymna scolopes. Upon colonizing juvenile squids, bacterial symbionts grow on host-supplied nutrients, while providing a bioluminescence that the host uses during its nocturnal activities. Mutant bacterial strains that are unable to emit light have been shown to be defective in normal colonization. A 606 bp open reading frame was cloned from V. fischeri that encoded a protein, which we named LitR, that had about 60% identity to four related regulator proteins: Vibrio cholerae HapR, Vibrio harveyi LuxR, Vibrio parahaemolyticus OpaR and Vibrio vulnificus SmcR. When grown in culture, cells of V. fischeri strain PMF8, in which litR was insertionally inactivated, were delayed in the onset of luminescence induction and emitted only about 20% as much light per cell as its parent. Protein-binding studies suggested that LitR enhances quorum sensing by regulating the transcription of the luxR gene. Interestingly, when competed against its parent in mixed inocula, PMF8 became the predominant symbiont present in 83% of light organs. Thus, the litR mutation appears to represent a novel class of mutations in which the loss of a regulatory gene function enhances the bacterium's competence in initiating a benign infection.
KeywordMeSH Terms
Gene Expression Regulation, Bacterial
Luminescent Measurements
Symbiosis
7. DeLoney  CR, Bartley  TM, Visick  KL,     ( 2002 )

Role for phosphoglucomutase in Vibrio fischeri-Euprymna scolopes symbiosis.

Journal of bacteriology 184 (18)
PMID : 12193629  :   DOI  :   10.1128/jb.184.18.5121-5129.2002     PMC  :   PMC135327    
Abstract >>
Vibrio fischeri, a luminescent marine bacterium, specifically colonizes the light organ of its symbiotic partner, the Hawaiian squid Euprymna scolopes. In a screen for V. fischeri colonization mutants, we identified a strain that exhibited on average a 10-fold decrease in colonization levels relative to that achieved by wild-type V. fischeri. Further characterization revealed that this defect did not result from reduced luminescence or motility, two processes required for normal colonization. We determined that the transposon in this mutant disrupted a gene with high sequence identity to the pgm (phosphoglucomutase) gene of Escherichia coli, which encodes an enzyme that functions in both galactose metabolism and the synthesis of UDP-glucose. The V. fischeri mutant grew poorly with galactose as a sole carbon source and was defective for phosphoglucomutase activity, suggesting functional identity between E. coli Pgm and the product of the V. fischeri gene, which was therefore designated pgm. In addition, lipopolysaccharide profiles of the mutant were distinct from that of the parent strain and the mutant exhibited increased sensitivity to various cationic agents and detergents. Chromosomal complementation with the wild-type pgm allele restored the colonization ability to the mutant and also complemented the other noted defects. Unlike the pgm mutant, a galactose-utilization mutant (galK) of V. fischeri colonized juvenile squid to wild-type levels, indicating that the symbiotic defect of the pgm mutant is not due to an inability to catabolize galactose. Thus, pgm represents a new gene required for promoting colonization of E. scolopes by V. fischeri.
KeywordMeSH Terms
Symbiosis
8. Aeckersberg  F, Lupp  C, Feliciano  B, Ruby  EG,     ( 2001 )

Vibrio fischeri outer membrane protein OmpU plays a role in normal symbiotic colonization.

Journal of bacteriology 183 (22)
PMID : 11673429  :   DOI  :   10.1128/JB.183.22.6590-6597.2001     PMC  :   PMC95490    
Abstract >>
The nascent light-emitting organ of newly hatched juveniles of the Hawaiian sepiolid squid Euprymna scolopes is specifically colonized by cells of Vibrio fischeri that are obtained from the ambient seawater. The mechanisms that promote this specific, cooperative colonization are likely to require a number of bacterial and host-derived factors and activities, only some of which have been described to date. A characteristic of many host-pathogen associations is the presence of bacterial mechanisms that allow attachment to specific tissues. These mechanisms have been well characterized and often involve bacterial fimbriae or outer membrane proteins (OMPs) that act as adhesins, the expression of which has been linked to virulence regulators such as ToxR in Vibrio cholerae. Analogous or even homologous mechanisms are probably operative in the initiation and persistence of cooperative bacterial associations, although considerably less is known about them. We report the presence in V. fischeri of ompU, a gene encoding a 32.5-kDa protein homolog of two other OMPs, OmpU of V. cholerae (50.8% amino acid sequence identity) and OmpL of Photobacterium profundum (45.5% identity). A null mutation introduced into the V. fischeri ompU resulted in the loss of an OMP with an estimated molecular mass of about 34 kDa; genetic complementation of the mutant strain with a DNA fragment containing only the ompU gene restored the production of this protein. The expression of the V. fischeri OmpU was not significantly affected by either (i) iron or phosphate limitation or (ii) a mutation that renders V. fischeri defective in the synthesis of a homolog of the OMP-regulatory protein ToxR. The ompU mutant grew normally in complex nutrient media but was more susceptible to growth inhibition in the presence of either anionic detergents or the antimicrobial peptide protamine sulfate. Interestingly, colonization experiments showed that the ompU null mutant initiated a symbiotic association with juvenile light organ tissue with only about 60% of the effectiveness of the parent strain. When colonization did occur, it proceeded more slowly and resulted in an approximately fourfold-smaller bacterial population. Surprisingly, there was no evidence that in a mixed infection with its parent, the ompU-defective strain had a competitive disadvantage, suggesting that the presence of the parent strain provided a shared compensatory activity. Thus, the OmpU protein appears to play a role in the normal process by which V. fischeri initiates its colonization of the nascent light organ of juvenile squids.
KeywordMeSH Terms
Symbiosis
9. Rowe-Magnus  DA, Guerout  AM, Ploncard  P, Dychinco  B, Davies  J, Mazel  D,     ( 2001 )

The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons.

Proceedings of the National Academy of Sciences of the United States of America 98 (2)
PMID : 11209061  :   DOI  :   10.1073/pnas.98.2.652     PMC  :   PMC14643    
Abstract >>
Integrons are genetic elements that acquire and exchange exogenous DNA, known as gene cassettes, by a site-specific recombination mechanism. Characterized gene cassettes consist of a target recombination sequence (attC site) usually associated with a single open reading frame coding for an antibiotic resistance determinant. The affiliation of multiresistant integrons (MRIs), which contain various combinations of antibiotic resistance gene cassettes, with transferable elements underlies the rapid evolution of multidrug resistance among diverse Gram-negative bacteria. Yet the origin of MRIs remains unknown. Recently, a chromosomal super-integron (SI) harboring hundreds of cassettes was identified in the Vibrio cholerae genome. Here, we demonstrate that the activity of its associated integrase is identical to that of the MRI integrase, IntI1. We have also identified equivalent integron superstructures in nine distinct genera throughout the gamma-proteobacterial radiation. Phylogenetic analysis revealed that the evolutionary history of the system paralleled that of the radiation, indicating that integrons are ancient structures. The attC sites of the 63 antibiotic-resistance gene cassettes identified thus far in MRIs are highly variable. Strikingly, one-fifth of these were virtually identical to the highly related yet species-specific attC sites of the SIs described here. Furthermore, antimicrobial resistance homologues were identified among the thousands of genes entrapped by these SIs. Because the gene cassettes of SIs are substrates for MRIs, these data identify SIs as the source of contemporary MRIs and their cassettes. However, our demonstration of the metabolic functions, beyond antibiotic resistance and virulence, of three distinct SI gene cassettes indicates that integrons function as a general gene-capture system for bacterial innovation.
KeywordMeSH Terms
Evolution, Molecular
Genome, Bacterial
10. Kasai  S, Yamazaki  T,     ( 2001 )

Identification of the cobalamin-dependent methionine synthase gene, metH, in Vibrio fischeri ATCC 7744 by sequencing using genomic DNA as a template.

Gene 264 (2)
PMID : 11250084  :   DOI  :   10.1016/s0378-1119(01)00339-0    
Abstract >>
To confirm the presence of cobalamin-dependent methionine synthase (CDMS) in luminous bacteria, which is a prerequisite for the substantiation of our proposals on the physiological function of the lux operon, we identified the CDMS gene (metH) in Vibrio fischeri ATCC 7744. Two partial metH sequences, one located near the 5'-terminus of the gene and the other near the 3'-terminus, were sequenced by a PCR based method. To design a new set of PCR primers located on the two flanking regions of the gene, the genomic DNA was sequenced by SUGDAT method (sequencing using genomic DNA as a template) upstream or downstream from the respective partial gene sequences. Subsequently a 4.2 kb DNA fragment containing the whole metH was amplified by PCR and sequenced. The number of amino acid residues comprising the protein (1226 amino acids) was comparable to those of known CDMSs. The deduced amino acid sequence showed 85, 74, 55, 31, 30, 52, or 52% identity with that of Vibrio cholerae, Escherichia coli, Deinococcus radiodurans, Synechocystis PCC6803, Mycobacterium tuberculosis, Caenorhabditis elegans or Homo sapiens, respectively. All the predicted amino acid residues for the binding of cobalamin and S-adenosylmethionine were conserved. In the regulatory region of the V. fischeri metH, the binding site of the met repressor, MetJ, was present, although the site is atypically not present in E. coli metH or Salmonella typhimurium metH. It was shown that nucleotide sequences, even long ones, can be determined without a cloning step, if only parts of the DNA fragment to be sequenced are amplified by PCR.
KeywordMeSH Terms
11. Visick  KL, Skoufos  LM,     ( 2001 )

Two-component sensor required for normal symbiotic colonization of euprymna scolopes by Vibrio fischeri.

Journal of bacteriology 183 (3)
PMID : 11208780  :   DOI  :   10.1128/JB.183.3.835-842.2001     PMC  :   PMC94949    
Abstract >>
The light organ of the squid Euprymna scolopes is specifically colonized to a high density by the marine bacterium Vibrio fischeri. To date, only a few factors contributing to the specificity of this symbiosis have been identified. Using a genetic screen for random transposon mutants defective in initiating the symbiotic association or in colonizing the light organ to high density, we identified a mutant of V. fischeri that exhibited an apparent defect in symbiosis initiation. This mutant was not defective in motility, luminescence, or growth in minimal medium, suggesting that it lacks an essential, previously unidentified symbiotic function. By sequence analysis, we showed that the locus inactivated in this mutant encodes a predicted 927-amino-acid protein with a high degree of similarity to the sensor component of hybrid two-component regulatory systems. We have therefore designated this locus rscS, for regulator of symbiotic colonization-sensor. Sequence analysis revealed two hydrophobic regions which may result in the formation of a periplasmic loop involved in signal recognition; PhoA fusion data supported this proposed membrane topology. We have investigated the start site of rscS transcription by primer extension and identified a putative promoter region. We hypothesize that RscS recognizes a signal associated with the light organ environment and responds by stimulating a putative response regulator that controls protein function or gene expression to coordinate early colonization events. Further studies on RscS, its cognate response regulator, and the signaling conditions will provide important insight into the interaction between V. fischeri and E. scolopes.
KeywordMeSH Terms
Bacterial Proteins
Genes, Regulator
Symbiosis
12. Graf  J,     ( 2000 )

Novel effects of a transposon insertion in the Vibrio fischeri glnD gene: defects in iron uptake and symbiotic persistence in addition to nitrogen utilization.

Molecular microbiology 37 (1)
PMID : 10931314  :   DOI  :   10.1046/j.1365-2958.2000.01984.x    
Abstract >>
Vibrio fischeri is the sole species colonizing the light-emitting organ of the Hawaiian squid, Euprymna scolopes. Upon entering the nascent light organ of a newly hatched juvenile squid, the bacteria undergo morphological and physiological changes that include the loss of flagellation and the induction of bioluminescence. These and other events reveal a pattern of genetic regulation that is a response to the colonization of host tissue. In this study, we isolated and characterized a glnD:mTn5Cm mutant of V. fischeri. In addition to the predicted defects in the efficiency of nitrogen utilization, this glnD mutant had an unexpected reduction in the ability to produce siderophore and grow under iron-limiting conditions. Although the glnD mutant could colonize juvenile squid normally over the first 24 h, it was subsequently unable to persist in the light organ to the usual extent. This persistence phenotype was more severe if the mutant was pregrown under iron-limiting conditions before inoculation, but could be ameliorated by the presence of excess iron. These results indicate that the ability to respond to iron limitation may be an important requirement in the developing symbiosis. Supplying the glnD gene in trans restored normal efficiency of nitrogen use, iron sequestration and colonization phenotypes to the glnD:mTn5Cm mutant; thus, there appears to be a genetic and/or metabolic linkage between nitrogen sensing, siderophore synthesis and symbiosis competence in V. fischeri that involves the glnD gene.
KeywordMeSH Terms
DNA Transposable Elements
Symbiosis
13. Chun  J, Ravel  J, Straube  WL, Ramaiah  N,     ( 2000 )

Detection of luciferase gene sequences in nonluminescent bacteria from the Chesapeake Bay.

FEMS microbiology ecology 33 (1)
PMID : 10922500  :   DOI  :   10.1111/j.1574-6941.2000.tb00723.x    
Abstract >>
A 745-bp luxA fragment was amplified from Vibrio harveyi (UM 1503), radiolabeled, and used as a probe to detect and quantify luxA genotypes in culturable bacterial populations from the Chesapeake Bay. DNA samples from 53 reference strains were also examined for this gene. The luxA-positive bacteria comprised from 0-6% of the culturable heterotrophic bacterial community in samples from the Bay. Only those reference strains known to be luminescent contained the luxA gene, as indicated by PCR. Results in all cases were confirmed by PCR of DNA extracts and Southern hybridization analyses, using an internal probe for confirmation of luxA amplification products. Sequence analysis of luxA genes from three nonluminescent bacteria isolated from the Chesapeake Bay indicated little or no differences when compared with luxA sequences from known marine luminescent bacterial species. These three Chesapeake Bay strains and other luxA-positive strains were tested with a luminometer and confirmed to be nonluminescent. All of over 7800 bacterial colonies enumerated during this study from Chesapeake Bay samples were non-visibly luminescent. Our results indicate that luxA-positive bacteria isolated from the Chesapeake Bay are not generally luminescent on phenotypic examination, implying that gene probe techniques are required for examining luxA gene distribution in microbial populations present in environmental samples.
KeywordMeSH Terms
14. Stabb  EV, Reich  KA, Ruby  EG,     ( 2001 )

Vibrio fischeri genes hvnA and hvnB encode secreted NAD(+)-glycohydrolases.

Journal of bacteriology 183 (1)
PMID : 11114931  :   DOI  :   10.1128/JB.183.1.309-317.2001     PMC  :   PMC94880    
Abstract >>
HvnA and HvnB are proteins secreted by Vibrio fischeri ES114, an extracellular light organ symbiont of the squid Euprymna scolopes, that catalyze the transfer of ADP-ribose from NAD(+) to polyarginine. Based on this activity, HvnA and HvnB were presumptively designated mono-ADP-ribosyltransferases (ARTases), and it was hypothesized that they mediate bacterium-host signaling. We have cloned hvnA and hvnB from strain ES114. hvnA appears to be expressed as part of a four-gene operon, whereas hvnB is monocistronic. The predicted HvnA and HvnB amino acid sequences are 46% identical to one another and share 44% and 34% identity, respectively, with an open reading frame present in the Pseudomonas aeruginosa genome. Four lines of evidence indicate that HvnA and HvnB mediate polyarginine ADP-ribosylation not by ARTase activity, but indirectly through an NAD(+)-glycohydrolase (NADase) activity that releases free, reactive, ADP-ribose: (i) like other NADases, and in contrast to the ARTase cholera toxin, HvnA and HvnB catalyzed ribosylation of not only polyarginine but also polylysine and polyhistidine, and ribosylation was inhibited by hydroxylamine; (ii) HvnA and HvnB cleaved 1, N(6)-etheno-NAD(+) and NAD(+); (iii) incubation of HvnA and HvnB with [(32)P]NAD(+) resulted in the production of ADP-ribose; and (iv) purified HvnA displayed an NADase V(max) of 400 mol min(-1) mol(-1), which is within the range reported for other NADases and 10(2)- to 10(4)-fold higher than the minor NADase activity reported in bacterial ARTase toxins. Construction and analysis of an hvnA hvnB mutant revealed no other NADase activity in culture supernatants of V. fischeri, and this mutant initiated the light organ symbiosis and triggered regression of the light organ ciliated epithelium in a manner similar to that for the wild type.
KeywordMeSH Terms
Bacterial Proteins
15. Ramaiah  N, Hill  RT, Chun  J, Ravel  J, Matte  MH, Straube  WL, Colwell  RR,     ( 2000 )

Use of a chiA probe for detection of chitinase genes in bacteria from the Chesapeake Bay(1).

FEMS microbiology ecology 34 (1)
PMID : 11053737  :   DOI  :   10.1111/j.1574-6941.2000.tb00755.x    
Abstract >>
PCR primers specific for the chiA gene were designed by alignment and selection of highly conserved regions of chiA sequences from Serratia marcescens, Alteromonas sp., Bacillus circulans and Aeromonas caviae. These primers were used to amplify a 225 bp fragment of the chiA gene from Vibrio harveyi to produce a chiA gene probe. The chiA PCR primers and probe were used to detect the presence of the chiA gene in an assemblage of 53 reference strains and gave consistent results. Selected chiA fragments amplified by PCR were cloned and sequenced from nine known strains and from Chesapeake Bay isolates 6d and 11d. This confirmed the specificity and utility of the primers for detection of chiA-positive environmental strains. Over 1000 bacterial isolates from Chesapeake Bay water samples were tested for the presence of the chiA gene which was found to be present in 5-41% (average 21%) of the culturable bacterial community. The approach developed in this study was valuable for isolation and enumeration of chiA-positive bacteria in environmental samples.
KeywordMeSH Terms
16. Lin  YH, Miyamoto  CM,     ( 2000 )

Control of bioluminescence in Vibrio fischeri by the LuxO signal response regulator.

Molecular microbiology 36 (3)
PMID : 10844649  :   DOI  :   10.1046/j.1365-2958.2000.01875.x    
Abstract >>
Bioluminescence in the marine bacterium Vibrio fischeri is controlled by the excretion of a N-acyl homoserine lactone (HSL) autoinducer which interacts with a regulator, LuxR, and activates transcription of the lux operon at high-cell density. This system has become the prototype for quorum sensing in many bacteria. Although light emission in Vibrio harveyi is also regulated by a N-acyl-HSL inducer, in sharp contrast, a completely different and more complex system is involved in quorum sensing which is mediated via LuxO, the response regulator of a phosphorelay signal transduction system. In the present work, luxO and the overlapping luxU gene, also involved in the phosphorelay system in V. harveyi, have been discovered in V. fischeri. By gene replacement technology, a V. fischeri luxO- mutant was generated whose phenotype was similar to that of V. harveyi luxO- showing that LuxO is involved in control of luminescence in V. fischeri. This mutant could be complemented with luxO from either V. fischeri or V. harveyi resulting in the restoration of the dependence of luminescence intensity on cell density. In contrast to V. harveyi luxO-, light emission of V. fischeri luxO- was stimulated by the N-acyl-HSL autoinducer indicating that luxO is part of a second signal transduction system controlling luminescence in this species. The presence of a luxO-based phosphorelay regulatory system as well as the luxR-based system in V. fischeri suggests that the former system, originally discovered in V. harveyi, may be a general regulatory mechanism in luminescent bacteria.
KeywordMeSH Terms
Transcription Factors
17. Callahan  SM,     ( 2000 )

LuxR- and acyl-homoserine-lactone-controlled non-lux genes define a quorum-sensing regulon in Vibrio fischeri.

Journal of bacteriology 182 (10)
PMID : 10781550  :   DOI  :   10.1128/jb.182.10.2811-2822.2000     PMC  :   PMC101990    
Abstract >>
The luminescence (lux) operon (luxICDABEG) of the symbiotic bacterium Vibrio fischeri is regulated by the transcriptional activator LuxR and two acyl-homoserine lactone (acyl-HSL) autoinducers (the luxI-dependent 3-oxo-hexanoyl-HSL [3-oxo-C6-HSL] and the ainS-dependent octanoyl-HSL [C8-HSL]) in a population density-responsive manner called quorum sensing. To identify quorum-sensing-regulated (QSR) proteins different from those encoded by lux genes, we examined the protein patterns of V. fischeri quorum-sensing mutants defective in luxI, ainS, and luxR by two-dimensional polyacrylamide gel electrophoresis. Five non-Lux QSR proteins, QsrP, RibB, AcfA, QsrV, and QSR 7, were identified; their production occurred preferentially at high population density, required both LuxR and 3-oxo-C6-HSL, and was inhibited by C8-HSL at low population density. The genes encoding two of the QSR proteins were characterized: qsrP directs cells to synthesize an apparently novel periplasmic protein, and ribB is a homolog of the Escherichia coli gene for 3,4-dihydroxy-2-butanone 4-phosphate synthase, a key enzyme for riboflavin synthesis. The qsrP and ribB promoter regions each contained a sequence similar to the lux operon lux box, a 20-bp region of dyad symmetry necessary for LuxR/3-oxo-C6-HSL-dependent activation of lux operon transcription. V. fischeri qsrP and ribB mutants exhibited no distinct phenotype in culture. However, a qsrP mutant, in competition with its parent strain, was less successful in colonizing Euprymna scolopes, the symbiotic host of V. fischeri. The newly identified QSR genes, together with the lux operon, define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri.
KeywordMeSH Terms
Regulon
18. Weng  SF, Chen  HY,     ( 2000 )

Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

Biochemical and biophysical research communications 269 (3)
PMID : 10720487  :   DOI  :   10.1006/bbrc.1999.1506    
Abstract >>
Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.
KeywordMeSH Terms
Bacterial Proteins
Genes, Bacterial
Membrane Glycoproteins
Multigene Family
Peptides
19. Kaeding  AJ, Ast  JC, Pearce  MM, Urbanczyk  H, Kimura  S, Endo  H, Nakamura  M, Dunlap  PV,     ( 2007 )

Phylogenetic diversity and cosymbiosis in the bioluminescent symbioses of "Photobacterium mandapamensis".

Applied and environmental microbiology 73 (10)
PMID : 17369329  :   DOI  :   10.1128/AEM.02212-06     PMC  :   PMC1907103    
Abstract >>
Photobacterium mandapamensis (proposed name) and Photobacterium leiognathi are closely related, phenotypically similar marine bacteria that form bioluminescent symbioses with marine animals. Despite their similarity, however, these bacteria can be distinguished phylogenetically by sequence divergence of their luminescence genes, luxCDAB(F)E, by the presence (P. mandapamensis) or the absence (P. leiognathi) of luxF and, as shown here, by the sequence divergence of genes involved in the synthesis of riboflavin, ribBHA. To gain insight into the possibility that P. mandapamensis and P. leiognathi are ecologically distinct, we used these phylogenetic criteria to determine the incidence of P. mandapamensis as a bioluminescent symbiont of marine animals. Five fish species, Acropoma japonicum (Perciformes, Acropomatidae), Photopectoralis panayensis and Photopectoralis bindus (Perciformes, Leiognathidae), Siphamia versicolor (Perciformes, Apogonidae), and Gadella jordani (Gadiformes, Moridae), were found to harbor P. mandapamensis in their light organs. Specimens of A. japonicus, P. panayensis, and P. bindus harbored P. mandapamensis and P. leiognathi together as cosymbionts of the same light organ. Regardless of cosymbiosis, P. mandapamensis was the predominant symbiont of A. japonicum, and it was the apparently exclusive symbiont of S. versicolor and G. jordani. In contrast, P. leiognathi was found to be the predominant symbiont of P. panayensis and P. bindus, and it appears to be the exclusive symbiont of other leiognathid fishes and a loliginid squid. A phylogenetic test for cospeciation revealed no evidence of codivergence between P. mandapamensis and its host fishes, indicating that coevolution apparently is not the basis for this bacterium's host preferences. These results, which are the first report of bacterial cosymbiosis in fish light organs and the first demonstration that P. leiognathi is not the exclusive light organ symbiont of leiognathid fishes, demonstrate that the host species ranges of P. mandapamensis and P. leiognathi are substantially distinct. The host range difference underscores possible differences in the environmental distributions and physiologies of these two bacterial species.
KeywordMeSH Terms
Biodiversity
Ecosystem
Symbiosis
20. Nhung  PH, Shah  MM, Ohkusu  K, Noda  M, Hata  H, Sun  XS, Iihara  H, Goto  K, Masaki  T, Miyasaka  J, Ezaki  T,     ( 2007 )

The dnaJ gene as a novel phylogenetic marker for identification of Vibrio species.

Systematic and applied microbiology 30 (4)
PMID : 17207598  :   DOI  :   10.1016/j.syapm.2006.11.004    
Abstract >>
The utility of the dnaJ gene for identifying Vibrio species was investigated by analyzing dnaJ sequences of 57 type strains and 22 clinical strains and comparing sequence homologies with those of the 16S rDNA gene and other housekeeping genes (recA, rpoA, hsp60). Among the 57 Vibrio species, the mean sequence similarity of the dnaJ gene (77.9%) was significantly less than that of the 16S rDNA gene (97.2%), indicating a high discriminatory power of the dnaJ gene. Most Vibrio species were, therefore, differentiated well by dnaJ sequence analysis. Compared to other housekeeping genes, the dnaJ gene showed better resolution than recA or rpoA for differentiating Vibrio coralliilyticus from Vibrio neptunius and Vibrio harveyi from Vibrio rotiferianus. Among the clinical strains, all 22 human pathogenic strains, including an atypical strain, were correctly identified by the dnaJ sequence. Our findings suggest that analysis of the dnaJ gene sequence can be used as a new tool for the identification of Vibrio species.
KeywordMeSH Terms
Genes, Bacterial
HSP40 Heat-Shock Proteins
21. Kasai  S, Okada  K, Hoshino  A, Iida  T, Honda  T,     ( 2007 )

Lateral transfer of the lux gene cluster.

Journal of biochemistry 141 (2)
PMID : 17169972  :   DOI  :   10.1093/jb/mvm023    
Abstract >>
The lux operon is an uncommon gene cluster. To find the pathway through which the operon has been transferred, we sequenced the operon and both flanking regions in four typical luminous species. In Vibrio cholerae NCIMB 41, a five-gene cluster, most genes of which were highly similar to orthologues present in Gram-positive bacteria, along with the lux operon, is inserted between VC1560 and VC1563, on chromosome 1. Because this entire five-gene cluster is present in Photorhabdus luminescens TT01, about 1.5 Mbp upstream of the operon, we deduced that the operon and the gene cluster were transferred from V. cholerae to an ancestor of Pr. luminescens. Because in both V. fischeri and Shewanella hanedai, luxR and luxI were found just upstream of the operon, we concluded that the operon was transferred from either species to the other. Because most of the genes flanking the operon were highly similar to orthologues present on chromosome 2 of vibrios, we speculated that the operon of most species is located on this chromosome. The undigested genomic DNAs of five luminous species were analysed by pulsed-field gel electrophoresis and Southern hybridization. In all the species except V. cholerae, the operons are located on chromosome 2.
KeywordMeSH Terms
Gene Transfer, Horizontal
Operon
22. Jones  BW, Lopez  JE, Huttenburg  J, Nishiguchi  MK,     ( 2006 )

Population structure between environmentally transmitted vibrios and bobtail squids using nested clade analysis.

Molecular ecology 15 (14)
PMID : 17107468  :   DOI  :   10.1111/j.1365-294X.2006.03073.x    
Abstract >>
Squids from the genus Euprymna (Cephalopoda: Sepiolidae) and their symbiotic bacteria Vibrio fischeri form a mutualism in which vibrios inhabit a complex light organ within the squid host. A host-mediated daily expulsion event seeds surrounding seawater with symbiotically capable V. fischeri that environmentally colonize newly hatched axenic Euprymna juveniles. Competition experiments using native and non-native Vibrio have shown that this expulsion/re-colonization phenomenon has led to cospeciation in this system in the Pacific Ocean; however, the genetic architecture of these symbiotic populations has not been determined. Using genetic diversity and nested clade analyses we have examined the variation and history of three allopatric Euprymna squid species (E. scolopes of Hawaii, E. hyllebergi of Thailand, and E. tasmanica from Australia) and their respective Vibrio symbionts. Euprymna populations appear to be very genetically distinct from each other, exhibiting little or no migration over large geographical distances. In contrast, Vibrio symbiont populations contain more diverse haplotypes, suggesting both host presence and unidentified factors facilitating long-distance migration structure in Pacific Vibrio populations. Findings from this study highlight the importance of how interactions between symbiotic organisms can unexpectedly shape population structure in phylogeographical studies.
KeywordMeSH Terms
Environment
Phylogeny
23. Kaplan  HB, Greenberg  EP,     ( 1987 )

Overproduction and purification of the luxR gene product: Transcriptional activator of the Vibrio fischeri luminescence system.

Proceedings of the National Academy of Sciences of the United States of America 84 (19)
PMID : 16578817  :   DOI  :   10.1073/pnas.84.19.6639     PMC  :   PMC299138    
Abstract >>
Expression of Vibrio fischeri luminescence genes requires an inducer, termed autoinducer, and a positive regulatory element, the luxR gene product. A plasmid containing luxR under control of a tac promoter was engineered to overproduce this gene product. The overproduced luxR gene product was active in vivo, and its apparent monomeric molecular weight was indistinguishable from that of the protein encoded by luxR under control of its own promoter (M(r) 27,000). The new tac-luxR construct directed the synthesis of large quantities of the luxR gene product in induced Escherichia coli cells lacking other lux genes. In the presence of the other lux genes, overexpression of the tac-luxR construct was not detected. The overproduced luxR gene product, which formed cytoplasmic inclusion bodies, was purified and used in subsequent studies. Nonequilibrium pH gradient electrophoresis indicated that the protein was basic, and the amino-terminal 15 amino acids were sequenced. DNA-binding activity was detected by membrane filter binding assays; under the conditions used, the binding was not lux DNA-specific. Binding of tritium-labeled autoinducer to the luxR gene product was not detected, and autoinducer enhancement of the binding of the luxR gene product to DNA could not be detected reproducibly.
KeywordMeSH Terms
24. Perry  LL, Bright  NG, Carroll  RJ, Scott  MC, Allen  MS, Applegate  BM,     ( 2005 )

Molecular characterization of autoinduction of bioluminescence in the Microtox indicator strain Vibrio fischeri ATCC 49387.

Canadian journal of microbiology 51 (7)
PMID : 16175203  :   DOI  :   10.1139/w05-019    
Abstract >>
Repeated attempts to clone the luxI from Vibrio fischeri ATCC 49387 failed to produce a clone carrying a functional LuxI. Sequence data from the clones revealed the presence of a polymorphism when compared with previously published luxI sequences, prompting further characterization of bioluminescence regulation in V. fischeri ATCC 49387. Further investigation of V. fischeri ATCC 49387 revealed that its LuxI protein lacks detectable LuxI activity due to the presence of a glutamine residue at position 125 in the deduced amino acid sequence. Specific bioluminescence in V. fischeri ATCC 49387 increases with increasing cell density, indicative of a typical autoinduction response. However, conditioned medium from this strain does not induce bioluminescence in an ATCC 49387 luxR-plux-based acyl homoserine lactone reporter strain, but does induce bioluminescence in ATCC 49387. It has been previously shown that a V. fischeri MJ-1 luxI mutant exhibits autoinduction of bioluminescence through N-octanoyl-L-homoserine lactone, the product of the AinS autoinducer synthase. However, a bioreporter based on luxR-plux from V. fischeri ATCC 49387 responded poorly to conditioned medium from V. fischeri ATCC 49387 and also responded poorly to authentic N-octanoyl-DL-homoserine lactone. A similar MJ-1-based bioreporter showed significant induction under the same conditions. A putative ainS gene cloned from ATCC 49387, unlike luxI from ATCC 49387, expresses V. fischeri autoinducer synthase activity in Escherichia coli. This study suggests that a regulatory mechanism independent of LuxR and LuxI but possibly involving AinS is responsible for the control of autoinduction of bioluminescence in V. fischeri ATCC 49387.
KeywordMeSH Terms
Gene Expression Regulation, Bacterial
Luminescence
Signal Transduction
25. Thompson  FL, Gevers  D, Thompson  CC, Dawyndt  P, Naser  S, Hoste  B, Munn  CB, Swings  J,     ( 2005 )

Phylogeny and molecular identification of vibrios on the basis of multilocus sequence analysis.

Applied and environmental microbiology 71 (9)
PMID : 16151093  :   DOI  :   10.1128/AEM.71.9.5107-5115.2005     PMC  :   PMC1214639    
Abstract >>
We analyzed the usefulness of rpoA, recA, and pyrH gene sequences for the identification of vibrios. We sequenced fragments of these loci from a collection of 208 representative strains, including 192 well-documented Vibrionaceae strains and 16 presumptive Vibrio isolates associated with coral bleaching. In order to determine the intraspecies variation among the three loci, we included several representative strains per species. The phylogenetic trees constructed with the different genetic loci were roughly in agreement with former polyphasic taxonomic studies, including the 16S rRNA-based phylogeny of vibrios. The families Vibrionaceae, Photobacteriaceae, Enterovibrionaceae, and Salinivibrionaceae were all differentiated on the basis of each genetic locus. Each species clearly formed separated clusters with at least 98, 94, and 94% rpoA, recA, and pyrH gene sequence similarity, respectively. The genus Vibrio was heterogeneous and polyphyletic, with Vibrio fischeri, V. logei, and V. wodanis grouping closer to the Photobacterium genus. V. halioticoli-, V. harveyi-, V. splendidus-, and V. tubiashii-related species formed groups within the genus Vibrio. Overall, the three genetic loci were more discriminatory among species than were 16S rRNA sequences. In some cases, e.g., within the V. splendidus and V. tubiashii group, rpoA gene sequences were slightly less discriminatory than recA and pyrH sequences. In these cases, the combination of several loci will yield the most robust identification. We can conclude that strains of the same species will have at least 98, 94, and 94% rpoA, recA, and pyrH gene sequence similarity, respectively.
KeywordMeSH Terms
Bacterial Typing Techniques
Phylogeny
Sequence Analysis, DNA
26. Dunn  AK, Martin  MO, Stabb  EV,     ( 2005 )

Characterization of pES213, a small mobilizable plasmid from Vibrio fischeri.

Plasmid 54 (2)
PMID : 16122560  :   DOI  :   10.1016/j.plasmid.2005.01.003    
Abstract >>
Most Vibrio fischeri strains isolated from the Euprymna scolopes light organ carry plasmids, often including both a large (>40kb) plasmid, and one or more small (<12kb) plasmids. The large plasmids share homology with pES100, which is the lone plasmid in V. fischeri type strain ES114. pES100 appears to encode a conjugative system similar to that on plasmid R721. The small plasmids lack extensive similarity to pES100, but they almost always occur in cells that also harbor a large plasmid resembling pES100. We found that many or all of these small plasmids share homology with pES213, a plasmid in strain ES213. We determined the 5501-bp pES213 sequence and generated selectable antibiotic resistance encoding pES213 derivatives, which enabled us to examine replication, retention, and transfer in V. fischeri. An 863-bp fragment of pES213 with features characteristic of theta-type replicons conferred replication without requiring any pES213 open reading frame (ORF). We estimated that pES213 derivatives were maintained at 9.4 copies per genome, which corresponds well with a model of random plasmid segregation to daughter cells and the approximately 10(-4) per generation frequency of plasmid loss. pES213 derivatives mobilized between V. fischeri strains at frequencies up to approximately 10(-4) in culture and in the host, apparently by employing the pES100 conjugative apparatus. pES213 carries two homologs of the putative pES100 origin of transfer (oriT), and V. fischeri strains lacking the pES100 conjugative relaxase, including a relaxase mutant, failed to serve as donors for transmission of pES213 derivatives. In other systems, genes directing conjugative transfer can function in trans to oriT, so it was noteworthy that ORFs adjacent to oriT, VFB51 in pES100 and traYZ in pES213, enhanced transfer 100- to 1000-fold when provided in cis. We also identified and disrupted the V. fischeri recA gene. RecA was not required for stable pES213 replication but surprisingly was required in donors for efficient transfer of pES213 derivatives. These studies provide an explanation for the prevalence and co-occurrence of pES100- and pES213-type plasmids, illuminate novel elements of pES213 mobilization, and provide the foundation for new genetic tools in V. fischeri.
KeywordMeSH Terms
Conjugation, Genetic
27. Sawabe  T, Hayashi  K, Moriwaki  J, Fukui  Y, Thompson  FL, Swings  J, Christen  R,     ( 2004 )

Vibrio neonatus sp. nov. and Vibrio ezurae sp. nov. isolated from the gut of Japanese abalones.

Systematic and applied microbiology 27 (5)
PMID : 15490553  :   DOI  :   10.1078/0723202041748154    
Abstract >>
Five alginolytic, facultative anaerobic, non-motile bacteria were isolated from the gut of Japanese abalones (Haliotis discus discus, H. diversicolor diversicolor and H. diversicolor aquatilis). Phylogenetic analyses based on 16S rRNA gene and gap gene sequences indicated that these strains are closely related to V. halioticoli. DNA-DNA hybridizations, FAFLP fingerprintings, and phylogenies of gap and 16S rRNA gene sequences showed that the five strains represent two species different from all currently described vibrios. The names Vibrio neonatus sp. nov. (IAM 15060T = LMG 19973T = HDD3-1T; mol% G+C of DNA is 42.1-43.9), and Vibrio ezurae sp. nov. (IAM 15061T = LMG 19970T = HDS1-1T; mol% G+C of DNA is 43.6-44.8) are proposed to encompass these new taxa. The two new species can be differentiated from V. halioticoli on the basis of several features, including beta-galactosidase activity, assimilation of glycerol, D-mannose and D-gluconate.
KeywordMeSH Terms
28. Thompson  CC, Thompson  FL, Vandemeulebroecke  K, Hoste  B, Dawyndt  P, Swings  J,     ( 2004 )

Use of recA as an alternative phylogenetic marker in the family Vibrionaceae.

International journal of systematic and evolutionary microbiology 54 (Pt 3)
PMID : 15143042  :   DOI  :   10.1099/ijs.0.02963-0    
Abstract >>
This study analysed the usefulness of recA gene sequences as an alternative phylogenetic and/or identification marker for vibrios. The recA sequences suggest that the genus Vibrio is polyphyletic. The high heterogeneity observed within vibrios was congruent with former polyphasic taxonomic studies on this group. Photobacterium species clustered together and apparently nested within vibrios, while Grimontia hollisae was apart from other vibrios. Within the vibrios, Vibrio cholerae and Vibrio mimicus clustered apart from the other genus members. Vibrio harveyi- and Vibrio splendidus-related species formed compact separated groups. On the other hand, species related to Vibrio tubiashii appeared scattered in the phylogenetic tree. The pairs Vibrio coralliilyticus and Vibrio neptunius, Vibrio nereis and Vibrio xuii and V. tubiashii and Vibrio brasiliensis clustered completely apart from each other. There was a correlation of 0.58 between recA and 16S rDNA pairwise similarities. Strains of the same species have at least 94 % recA sequence similarity. recA gene sequences are much more discriminatory than 16S rDNA. For 16S rDNA similarity values above 98 % there was a wide range of recA similarities, from 83 to 99 %.
KeywordMeSH Terms
Genes, Bacterial
29. Wolfe  AJ, Millikan  DS, Campbell  JM, Visick  KL,     ( 2004 )

Vibrio fischeri sigma54 controls motility, biofilm formation, luminescence, and colonization.

Applied and environmental microbiology 70 (4)
PMID : 15066853  :   DOI  :   10.1128/aem.70.4.2520-2524.2004     PMC  :   PMC383144    
Abstract >>
In this study, we demonstrated that the putative Vibrio fischeri rpoN gene, which encodes sigma(54), controls flagellar biogenesis, biofilm development, and bioluminescence. We also show that rpoN plays a requisite role initiating the symbiotic association of V. fischeri with juveniles of the squid Euprymna scolopes.
KeywordMeSH Terms
DNA-Binding Proteins
30. Ast  JC, Dunlap  PV,     ( 2004 )

Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

Archives of microbiology 181 (5)
PMID : 15034641  :   DOI  :   10.1007/s00203-004-0663-7    
Abstract >>
The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon (luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene (luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).
KeywordMeSH Terms
Genes, Bacterial
Operon
31. Weng  SF, Chao  YF, Lin  JW,     ( 2004 )

Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

Biochemical and biophysical research communications 314 (3)
PMID : 14741712  :   DOI  :   10.1016/j.bbrc.2003.12.171    
Abstract >>
Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response.
KeywordMeSH Terms
32. Nishiguchi  MK, Nair  VS,     ( 2003 )

Evolution of symbiosis in the Vibrionaceae: a combined approach using molecules and physiology.

International journal of systematic and evolutionary microbiology 53 (Pt 6)
PMID : 14657139  :   DOI  :   10.1099/ijs.0.02792-0    
Abstract >>
The family Vibrionaceae is considered to be one of the most diverse and well-studied groups of bacteria. Here, evolution is assessed within the Vibrionaceae to determine whether multiple origins of eukaryotic associations have occurred within this diverse group of bacteria. Analyses were based on a large molecular dataset, along with a matrix that consisted of 100 biochemical and restriction digest characters. By using direct optimization methods to analyse both datasets individually and in combination, a total-evidence cladogram has been produced, which supports the hypothesis that several important symbionts (both mutualistic and pathogenic) within the Vibrionaceae are not monophyletic. This leads us to consider that symbiosis (and subsequently, associations with Eukarya) has evolved multiple times within the Vibrionaceae lineage.
KeywordMeSH Terms
Biological Evolution
Phylogeny
33. Whistler  CA, Ruby  EG,     ( 2003 )

GacA regulates symbiotic colonization traits of Vibrio fischeri and facilitates a beneficial association with an animal host.

Journal of bacteriology 185 (24)
PMID : 14645281  :   DOI  :   10.1128/jb.185.24.7202-7212.2003     PMC  :   PMC296250    
Abstract >>
The GacS/GacA two-component system regulates the expression of bacterial traits during host association. Although the importance of GacS/GacA as a regulator of virulence is well established, its role in benign associations is not clear, as mutations in either the gacS or gacA gene have little impact on the success of colonization in nonpathogenic associations studied thus far. Using as a model the symbiotic association of the bioluminescent marine bacterium Vibrio fischeri with its animal host, the Hawaiian bobtail squid, Euprymna scolopes, we investigated the role of GacA in this beneficial animal-microbe interaction. When grown in culture, gacA mutants were defective in several traits important for symbiosis, including luminescence, growth in defined media, growth yield, siderophore activity, and motility. However, gacA mutants were not deficient in production of acylated homoserine lactone signals or catalase activity. The ability of the gacA mutants to initiate squid colonization was impaired but not abolished, and they reached lower-than-wild-type population densities within the host light organ. In contrast to their dark phenotype in culture, gacA mutants that reached population densities above the luminescence detection limit had normal levels of luminescence per bacterial cell in squid light organs, indicating that GacA is not required for light production within the host. The gacA mutants were impaired at competitive colonization and could only successfully cocolonize squid light organs when present in the seawater at higher inoculum densities than wild-type bacteria. Although severely impaired during colonization initiation, gacA mutants were not displaced by the wild-type strain in light organs that were colonized with both strains. This study establishes the role of GacA as a regulator of a beneficial animal-microbe association and indicates that GacA regulates utilization of growth substrates as well as other colonization traits.
KeywordMeSH Terms
Symbiosis
34. Preheim  SP, Timberlake  S, Polz  MF,     ( 2011 )

Merging taxonomy with ecological population prediction in a case study of Vibrionaceae.

Applied and environmental microbiology 77 (20)
PMID : 21873482  :   DOI  :   10.1128/AEM.00665-11     PMC  :   PMC3194886    
Abstract >>
We synthesized population structure data from three studies that assessed the fine-scale distribution of Vibrionaceae among temporally and spatially distinct environmental categories in coastal seawater and animals. All studies used a dynamic model (AdaptML) to identify phylogenetically cohesive and ecologically distinct bacterial populations and their predicted habitats without relying on a predefined genetic cutoff or relationships to previously named species. Across the three studies, populations were highly overlapping, displaying similar phylogenetic characteristics (identity and diversity), and were predominantly congruent with taxonomic Vibrio species previously characterized as genotypic clusters by multilocus sequence analysis (MLSA). The environmental fidelity of these populations appears high, with 9 out of 12 reproducibly associating with the same predicted (micro)habitats when similar environmental categories were sampled. Overall, this meta-analysis provides information on the habitat predictability and structure of previously described species, demonstrating that MLSA-based taxonomy can, at least in some cases, serve to approximate ecologically cohesive populations.
KeywordMeSH Terms
Ecosystem
Environmental Microbiology
35. Wollenberg  MS, Ruby  EG,     ( 2012 )

Phylogeny and fitness of Vibrio fischeri from the light organs of Euprymna scolopes in two Oahu, Hawaii populations.

The ISME journal 6 (2)
PMID : 21776028  :   DOI  :   10.1038/ismej.2011.92     PMC  :   PMC3260510    
Abstract >>
The evolutionary relationship among Vibrio fischeri isolates obtained from the light organs of Euprymna scolopes collected around Oahu, Hawaii, were examined in this study. Phylogenetic reconstructions based on a concatenation of fragments of four housekeeping loci (recA, mdh, katA, pyrC) identified one monophyletic group ('Group-A') of V. fischeri from Oahu. Group-A V. fischeri strains could also be identified by a single DNA fingerprint type. V. fischeri strains with this fingerprint type had been observed to be at a significantly higher abundance than other strains in the light organs of adult squid collected from Maunalua Bay, Oahu, in 2005. We hypothesized that these previous observations might be related to a growth/survival advantage of the Group-A strains in the Maunalua Bay environments. Competition experiments between Group-A strains and non-Group-A strains demonstrated an advantage of the former in colonizing juvenile Maunalua Bay hosts. Growth and survival assays in Maunalua Bay seawater microcosms revealed a reduced fitness of Group-A strains relative to non-Group-A strains. From these results, we hypothesize that there may exist trade-offs between growth in the light organ and in seawater environments for local V. fischeri strains from Oahu. Alternatively, Group-A V. fischeri may represent an example of rapid, evolutionarily significant, specialization of a horizontally transmitted symbiont to a local host population.
KeywordMeSH Terms
Phylogeny
36. Bose  JL, Wollenberg  MS, Colton  DM, Mandel  MJ, Septer  AN, Dunn  AK, Stabb  EV,     ( 2011 )

Contribution of rapid evolution of the luxR-luxI intergenic region to the diverse bioluminescence outputs of Vibrio fischeri strains isolated from different environments.

Applied and environmental microbiology 77 (7)
PMID : 21317265  :   DOI  :   10.1128/AEM.02643-10     PMC  :   PMC3067414    
Abstract >>
Vibrio fischeri serves as a valuable model of bacterial bioluminescence, its regulation, and its functional significance. Light output varies more than 10,000-fold in wild-type isolates from different environments, yet dim and bright strains have similar organization of the light-producing lux genes, with the activator-encoding luxR divergently transcribed from luxICDABEG. By comparing the genomes of bright strain MJ11 and the dimmer ES114, we found that the lux region has diverged more than most shared orthologs, including those flanking lux. Divergence was particularly high in the intergenic sequence between luxR and luxI. Analysis of the intergenic lux region from 18 V. fischeri strains revealed that, with one exception, sequence divergence essentially mirrored strain phylogeny but with relatively high substitution rates. The bases conserved among intergenic luxR-luxI sequences included binding sites for known regulators, such as LuxR and ArcA, and bases of unknown significance, including a striking palindromic repeat. By using this collection of diverse luxR-luxI regions, we found that expression of P(luxI)-lacZ but not P(luxR)-lacZ transcriptional reporters correlated with the luminescence output of the strains from which the promoters originated. We also found that exchange of a small stretch of the luxI-luxR intergenic region between two strains largely reversed their relative brightness. Our results show that the luxR-luxI intergenic region contributes significantly to the variable luminescence output among V. fischeri strains isolated from different environments, although other elements of strain backgrounds also contribute. Moreover, the lux system appears to have evolved relatively rapidly, suggesting unknown environment-specific selective pressures.
KeywordMeSH Terms
DNA, Intergenic
Gene Expression Regulation, Bacterial
Polymorphism, Genetic
37. De Jonge  N, Hohlweg  W, Garcia-Pino  A, Respondek  M, Buts  L, Haesaerts  S, Lah  J, Zangger  K, Loris  R,     ( 2010 )

Structural and thermodynamic characterization of Vibrio fischeri CcdB.

The Journal of biological chemistry 285 (8)
PMID : 19959472  :   DOI  :   10.1074/jbc.M109.068429     PMC  :   PMC2820787    
Abstract >>
CcdB(Vfi) from Vibrio fischeri is a member of the CcdB family of toxins that poison covalent gyrase-DNA complexes. In solution CcdB(Vfi) is a dimer that unfolds to the corresponding monomeric components in a two-state fashion. In the unfolded state, the monomer retains a partial secondary structure. This observation correlates well with the crystal and NMR structures of the protein, which show a dimer with a hydrophobic core crossing the dimer interface. In contrast to its F plasmid homologue, CcdB(Vfi) possesses a rigid dimer interface, and the apparent relative rotations of the two subunits are due to structural plasticity of the monomer. CcdB(Vfi) shows a number of non-conservative substitutions compared with the F plasmid protein in both the CcdA and the gyrase binding sites. Although variation in the CcdA interaction site likely determines toxin-antitoxin specificity, substitutions in the gyrase-interacting region may have more profound functional implications.
KeywordMeSH Terms
Protein Multimerization
38. Ast  JC, Urbanczyk  H, Dunlap  PV,     ( 2009 )

Multi-gene analysis reveals previously unrecognized phylogenetic diversity in Aliivibrio.

Systematic and applied microbiology 32 (6)
PMID : 19481895  :   DOI  :   10.1016/j.syapm.2009.04.005    
Abstract >>
The "Vibrio fischeri species group" recently was reclassified as a new genus, Aliivibrio, comprising four species, Aliivibrio fischeri, Aliivibrio logei, Aliivibrio salmonicida, and Aliivibrio wodanis. Only limited phylogenetic analysis of strains within Aliivibrio has been carried out, however, and taxonomic ambiguity is evident within this group, especially for phenotypically unusual strains and certain strains isolated from bioluminescent symbioses. Therefore, to examine in depth the evolutionary relationships within Aliivibrio and redefine the host affiliations of symbiotic species, we examined several previously identified and newly isolated strains using phylogenetic analysis based on multiple independent loci, gapA, gyrB, pyrH, recA, rpoA, the luxABE region, and the 16S rRNA gene. The analysis resolved Aliivibrio as distinct from Vibrio, Photobacterium, and other genera of Vibrionaceae, and resolved A. fischeri, A. salmonicida, A. logei, and A. wodanis as distinct, well-supported clades. However, it also revealed that several previously reported strains are incorrectly identified and that substantial unrecognized diversity exists in this genus. Specifically, strain ATCC 33715 (Y-1) and several other strains having a yellow-shifted luminescence were not members of A. fischeri. Furthermore, no strain previously identified as A. logei grouped with the type strain (ATCC 29985(T)), and no bona-fide strain of A. logei was identified as a bioluminescent symbiont. Several additional strains identified previously as A. logei group instead with the type strain of A. wodanis (ATCC BAA-104(T)), or are members of a new clade. Two strongly supported clades were evident within A. fischeri, a phylogenetic structure that might reflect differences in the host species or differences in the ecological incidence of strains. The results of this study highlight the importance of basing taxonomic conclusions on examination of type strains.
KeywordMeSH Terms
Genetic Variation
Phylogeny
Sequence Analysis, DNA
39. Chimetto  LA, Brocchi  M, Gondo  M, Thompson  CC, Gomez-Gil  B, Thompson  FL,     ( 2009 )

Genomic diversity of vibrios associated with the Brazilian coral Mussismilia hispida and its sympatric zoanthids (Palythoa caribaeorum, Palythoa variabilis and Zoanthus solanderi).

Journal of applied microbiology 106 (6)
PMID : 19291243  :   DOI  :   10.1111/j.1365-2672.2009.04149.x    
Abstract >>
A taxonomic survey of the vibrios associated with the Brazilian endemic coral Mussismilia hispida and the sympatric zoanthids (i.e. Palythoa caribaeorum, Palythoa variabilis and Zoanthus solanderi). Mucus of 54 cnidarian specimens collected in three different places at S?o Sebasti?o in two consecutive years (i.e. 2005 and 2006) was used for taxonomic characterization of the cnidarian microbiota. Ninety-eight of the 151 vibrio isolates fell within the vibrio core group according to partial 16S rDNA sequences. We performed the sequencing of recA and pyrH genes of all vibrio isolates. The most abundant taxa belonged to the vibrio core group (Vibrio harveyi, Vibrio rotiferianus, Vibrio campbellii and Vibrio alginolyticus), Vibrio mediterranei (=Vibrio shillonii) and Vibrio chagasii. With the exception of V. chagasii which was found only in the mucus of M. hispida, the other species appeared in different hosts with no evidence for the presence of host-specific clones or species. Using rep-PCR analysis, we observed a high genomic heterogeneity within the vibrios. Each vibrio isolate generated a different rep-PCR fingerprint pattern. There was a complete agreement between the grouping based on rep-PCR and concatenated sequences of pyrH, recA and 16S rDNA, but the pyrH gene has the highest discriminatory power for vibrio species identification. The vibrio core group is dominant in the mucus of these cnidarians. There is a tremendous diversity of vibrio lineages within the coral mucus. pyrH gene sequences permit a clear-cut identification of vibrios. The taxonomic resolution provided by pyrH (but not recA) appears to be enough for identifying species of vibrios and for disclosing putative new taxa. The vibrio core group appears to be dominant in the mucus of the Brazilian cnidarians. The overrepresentation of these vibrios may reflect as yet unknown ecological functions in the coral holobiont.
KeywordMeSH Terms
40. Kumar  S, Parvathi  A, Hernandez  RL, Cadle  KM, Varela  MF,     ( 2009 )

Identification of a novel UDP-N-acetylglucosamine enolpyruvyl transferase (MurA) from Vibrio fischeri that confers high fosfomycin resistance in Escherichia coli.

Archives of microbiology 191 (5)
PMID : 19277606  :   DOI  :   10.1007/s00203-009-0468-9     PMC  :   PMC2673340    
Abstract >>
MurA [UDP-N-acetylglucosamine (UDP-NAG) enolpyruvyl transferase] is a key enzyme involved in bacterial cell wall peptidoglycan synthesis and a target for the antimicrobial agent fosfomycin, a structural analog of the MurA substrate phosphoenol pyruvate. In this study, we identified, cloned and sequenced a novel murA gene from an environmental isolate of Vibrio fischeri that is naturally resistant to fosfomycin. The fosfomycin resistance gene was isolated from a genomic DNA library of V. fischeri. An antimicrobial agent hypersensitive strain of Escherichia coli harboring murA from V. fischeri exhibited a high fosfomycin resistance phenotype, with minimum inhibitory concentration of 3,000 microg/ml. The cloned murA gene was 1,269 bp long encoding a 422 amino acid polypeptide with an estimated pI of 5.0. The deduced amino acid sequence of the putative protein was identified as UDP-NAG enolpyruvyl transferase by homology comparison. The MurA protein with an estimated molecular weight of 44.7 kDa was expressed in E. coli and purified by affinity chromatography. MurA of V. fischeri will be a useful target to identify potential inhibitors of fosfomycin resistance in pharmacological studies.
KeywordMeSH Terms
41. Mandel  MJ, Wollenberg  MS, Stabb  EV, Visick  KL, Ruby  EG,     ( 2009 )

A single regulatory gene is sufficient to alter bacterial host range.

Nature 458 (7235)
PMID : 19182778  :   DOI  :   10.1038/nature07660     PMC  :   PMC2713604    
Abstract >>
Microbial symbioses are essential for the normal development and growth of animals. Often, symbionts must be acquired from the environment during each generation, and identification of the relevant symbiotic partner against a myriad of unwanted relationships is a formidable task. Although examples of this specificity are well-documented, the genetic mechanisms governing it are poorly characterized. Here we show that the two-component sensor kinase RscS is necessary and sufficient for conferring efficient colonization of Euprymna scolopes squid by bioluminescent Vibrio fischeri from the North Pacific Ocean. In the squid symbiont V. fischeri ES114, RscS controls light-organ colonization by inducing the Syp exopolysaccharide, a mediator of biofilm formation during initial infection. A genome-level comparison revealed that rscS, although present in squid symbionts, is absent from the fish symbiont V. fischeri MJ11. We found that heterologous expression of RscS in strain MJ11 conferred the ability to colonize E. scolopes in a manner comparable to that of natural squid isolates. Furthermore, phylogenetic analyses support an important role for rscS in the evolution of the squid symbiosis. Our results demonstrate that a regulatory gene can alter the host range of animal-associated bacteria. We show that, by encoding a regulator and not an effector that interacts directly with the host, a single gene can contribute to the evolution of host specificity by switching 'on' pre-existing capabilities for interaction with animal tissue.
KeywordMeSH Terms
42. Browne-Silva  J, Nishiguchi  MK,     ( 2008 )

Gene sequences of the pil operon reveal relationships between symbiotic strains of Vibrio fischeri.

International journal of systematic and evolutionary microbiology 58 (Pt 6)
PMID : 18523167  :   DOI  :   10.1099/ijs.0.65370-0     PMC  :   PMC3374725    
Abstract >>
Symbiosis between the bobtail squid Euprymna scolopes (Mollusca: Cephalopoda) and Vibrio fischeri bacteria has been a well-studied model for understanding the molecular mechanisms of colonization and adherence to host cells. For example, pilin expression has been observed to cause subtle variation in colonization for a number of Gram-negative bacteria with eukaryotic hosts. To investigate variation amongst pil genes of closely related strains of vibrios, we amplified pil genes A, B, C and D to determine orientation and sequence similarity to other symbiotic vibrios. The pilA gene was found to be upstream from all other pil genes, and not contiguous with the rest of the operon. The pilB, pilC and pilD loci were flanked at the 3' end by yacE, followed by a conserved hypothetical gene. DNA sequences of each pil gene were aligned and analysed phylogenetically using parsimony for both individual and combined gene trees. Results demonstrate that certain pil loci (pilB and pilD) are conserved among strains of V. fischeri, but pilC differs in sequence between symbiotic and free-living strains. Phylogenetic analysis of all pil genes gives better resolution of Indo-west Pacific V. fischeri symbionts compared with analysis of the 16S rRNA gene. Hawaiian and Australian symbiotic strains form one monophyletic tree, supporting the hypothesis that V. fischeri strain specificity is selected by the geographical location of their hosts and is not related to specific squid species.
KeywordMeSH Terms
Sequence Analysis, DNA
Symbiosis
43. Thompson  CC, Thompson  FL, Vicente  AC, Swings  J,     ( 2007 )

Phylogenetic analysis of vibrios and related species by means of atpA gene sequences.

International journal of systematic and evolutionary microbiology 57 (Pt 11)
PMID : 17978204  :   DOI  :   10.1099/ijs.0.65223-0    
Abstract >>
We investigated the use of atpA gene sequences as alternative phylogenetic and identification markers for vibrios. A fragment of 1322 bp (corresponding to approximately 88% of the coding region) was analysed in 151 strains of vibrios. The relationships observed were in agreement with the phylogeny inferred from 16S rRNA gene sequence analysis. For instance, the Vibrio cholerae, Vibrio halioticoli, Vibrio harveyi and Vibrio splendidus species groups appeared in the atpA gene phylogenetic analyses, suggesting that these groups may be considered as separate genera within the current Vibrio genus. Overall, atpA gene sequences appeared to be more discriminatory for species differentiation than 16S rRNA gene sequences. 16S rRNA gene sequence similarities above 97% corresponded to atpA gene sequences similarities above 80%. The intraspecies variation in the atpA gene sequence was about 99% sequence similarity. The results showed clearly that atpA gene sequences are a suitable alternative for the identification and phylogenetic study of vibrios.
KeywordMeSH Terms
Bacterial Typing Techniques
Phylogeny
Sequence Analysis, DNA
44. Bose  JL, Kim  U, Bartkowski  W, Gunsalus  RP, Overley  AM, Lyell  NL, Visick  KL, Stabb  EV,     ( 2007 )

Bioluminescence in Vibrio fischeri is controlled by the redox-responsive regulator ArcA.

Molecular microbiology 65 (2)
PMID : 17590235  :   DOI  :   10.1111/j.1365-2958.2007.05809.x    
Abstract >>
Bioluminescence generated by the Vibrio fischeri Lux system consumes oxygen and reducing power, and it has been proposed that cells use this to counteract either oxidative stress or the accumulation of excess reductant. These models predict that lux expression should respond to redox conditions; yet no redox-responsive regulator of lux is known. We found that the luxICDABEG operon responsible for bioluminescence is repressed by the ArcAB system, which is activated under reducing conditions. Consistent with a role for ArcAB in connecting redox monitoring to lux regulation, adding reductant decreased luminescence in an arc-dependent manner. ArcA binds to and regulates transcription from the luxICDABEG promoter, and it represses luminescence both in the bright strain MJ1 and in ES114, an isolate from the squid Euprymna scolopes that is not visibly luminescent in culture. In ES114, deleting arcA increased luminescence in culture approximately 500-fold to visible levels comparable to that of symbiotic cells. ArcA did not repress symbiotic luminescence, but by 48 h after inoculation, ArcA did contribute to colonization competitiveness. We hypothesize that inactivation of ArcA in response to oxidative stress during initial colonization derepresses luxICDABEG, but that ArcAB actively regulates other metabolic pathways in the more reduced environment of an established infection.
KeywordMeSH Terms
Gene Expression Regulation, Bacterial
Luminescence
45. Devine  JH, Shadel  GS, Baldwin  TO,     ( 1989 )

Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744.

Proceedings of the National Academy of Sciences of the United States of America 86 (15)
PMID : 2762291  :   DOI  :   10.1073/pnas.86.15.5688     PMC  :   PMC297695    
Abstract >>
Escherichia coli that carry a recombinant plasmid bearing the Vibrio fischeri lux regulon express luminescence that mimics the luminescence of V. fischeri. The lux regulon consists of two divergently transcribed operons, the rightward operon (luxICDABE genes) and the leftward operon (luxR gene). The luxR and luxI genes and the control region separating the two operons supply the primary regulatory control over the lux regulon; the regulatory mechanisms result in a dramatic increase in the rate of luciferase synthesis after induction, apparently due to a unique autoregulatory positive feedback mechanism, and in an enormous difference (greater than 10(4] in levels of luminescence in cells before and after induction. The generally accepted model of primary regulation of bioluminescence in V. fischeri involves the interaction of the product of the luxR gene and N-(3-oxohexanoyl)homoserine lactone, the autoinducer produced by the enzyme encoded by luxI, the first gene of the rightward operon, with an operator sequence within the control region to stimulate transcription of the rightward operon in a positive feedback loop. We have used deletion mapping of a transcription reporter vector to determine the approximate location of the operator. By site-directed mutagenesis of the presumed operator, we have demonstrated that the 20-base-pair inverted repeat ACCTGTAGGA/TCGTA CAGGT (where the vertical line is the center of symmetry), which bears striking similarity to the recognition sequence for the pleiotropic repressor protein LexA, is the operator of the lux regulon. We also found that deletion of sequences upstream of the palindrome leads to increased transcription from the rightward promoter (PR), indicative of a cis-acting element that represses transcription in the absence of the LuxR-autoinducer complex. Modifications of the palindrome that eliminate stimulation by LuxR-autoinducer of transcription from PR have no effect on repression by the cis-acting mechanism(s), suggesting that the palindrome is not necessary for repression of the rightward operon. Thus, it appears that the large increase in transcription upon induction of the lux regulon is the result of at least two independent mechanisms, one positive and the other negative.
KeywordMeSH Terms
Genes, Bacterial
Genes, Regulator
Operon
46. Volbeda  A, Darnault  C, Renoux  O, Nicolet  Y, Fontecilla-Camps  JC,     ( 2015 )

The crystal structure of the global anaerobic transcriptional regulator FNR explains its extremely fine-tuned monomer-dimer equilibrium.

Science advances 1 (11)
PMID : 26665177  :   DOI  :   10.1126/sciadv.1501086     PMC  :   PMC4672761    
Abstract >>
The structure of the dimeric holo-fumarate and nitrate reduction regulator (FNR) from Aliivibrio fischeri has been solved at 2.65 ? resolution. FNR globally controls the transition between anaerobic and aerobic respiration in facultative anaerobes through the assembly/degradation of its oxygen-sensitive [4Fe-4S] cluster. In the absence of O2, FNR forms a dimer and specifically binds to DNA, whereas in its presence, the cluster is degraded causing FNR monomerization and DNA dissociation. We have used our crystal structure and the information previously gathered from numerous FNR variants to propose that this process is governed by extremely fine-tuned interactions, mediated by two salt bridges near the amino-terminal cluster-binding domain and an "imperfect" coiled-coil dimer interface. [4Fe-4S] to [2Fe-2S] cluster degradation propagates a conformational signal that indirectly causes monomerization by disrupting the first of these interactions and unleashing the "unzipping" of the FNR dimer in the direction of the carboxyl-terminal DNA binding domain.
KeywordMeSH Terms
Fumarate and Nitrate Reduction regulator (FNR)
biochemisty
biomolecules
crystal structure
47. Sun  Y, LaSota  ED, Cecere  AG, LaPenna  KB, Larios-Valencia  J, Wollenberg  MS, Miyashiro  T,     ( 2016 )

Intraspecific Competition Impacts Vibrio fischeri Strain Diversity during Initial Colonization of the Squid Light Organ.

Applied and environmental microbiology 82 (10)
PMID : 27016564  :   DOI  :   10.1128/AEM.04143-15     PMC  :   PMC4959073    
Abstract >>
Animal development and physiology depend on beneficial interactions with microbial symbionts. In many cases, the microbial symbionts are horizontally transmitted among hosts, thereby making the acquisition of these microbes from the environment an important event within the life history of each host. The light organ symbiosis established between the Hawaiian squid Euprymna scolopes and the bioluminescent bacterium Vibrio fischeri is a model system for examining how hosts acquire horizontally transmitted microbial symbionts. Recent studies have revealed that the light organ of wild-caught E. scolopes squid contains polyclonal populations of V. fischeri bacteria; however, the function and development of such strain diversity in the symbiosis are unknown. Here, we report our phenotypic and phylogenetic characterizations of FQ-A001, which is a V. fischeri strain isolated directly from the light organ of an E. scolopes individual. Relative to the type strain ES114, FQ-A001 exhibits similar growth in rich medium but displays increased bioluminescence and decreased motility in soft agar. FQ-A001 outcompetes ES114 in colonizing the crypt spaces of the light organs. Remarkably, we find that animals cocolonized with FQ-A001 and ES114 harbor singly colonized crypts, in contrast to the cocolonized crypts observed from competition experiments involving single genotypes. The results with our two-strain system suggest that strain diversity within the squid light organ is a consequence of diversity in the single-strain colonization of individual crypt spaces. The developmental programs and overall physiologies of most animals depend on diverse microbial symbionts that are acquired from the environment. However, the basic principles underlying how microbes colonize their hosts remain poorly understood. Here, we report our findings of bacterial strain competition within the coevolved animal-microbe symbiosis composed of the Hawaiian squid and bioluminescent bacterium Vibrio fischeri Using fluorescent proteins to differentially label two distinct V. fischeri strains, we find that the strains are unable to coexist in the same niche within the host. Our results suggest that strain competition for distinct colonization sites dictates the strain diversity associated with the host. Our study provides a platform for studying how strain diversity develops within a host.
KeywordMeSH Terms
Genetic Variation
Symbiosis
48. Machado  H, Gram  L,     ( 2015 )

The fur gene as a new phylogenetic marker for Vibrionaceae species identification.

Applied and environmental microbiology 81 (8)
PMID : 25662978  :   DOI  :   10.1128/AEM.00058-15     PMC  :   PMC4375339    
Abstract >>
Microbial taxonomy is essential in all areas of microbial science. The 16S rRNA gene sequence is one of the main phylogenetic species markers; however, it does not provide discrimination in the family Vibrionaceae, where other molecular techniques allow better interspecies resolution. Although multilocus sequence analysis (MLSA) has been used successfully in the identification of Vibrio species, the technique has several limitations. They include the fact that several locus amplifications and sequencing have to be performed, which still sometimes lead to doubtful identifications. Using an in silico approach based on genomes from 103 Vibrionaceae strains, we demonstrate here the high resolution of the fur gene in the identification of Vibrionaceae species and its usefulness as a phylogenetic marker. The fur gene showed within-species similarity higher than 95%, and the relationships inferred from its use were in agreement with those observed for 16S rRNA analysis and MLSA. Furthermore, we developed a fur PCR sequencing-based method that allowed identification of Vibrio species. The discovery of the phylogenetic power of the fur gene and the development of a PCR method that can be used in amplification and sequencing of the gene are of general interest whether for use alone or together with the previously suggested loci in an MLSA.
KeywordMeSH Terms
Phylogeny
49. Wendling  CC, Batista  FM, Wegner  KM,     ( 2014 )

Persistence, seasonal dynamics and pathogenic potential of Vibrio communities from Pacific oyster hemolymph.

PloS one 9 (4)
PMID : 24728233  :   DOI  :   10.1371/journal.pone.0094256     PMC  :   PMC3984124    
Abstract >>
Bacteria of the genus Vibrio occur at a continuum from free-living to symbiotic life forms, including opportunists and pathogens, that can contribute to severe diseases, for instance summer mortality events of Pacific oysters Crassostrea gigas. While most studies focused on Vibrio isolated from moribund oysters during mortality outbreaks, investigations of the Vibrio community in healthy oysters are rare. Therefore, we characterized the persistence, diversity, seasonal dynamics, and pathogenicity of the Vibrio community isolated from healthy Pacific oysters. In a reciprocal transplant experiment we repeatedly sampled hemolymph from adult Pacific oysters to differentiate population from site-specific effects during six months of in situ incubation in the field. We characterized virulence phenotypes and genomic diversity based on multilocus sequence typing in a total of 70 Vibrio strains. Based on controlled infection experiments we could show that strains with the ability to colonize healthy adult oysters can also have the potential to induce high mortality rates on larvae. Diversity and abundance of Vibrio varied significantly over time with highest values during and after spawning season. Vibrio communities from transplanted and stationary oysters converged over time, indicating that communities were not population specific, but rather assemble from the surrounding environment forming communities, some of which can persist over longer periods.
KeywordMeSH Terms
Seasons
50. Xue  H, Cordero  OX, Camas  FM, Trimble  W, Meyer  F, Guglielmini  J, Rocha  EP, Polz  MF,     ( 2015 )

Eco-Evolutionary Dynamics of Episomes among Ecologically Cohesive Bacterial Populations.

mBio 6 (3)
PMID : 25944863  :   DOI  :   10.1128/mBio.00552-15     PMC  :   PMC4436056    
Abstract >>
Although plasmids and other episomes are recognized as key players in horizontal gene transfer among microbes, their diversity and dynamics among ecologically structured host populations in the wild remain poorly understood. Here, we show that natural populations of marine Vibrionaceae bacteria host large numbers of families of episomes, consisting of plasmids and a surprisingly high fraction of plasmid-like temperate phages. Episomes are unevenly distributed among host populations, and contrary to the notion that high-density communities in biofilms act as hot spots of gene transfer, we identified a strong bias for episomes to occur in free-living as opposed to particle-attached cells. Mapping of episomal families onto host phylogeny shows that, with the exception of all phage and a few plasmid families, most are of recent evolutionary origin and appear to have spread rapidly by horizontal transfer. Such high eco-evolutionary turnover is particularly surprising for plasmids that are, based on previously suggested categorization, putatively nontransmissible, indicating that this type of plasmid is indeed frequently transferred by currently unknown mechanisms. Finally, analysis of recent gene transfer among plasmids reveals a network of extensive exchange connecting nearly all episomes. Genes functioning in plasmid transfer and maintenance are frequently exchanged, suggesting that plasmids can be rapidly transformed from one category to another. The broad distribution of episomes among distantly related hosts and the observed promiscuous recombination patterns show how episomes can offer their hosts rapid assembly and dissemination of novel functions. Plasmids and other episomes are an integral part of bacterial biology in all environments, yet their study is heavily biased toward their role as vectors for antibiotic resistance genes. This study presents a comprehensive analysis of all episomes within several coexisting bacterial populations of Vibrionaceae from the coastal ocean and represents the largest-yet genomic survey of episomes from a single bacterial family. The host population framework allows analysis of the eco-evolutionary dynamics at unprecedented resolution, yielding several unexpected results. These include (i) discovery of novel, nonintegrative temperate phages, (ii) revision of a class of episomes, previously termed nontransmissible," as highly transmissible, and (iii) surprisingly high evolutionary turnover of episomes, manifest as frequent birth, spread, and loss."
KeywordMeSH Terms
Evolution, Molecular
Gene Transfer, Horizontal
Plasmids
51. De Jonge  N, Simic  M, Buts  L, Haesaerts  S, Roelants  K, Garcia-Pino  A, Sterckx  Y, De Greve  H, Lah  J, Loris  R,     ( 2012 )

Alternative interactions define gyrase specificity in the CcdB family.

Molecular microbiology 84 (5)
PMID : 22582791  :   DOI  :   10.1111/j.1365-2958.2012.08069.x    
Abstract >>
Toxin-antitoxin (TA) modules are small operons associated with stress response of bacteria. F-plasmid CcdB(F) was the first TA toxin for which its target, gyrase, was identified. Plasmidic and chromosomal CcdBs belong to distinct families. Conserved residues crucial for gyrase poisoning activity of plasmidic CcdBs are not conserved among these families. Here we show that the chromosomal CcdB(Vfi) from Vibrio fischeri is an active gyrase poison that interacts with its target via an alternative energetic mechanism. Changes in the GyrA14-binding surface of the Vibrio and F-plasmid CcdB family members illustrate neutral drift where alternative interactions can be used to achieve the same functionality. Differences in affinity between V. fischeri and F-plasmid CcdB for gyrase and their corresponding CcdA antitoxin possibly reflect distinct roles for TA modules located on plasmids and chromosomes.
KeywordMeSH Terms
Topoisomerase II Inhibitors
52. Swartzman  A, Kapoor  S, Graham  AF, Meighen  EA,     ( 1990 )

A new Vibrio fischeri lux gene precedes a bidirectional termination site for the lux operon.

Journal of bacteriology 172 (12)
PMID : 2254256  :   DOI  :   10.1128/jb.172.12.6797-6802.1990     PMC  :   PMC210795    
Abstract >>
The DNA downstream of the lux structural genes in the Vibrio fischeri lux operon has been sequenced and a new lux gene (luxG) has been identified. A hairpin loop that begins with a poly(A) region and ends with a poly(T) region and thus can function as a bidirectional termination site for luxG and a convergent gene is located immediately downstream of luxG. 3' S1 nuclease mapping has demonstrated that the luxG mRNA was induced in a cell-density-dependent fashion consistent with it being part of the lux system and that the lux mRNA terminated immediately after the hairpin loop. The mRNA coded by an open reading frame convergent to luxG on the complementary strand was also shown by S1 nuclease mapping to overlap the lux mRNA for at least 20 nucleotides before termination. Expression of DNA containing the hairpin loop, placed between a strong promoter and a reporter gene and transferred by conjugation into luminescent bacteria, demonstrated the very high efficiency of termination by this hairpin loop oriented in either direction. These results also demonstrate that the organization of the genes at the 3' ends of the lux operons of V. fischeri and V. harveyi has clearly diverged.
KeywordMeSH Terms
Genes, Bacterial
Luminescent Measurements
53. Wollenberg  MS, Preheim  SP, Polz  MF, Ruby  EG,     ( 2012 )

Polyphyly of non-bioluminescent Vibrio fischeri sharing a lux-locus deletion.

Environmental microbiology 14 (3)
PMID : 21980988  :   DOI  :   10.1111/j.1462-2920.2011.02608.x     PMC  :   PMC3655796    
Abstract >>
This study reports the first description and molecular characterization of naturally occurring, non-bioluminescent strains of Vibrio fischeri. These 'dark' V. fischeri strains remained non-bioluminescent even after treatment with both autoinducer and aldehyde, substrate additions that typically maximize light production in dim strains of luminous bacteria. Surprisingly, the entire lux locus (eight genes) was absent in over 97% of these dark V. fischeri strains. Although these strains were all collected from a Massachusetts (USA) estuary in 2007, phylogenetic reconstructions allowed us to reject the hypothesis that these newly described non-bioluminescent strains exhibit monophyly within the V. fischeri clade. These dark strains exhibited a competitive disadvantage against native bioluminescent strains when colonizing the light organ of the model V. fischeri host, the Hawaiian bobtail squid Euprymna scolopes. Significantly, we believe that the data collected in this study may suggest the first observation of a functional, parallel locus-deletion event among independent lineages of a non-pathogenic bacterial species.
KeywordMeSH Terms
54. Baldwin  TO, Treat  ML, Daubner  SC,     ( 1990 )

Cloning and expression of the luxY gene from Vibrio fischeri strain Y-1 in Escherichia coli and complete amino acid sequence of the yellow fluorescent protein.

Biochemistry 29 (23)
PMID : 2201407  :   DOI  :   10.1021/bi00475a014    
Abstract >>
Vibrio fischeri strain Y-1 (ATCC 33715) emits light with a lambda max of 545 nm rather than the 485-nm emission typical of other strains of V. fischeri. The yellow emission is due to the interaction of the enzyme luciferase with a yellow fluorescent protein (YFP). On the basis of the N-terminal amino acid sequence of YFP, a mixed-sequence oligonucleotide probe was synthesized and used to isolate a 1.6-kbp HindIII fragment containing the first 208 bases of the gene that codes for YFP (luxY). Another synthetic oligonucleotide complementary to bases 167-184 of the YFP coding sequence was used to isolate a second (ca. 1.9 kbp) DNA fragment generated by digestion with both EcoRI and ClaI that contained the remainder of the luxY gene. The intact luxY gene, which encoded a 22,211-dalton polypeptide composed of 194 amino acid residues, was reconstructed from the two primary clones and is contained within a 765-bp SspI-XhoII fragment. Both strands of the entire luxY coding sequence were determined from the reconstructed gene, while the region surrounding the junction used in the reconstruction was also determined from the original partial clones. As with other genes that have been studied from V. fischeri, the luxY gene was unusually AT-rich. The sequence of luxY did not bear any apparent similarity to any of the sequences contained in the current GenBank database. Escherichia coli containing a plasmid with the luxY gene expresses a protein that reacts with antibody raised to authentic YFP.
KeywordMeSH Terms
Genes, Bacterial
55.     ( 1997 )

Purification and characterization of flavoproteins and cytochromes from the yellow bioluminescence marine bacterium Vibrio fischeri strain Y1.

European journal of biochemistry 245 (3)
PMID : 9183020  :   DOI  :   10.1111/j.1432-1033.1997.00790.x    
Abstract >>
Several flavoproteins and cytochromes that occur as major components in extracts of the yellow bioluminescence Y1 strain of the marine bacterium Vibrio fischeri have been purified and characterized with respect to their mass (SDS/PAGE and matrix-assisted laser-desorption/ionization MS), chromatographic properties, N-terminal sequence, and spectroscopy (absorption, fluorescence emission and anisotropy decay). The investigated proteins were as follows: yellow fluorescence protein (YFP) with bound riboflavin, FMN or 6,7-dimethyl-8-ribityllumazine; a blue fluorescence protein (BFP) with bound 6,7-dimethyl-8-ribityllumazine, riboflavin, or 6-methyl-7-oxo-8-ribityllumazine; thioredoxin reductase with FAD as ligand; and two c-type diheme cytochromes, c551 and c554. We present evidence that the riboflavin-bound YFP has an N-terminal sequence corresponding to that published for the dimeric YFP. We show that an equilibrium replacement of the riboflavin can be made with excess lumazine derivative and that lumazine-bound YFP has different bioluminescence properties to those of the lumazine protein from Photobacterium leiognathi. BFP is a different protein again, and in the bacterial lysate it occurs in multiple forms, ligated to either riboflavin, lumazine, or the 7-oxolumazine derivative. The N-terminal sequence for BFP shows similarities to those of the YFP proteins and to lumazine protein and riboflavin synthase from Photobacterium. BFP in any form has no bioluminescence or riboflavin-synthase activity. A 70-kDa fluorescent flavoprotein with FAD as ligand has an N-terminal sequence highly similar to those of thioredoxin reductases from Haemophilus influenzae and Escherichia coli. Cytochrome contaminations in previous preparations of YFP have been removed and are identified as the two c-type cytochromes c551 and c554. Both inhibit the NADH-induced bioluminescence in the reductase/luciferase system with the luciferases from P. leiognathi and V. fischeri. The N-terminal amino acid sequence of the cytochrome (c551) corresponds to a diheme cytochrome c4. The spectral properties of c554 are similar to those of other c5 cytochromes, and both c554 and c551 have absorption spectra similar to those of the respective cytochromes from the gram-negative bacteria Pseudomonas and Azotobacter.
KeywordMeSH Terms
56.     ( 1993 )

Characterization of a periplasmic 3':5'-cyclic nucleotide phosphodiesterase gene, cpdP, from the marine symbiotic bacterium Vibrio fischeri.

Journal of bacteriology 175 (15)
PMID : 8393003  :   DOI  :   10.1128/jb.175.15.4615-4624.1993     PMC  :   PMC204912    
Abstract >>
Vibrio fischeri, a marine bacterium that forms a bioluminescent symbiosis with certain fish and squids, exhibits the unusual attribute of growth on 3':5'-cyclic AMP (cAMP), apparently through the activity of a 3':5'-cyclic nucleotide phosphodiesterase (3':5'-CNP) with exceptionally high activity. The V. fischeri 3':5'-CNP is located in the periplasm, a novel cellular location for this enzyme in bacteria. To gain insight into the physiological function of this enzyme, we cloned the gene (designated cpdP) encoding it from V. fischeri MJ-1. This is the first bacterial 3':5'-CNP gene to be cloned. Sequencing and analysis of the 1.26-kb cpdP locus revealed a single open reading frame specifying a protein of 330 amino acid residues, including a 22-amino-acid leader peptide. The putative cpdP promoter contained a reasonable -10 promoter region (TATTAT) but contained no obvious -35 region; instead, a 12-bp inverted repeat (TTAAATATTTAA) occurred just upstream of this location. A possible rho-independent transcriptional terminator with a calculated free energy of -21.2 kcal.mol-1 (ca. -88.7 kJ.mol-1) followed the CpdP protein coding sequence. The predicted subunit molecular weight of 33,636 for the mature CpdP protein (36,087 less 2,451 for the leader peptide) was consistent with the molecular weight of 34,000 estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The deduced amino acid sequence of the CpdP protein exhibited 30.3% identity with that of the low-affinity 3':5'-CNP (PDE1) of Saccharomyces cerevisiae and 33.6% identity with that of the extracellular 3':5'-CNP of Dictyostelium discoideum. The residue identities clustered in two regions, residues 100 to 146 and 238 to 269, which contained 30 of the 33 amino acids conserved in all three proteins, 4 of which were histidines. A gene replacement mutant of V. fischeri MJ-1 containing a 0.45-kb BglII deletion within the cpdP gene lacked periplasmic 3':5'-CNP activity and did not grow on cAMP, confirming for V. fischeri the relationship among cpdP, synthesis of the periplasmic 3':5'-CNP, and growth on cAMP. The mutant exhibited no obvious sensitivity to high extracellular concentrations of cAMP (5 and 10 mM), suggesting that the enzyme does not play a role in defense against extracellular cAMP.
KeywordMeSH Terms
57.     ( 1993 )

The gene convergent to luxG in Vibrio fischeri codes for a protein related in sequence to RibG and deoxycytidylate deaminase.

Biochimica et biophysica acta 1143 (3)
PMID : 8329441  :   DOI  :   10.1016/0005-2728(93)90206-u    
Abstract >>
The nucleotide sequence of a convergent gene with the same bidirectional transcriptional terminator as the Vibrio fischeri lux operon has been determined. This gene codes for a polypeptide of 147 amino acids which is related in sequence to the polypeptide coded by the first gene (ribG) of the rib operon of Bacillus subtilis as well as deoxycytidylate deaminase of T4 bacteriophage and Saccharomyces cerevisiae. These results raise the possibility of a linkage between the regulation of the lux genes and riboflavin synthesis in Vibrio fischeri.
KeywordMeSH Terms
Genes, Bacterial
58.     ( 1994 )

The light organ symbiont Vibrio fischeri possesses a homolog of the Vibrio cholerae transmembrane transcriptional activator ToxR.

Journal of bacteriology 176 (10)
PMID : 8188612  :   DOI  :   10.1128/jb.176.10.3085-3088.1994     PMC  :   PMC205469    
Abstract >>
A cross-hybridizing DNA fragment to Vibrio cholerae toxR was cloned from the nonpathogenic light organ symbiont Vibrio fischeri, and three proteins homologous to V. cholerae ToxR, ToxS, and HtpG were deduced from its DNA sequence. V. fischeri ToxR was found to activate a V. cholerae ToxR-regulated promoter, and an antiserum raised against the amino-terminal domain of V. cholerae ToxR cross-reacts V. fischeri ToxR.
KeywordMeSH Terms
Bacterial Proteins
Membrane Proteins
59.     ( 1996 )

Halovibrin, secreted from the light organ symbiont Vibrio fischeri, is a member of a new class of ADP-ribosyltransferases.

Journal of bacteriology 178 (1)
PMID : 8550419  :   DOI  :   10.1128/jb.178.1.209-215.1996     PMC  :   PMC177641    
Abstract >>
The purification, cloning, and deduced amino acid sequence of an ADP-ribosyltransferase secreted from the marine bacterium Vibrio fischeri (V. fischeri ADP-r) is described. This enzyme was purified from culture supernatant, and partial amino acid sequence obtained from the purified protein was used to design a degenerate oligonucleotide probe that was used to clone a cross-hybridizing DNA fragment from V. fischeri genomic DNA. Recombinant Escherichia coli clones harboring this fragment possessed ADP-ribosyltransferase activity. The DNA fragment was sequenced, and deletion analysis localized the ADP-ribosyltransferase activity to one of the three possible open reading frames in the fragment; the deduced amino acid sequence from this open reading frame matched the amino acid sequence obtained from the purified protein. V. fischeri ADP-r has no significant homology (DNA or amino acid) with other known ADP-ribosyltransferases. This enzyme appears to require neither proteolytic cleavage nor a reducing agent for enzymatic activity. The cloned gene is expressed but not secreted in E. coli; however, it is secreted from a heterologous marine Vibrio species. We have named this enzyme halovibrin.
KeywordMeSH Terms
Bacterial Proteins
60.     ( 1994 )

NAD(P)H-flavin oxidoreductase from the bioluminescent bacterium, Vibrio fischeri ATCC 7744, is a flavoprotein.

FEBS letters 347 (2��3��)
PMID : 8033996  :   DOI  :   10.1016/0014-5793(94)00528-1    
Abstract >>
The NAD(P)H-flavin oxidoreductase gene from the bioluminescent bacterium, Vibrio fischeri ATCC 7744, was expressed in Escherichia coli, and the enzyme purified using Cibacron Blue 3G-A affinity column chromatography from crude extracts in a single step. The purified enzyme had a typical flavoprotein absorption spectrum and flavin mononucleotide (FMN) was identified as a prosthetic group, non-covalently bound in a molar ratio of 1:1. The enzyme catalyzed the electron transfer from NADH via FMNH2 to various other electron acceptors. Reduced flavin produced by flavin reductase participated non-enzymatically in the following reactions: H2O2-forming NADH oxidase-like, oxygen-insensitive nitroreductase-like, diaphorase (quinone reductase)-like and bacterial luciferase reactions.
KeywordMeSH Terms
61.     ( 1994 )

Identification of the genes encoding NAD(P)H-flavin oxidoreductases that are similar in sequence to Escherichia coli Fre in four species of luminous bacteria: Photorhabdus luminescens, Vibrio fischeri, Vibrio harveyi, and Vibrio orientalis.

Journal of bacteriology 176 (12)
PMID : 8206831  :   DOI  :   10.1128/jb.176.12.3544-3551.1994     PMC  :   PMC205542    
Abstract >>
Genes encoding NAD(P)H-flavin oxidoreductases (flavin reductases) similar in both size and sequence to Fre, the most abundant flavin reductase in Escherichia coli, were identified in four species of luminous bacteria, Photorhabdus luminescens (ATCC 29999), Vibrio fischeri (ATCC 7744), Vibrio harveyi (ATCC 33843), and Vibrio orientalis (ATCC 33934). Nucleotide sequence analysis showed Fre-like flavin reductases in P. luminescens and V. fischeri to consist of 233 and 236 amino acids, respectively. As in E. coli Fre, Fre-like enzymes in luminous bacteria preferably used riboflavin as an electron acceptor when NADPH was used as an electron donor. These enzymes also were good suppliers of reduced flavin mononucleotide (FMNH2) to the bioluminescence reaction. In V. fischeri, the Fre-like enzyme is a minor flavin reductase representing < 10% of the total FMN reductase. That the V. fischeri Fre-like enzyme has no appreciable homology in amino acid sequence to the major flavin reductase in V. fischeri, FRase I, indicates that at least two different types of flavin reductases supply FMNH2 to the luminescence system in V. fischeri. Although Fre-like flavin reductases are highly similar in sequence to luxG gene products (LuxGs), Fre-like flavin reductases and LuxGs appear to constitute two separate groups of flavin-associated proteins.
KeywordMeSH Terms
Luminescent Measurements
Oxidoreductases
62.     ( 1994 )

Identification of the gene encoding the major NAD(P)H-flavin oxidoreductase of the bioluminescent bacterium Vibrio fischeri ATCC 7744.

Journal of bacteriology 176 (12)
PMID : 8206830  :   DOI  :   10.1128/jb.176.12.3536-3543.1994     PMC  :   PMC205541    
Abstract >>
The gene encoding the major NAD(P)H-flavin oxidoreductase (flavin reductase) of the luminous bacterium Vibrio fischeri ATCC 7744 was isolated by using synthetic oligonucleotide probes corresponding to the N-terminal amino acid sequence of the enzyme. Nucleotide sequence analysis suggested that the major flavin reductase of V. fischeri consisted of 218 amino acids and had a calculated molecular weight of 24,562. Cloned flavin reductase expressed in Escherichia coli was purified virtually to homogeneity, and its basic biochemical properties were examined. As in the major flavin reductase in crude extracts of V. fischeri, cloned flavin reductase showed broad substrate specificity and served well as a catalyst to supply reduced flavin mononucleotide (FMNH2) to the bioluminescence reaction. The major flavin reductase of V. fischeri not only showed significant similarity in amino acid sequence to oxygen-insensitive NAD(P)H nitroreductases of Salmonella typhimurium, Enterobacter cloacae, and E. coli but also was associated with a low level of nitroreductase activity. The major flavin reductase of V. fischeri and the nitroreductases of members of the family Enterobacteriaceae would thus appear closely related in evolution and form a novel protein family.
KeywordMeSH Terms
Luminescent Measurements
63. Spiro  S,     ( 1994 )

The FNR family of transcriptional regulators.

Antonie van Leeuwenhoek 66 (1��3��)
PMID : 7747934  :   DOI  :   10.1007/bf00871630    
Abstract >>
Homologues of the transcriptional regulator FNR from Escherichia coli have been identified in a variety of taxonomically diverse bacterial species. Despite being structurally very similar, members of the FNR family have disparate regulatory roles. Those from Shewanella putrefaciens, Pseudomonas aeruginosa, Pseudomonas stutzeri and Rhodopseudomonas palustris are functionally similar to FNR in that they regulate anaerobic respiration or carbon metabolism. Four rhizobial proteins (from Rhizobium meliloti, R. leguminosarum, B. japonicum and Azorhizobium caulinodans) are involved in the regulation of nitrogen fixation; a fifth (from Rhizobium strain IC3342) has unknown function. Two proteins from mammalian pathogens (Actinobacillus pleuropneumoniae and Bordetella pertussis) may be involved in the regulation of toxin expression. The FNR protein of Vibrio fischeri regulates bioluminescence, and the function of the one known FNR homologue from a Gram-positive organism (Lactobacillus casei) remains to be elucidated. Some members of this family, like FNR itself, appear to function as sensors of oxygen availability, whereas others do not. The ability to sense and respond to oxygen limitation may be correlated with the presence of cysteine residues which, in the case of FNR, are thought to be involved in oxygen or redox sensing. The mechanism of DNA sequence recognition is probably conserved, or very similar, throughout this family. In a number of other Gram-negative species, there is good indirect evidence for the existence of FNR analogues; these include Alcaligenes eutrophus, A. denitrificans, A. faecalis, Paracoccus denitrificans and a number of Pseudomonas species.
KeywordMeSH Terms
Escherichia coli Proteins
Iron-Sulfur Proteins
64. Gilson  L, Kuo  A, Dunlap  PV,     ( 1995 )

AinS and a new family of autoinducer synthesis proteins.

Journal of bacteriology 177 (23)
PMID : 7592489  :   DOI  :   10.1128/jb.177.23.6946-6951.1995     PMC  :   PMC177564    
Abstract >>
In Vibrio fischeri, the autoinducer N-3-oxohexanoyl-L-homoserine lactone (AI-1) governs the cell density-dependent induction of the luminescence operon via the LuxR transcriptional activator. The synthesis of AI-1 from bacterial metabolic intermediates is dependent on luxI. Recently, we found a second V. fischeri autoinducer molecule, N-octanoyl-L-homoserine lactone (AI-2), that in E. coli also activates the luminescence operon via LuxR. A locus independent of luxI was identified as being required for AI-2 synthesis. This 2.7-kb ain (autoinducer) locus was characterized by transposon insertion mutagenesis, deletion and complementation analysis, and DNA sequencing. A single 1,185-bp gene, ainS, was found to be the sole exogenous gene necessary for the synthesis of AI-2 in Escherichia coli. In addition, a V. fischeri ainS mutant produced AI-1 but not AI-2, confirming that in its native species ainS is specific for the synthesis of AI-2. ainS is predicted to encode a 45,580-Da protein which exhibits no similarity to LuxI or to any of the LuxI homologs responsible for the synthesis of N-acyl-L-homoserine lactones in a variety of other bacteria. The existence of two different and unrelated autoinducer synthesis genes suggests the occurrence of convergent evolution in the synthesis of homoserine lactone signaling molecules. The C-terminal half of AinS shows homology to a putative protein in Vibrio harveyi, LuxM, which is required for the synthesis of a V. harveyi bioluminescence autoinducer. Together, AinS and LuxM define a new family of autoinducer synthesis proteins. Furthermore, the predicted product of another gene, ainR, encoded immediately downstream of ainS, shows homology to LuxN, which is similarly encoded downstream of luxM in V. harveyi and proposed to have sensor/regulator functions in the bioluminescence response to the V. harveyi auto inducer. This similarity presents the possibility that AI-2, besides interacting with LuxR, also interacts with AinR under presently unknown conditions.
KeywordMeSH Terms
Genes, Bacterial
65. Daubner  SC, Astorga  AM, Leisman  GB, Baldwin  TO,     ( 1987 )

Yellow light emission of Vibrio fischeri strain Y-1: purification and characterization of the energy-accepting yellow fluorescent protein.

Proceedings of the National Academy of Sciences of the United States of America 84 (24)
PMID : 3480518  :   DOI  :   10.1073/pnas.84.24.8912     PMC  :   PMC299661    
Abstract >>
A strain of luminous bacteria, Vibrio fischeri Y-1, emits yellow light rather than the blue-green emission typical of other luminous bacteria. The yellow emission has been postulated previously to result from energy transfer from an electronically excited species formed in the bacterial luciferase-catalyzed reaction to a secondary emitter protein, termed the yellow fluorescent protein (YFP). We report here the purification of YFP to homogeneity without loss of the chromophore. The protein was found to be a homodimer of Mr 22,000 subunits with one weakly bound FMN per subunit. The FMN-protein complex was stabilized by 10% (vol/vol) glycerol in the buffers, allowing purification of the active holo-YFP. The protein migrated as a single spot with an isoelectric point of approximately 6.5 on two-dimensional polyacrylamide gel electrophoresis and gave an N-terminal sequence of Met-Phe-Lys-Gly-Ile-Val-Glu-Gly-Ile-Gly-Ile-Ile-Glu-Lys-Ile. Addition of purified YFP to a reaction in which luciferase was supplied with FMNH2 (reduced FMN) by a NADH:FMN oxidoreductase resulted in a dramatic enhancement in the intensity of bioluminescence and an additional peak in the emission spectrum at about 534 nm. The resulting bimodal bioluminescence emission spectrum had peaks at 484 nm, apparently due to emission from the luciferase-flavin complex, and at 534 nm, corresponding to the fluorescence emission maximum of YFP. This bimodal spectrum closely matched the emission spectrum in vivo.
KeywordMeSH Terms
Luminescent Measurements
66. Engebrecht  J, Silverman  M,     ( 1987 )

Nucleotide sequence of the regulatory locus controlling expression of bacterial genes for bioluminescence.

Nucleic acids research 15 (24)
PMID : 3697093  :   DOI  :   10.1093/nar/15.24.10455     PMC  :   PMC339955    
Abstract >>
Production of light by the marine bacterium Vibrio fischeri and by recombinant hosts containing cloned lux genes is controlled by the density of the culture. Density-dependent regulation of lux gene expression has been shown to require a locus consisting of the luxR and luxI genes and two closely linked divergent promoters. As part of a genetic analysis to understand the regulation of bioluminescence, we have sequenced the region of DNA containing this control circuit. Open reading frames corresponding to luxR and luxI were identified; transcription start sites were defined by S1 nuclease mapping and sequences resembling promoter elements were located.
KeywordMeSH Terms
Genes, Bacterial
Genes, Regulator
Luminescent Measurements
Operon
67. Foran  DR, Brown  WM,     ( 1988 )

Nucleotide sequence of the LuxA and LuxB genes of the bioluminescent marine bacterium Vibrio fischeri.

Nucleic acids research 16 (2)
PMID : 3340562  :   DOI  :   10.1093/nar/16.2.777     PMC  :   PMC334704    
Abstract >>
N/A
KeywordMeSH Terms
Genes, Bacterial
Luminescent Measurements
68.     ( 2013 )

Diversity of Vibrio spp. isolated at ambient environmental temperature in the Eastern English Channel as determined by pyrH sequencing.

Journal of applied microbiology 114 (6)
PMID : 23473469  :   DOI  :   10.1111/jam.12181    
Abstract >>
To describe the diversity of the culturable mesophilic and potentially pathogenic vibrios isolated at 22 and 37�XC on TCBS medium, in September 2009 from seawater and surface sediments. q-PCR assays previously selected for the identification of bacterial strains isolated at 37�XC were used in combination with the partial sequencing of two housekeeping genes, pyrH and toxR, to identify 315 strains isolated at 22�XC. The great majority of the 37�XC strains was identified by q-PCR assays, (five of the six species) with the predominance of Vibrio alginolyticus (85�P9%) and V. harveyi (10�P7%). The human pathogens V. parahaemolyticus and V. cholerae were rarely detected (two strains each). The 22�XC strains were successfully identified by the phylogeny analysis of pyrH and toxR genes, revealing 20 Vibrio species, with the predominance of the clam pathogen V. celticus (36�P8%). The Splendidus and the Harveyi groups represented the main Vibrio group at 22�XC (80%) and 37�XC (99�P5%), respectively. The combination of q-PCR assays and the sequencing of pyrH and toxR genes highlighted two different Vibrio communities at 22 and 37�XC both dominated by pathogenic species for marine organisms. The sequencing of the pyrH gene revealed to be a valuable tool to identify environmental Vibrio spp. strains isolated at 22�XC, as 92�P3% of them were identified in this study.
KeywordMeSH Terms
69.     ( 2013 )

Energetic basis of uncoupling folding from binding for an intrinsically disordered protein.

Journal of the American Chemical Society 135 (4)
PMID : 23289531  :   DOI  :   10.1021/ja305081b    
Abstract >>
Intrinsically disordered proteins (IDPs) are proteins that lack a unique three-dimensional structure in their native state. Many have, however, been found to fold into a defined structure when interacting with specific binding partners. The energetic implications of such behavior have been widely discussed, yet experimental thermodynamic data is scarce. We present here a thorough thermodynamic and structural study of the binding of an IDP (antitoxin CcdA) to its molecular target (gyrase poison CcdB). We show that the binding-coupled folding of CcdA is driven by a combination of specific intramolecular interactions that favor the final folded structure and a less specific set of intermolecular contacts that provide a desolvation entropy boost. The folded structure of the bound IDP appears to be defined largely by its own amino acid sequence, with the binding partner functioning more as a facilitator than a mold to conform to. On the other hand, specific intermolecular interactions do increase the binding affinity up to the picomolar range. Overall, this study shows how an IDP can achieve very strong and structurally well-defined binding and it provides significant insight into the molecular forces that enable such binding properties.
KeywordMeSH Terms
Thermodynamics
70.     ( 1998 )

Identification and analysis of the regulatory region R&R* with the cnf1 gene encoding the cytotoxic necrotizing factor type 1 that closely links to the lux regulon of Vibrio fischeri.

Biochemical and biophysical research communications 250 (2)
PMID : 9753653  :   DOI  :   10.1006/bbrc.1998.9325    
Abstract >>
Nucleotide sequence of the regulatory region R&R* and the partial 5'-end of the cnf1 gene (GenBank Accession No. AF023157) of Vibrio fischeri ATCC 7744 has been determined, and the cytotoxic necrotizing factor 1 (CNF1) encoded by the cnf1 gene is deduced. Alignment and comparison of the cytotoxic necrotizing factor 1s of V. fischeri and E. coli show that they are homologous. Nucleotide sequence reveals that the cnf1 gene is closely linked to the lux regulon in genome; the gene order of the cnf1 gene and the lux regulon is <--cnf1-R&R*<--rrn-<--luxR-R&R-luxI-luxC-luxD -luxA-luxB-luxE-luxG-omega-->, whereas R&R is the regulatory region of the lux regulon, and R&R* is the regulatory region of the cnf1 gene; the sequence approximately 2 kb lay between the luxR gene of the lux regulon and the cnf1 gene is an rrn-like operon. It is unexpected to find the cnf1 gene in V. fischeri, since the CNF1 protein enables necrosis; the marine luminous bacterium V. fischeri is never to be identified as a pathogenic microbe. The cnf1 gene might be concerned with symbosis of the luminous bacteria and host fishes.
KeywordMeSH Terms
Escherichia coli Proteins
Genes, Bacterial
Genome, Bacterial
71.     ( 1998 )

Competitive dominance among strains of luminous bacteria provides an unusual form of evidence for parallel evolution in Sepiolid squid-vibrio symbioses.

Applied and environmental microbiology 64 (9)
PMID : 9726861  :   PMC  :   PMC106711    
Abstract >>
One of the principal assumptions in symbiosis research is that associated partners have evolved in parallel. We report here experimental evidence for parallel speciation patterns among several partners of the sepiolid squid-luminous bacterial symbioses. Molecular phylogenies for 14 species of host squids were derived from sequences of both the nuclear internal transcribed spacer region and the mitochondrial cytochrome oxidase subunit I; the glyceraldehyde phosphate dehydrogenase locus was sequenced for phylogenetic determinations of 7 strains of bacterial symbionts. Comparisons of trees constructed for each of the three loci revealed a parallel phylogeny between the sepiolids and their respective symbionts. Because both the squids and their bacterial partners can be easily cultured independently in the laboratory, we were able to couple these phylogenetic analyses with experiments to examine the ability of the different symbiont strains to compete with each other during the colonization of one of the host species. Our results not only indicate a pronounced dominance of native symbiont strains over nonnative strains, but also reveal a hierarchy of symbiont competency that reflects the phylogenetic relationships of the partners. For the first time, molecular systematics has been coupled with experimental colonization assays to provide evidence for the existence of parallel speciation among a set of animal-bacterial associations.
KeywordMeSH Terms
Phylogeny
Symbiosis
72.     ( 1998 )

1.8 A crystal structure of the major NAD(P)H:FMN oxidoreductase of a bioluminescent bacterium, Vibrio fischeri: overall structure, cofactor and substrate-analog binding, and comparison with related flavoproteins.

Journal of molecular biology 280 (2)
PMID : 9654450  :   DOI  :   10.1006/jmbi.1998.1871    
Abstract >>
We have solved the crystal structure of FRase I, the major NAD(P)H:FMN oxidoreductase of Vibrio fischeri, by the multiple isomorphous replacement method (MIR) at 1.8 A resolution with the conventional R factor of 0.187. The crystal structure of FRase I complexed with its competitive inhibitor, dicoumarol, has also been solved at 2.2 A resolution with the conventional R factor of 0.161. FRase I is a homodimer, having one FMN cofactor per subunit, which is situated at the interface of two subunits. The overall fold can be divided into two domains; 80% of the residues form a rigid core and the remaining, a small flexible domain. The overall core folding is similar to those of an NADPH-dependent flavin reductase of Vibrio harveyi (FRP) and the NADH oxidase of Thermus thermophilus (NOX) in spite of the very low identity in amino acid sequences (10% with FRP and 21% with NOX). 56% of alpha-carbons of FRase I core residues could be superposed onto NOX counterparts with an r.m.s. distance of 1.2 A. The remaining residues have relatively high B-values and may be essential for defining the substrate specificity. Indeed, one of them, Phe124, was found to participate in the binding of dicoumarol through stacking to one of the rings of dicoumarol. Upon binding of dicoumarol, most of the exposed re-face of the FMN cofactor is buried, which is consistent with the ping pong bi bi catalytic mechanism.
KeywordMeSH Terms

331, Shih-Pin Rd., Hsinchu 30062, Taiwan

Phone: +886-3-5223191

E-mail: bcrcweb@firdi.org.tw

web maintainance: +886-3-5223191 ext 593

Copyright © 2018.BCRC All rights reserved.The duplication or use of information and data such as texts or images or any linkage the website at the "bcrc.firdi.org.tw" is only permitted with the indication of the source or with prior approval by the BCRC(Bioresource Collection and Research Center).