| 1. |
Takahashi H,
Kimura B,
Yoshikawa M,
Fujii T,
( 2003 ) Cloning and sequencing of the histidine decarboxylase genes of gram-negative, histamine-producing bacteria and their application in detection and identification of these organisms in fish. PMID : 12732523 : DOI : 10.1128/aem.69.5.2568-2579.2003 PMC : PMC154508 Abstract >>
The use of molecular tools for early and rapid detection of gram-negative histamine-producing bacteria is important for preventing the accumulation of histamine in fish products. To date, no molecular detection or identification system for gram-negative histamine-producing bacteria has been developed. A molecular method that allows the rapid detection of gram-negative histamine producers by PCR and simultaneous differentiation by single-strand conformation polymorphism (SSCP) analysis using the amplification product of the histidine decarboxylase genes (hdc) was developed. A collection of 37 strains of histamine-producing bacteria (8 reference strains from culture collections and 29 isolates from fish) and 470 strains of non-histamine-producing bacteria isolated from fish were tested. Histamine production of bacteria was determined by paper chromatography and confirmed by high-performance liquid chromatography. Among 37 strains of histamine-producing bacteria, all histidine-decarboxylating gram-negative bacteria produced a PCR product, except for a strain of Citrobacter braakii. In contrast, none of the non-histamine-producing strains (470 strains) produced an amplification product. Specificity of the amplification was further confirmed by sequencing the 0.7-kbp amplification product. A phylogenetic tree of the isolates constructed using newly determined sequences of partial hdc was similar to the phylogenetic tree generated from 16S ribosomal DNA sequences. Histamine accumulation occurred when PCR amplification of hdc was positive in all of fish samples tested and the presence of powerful histamine producers was confirmed by subsequent SSCP identification. The potential application of the PCR-SSCP method as a rapid monitoring tool is discussed.
|
2. |
Kasai S,
Sumimoto T,
( 2002 ) Stimulated biosynthesis of flavins in Photobacterium phosphoreum IFO 13896 and the presence of complete rib operons in two species of luminous bacteria. PMID : 12444973 : DOI : 10.1046/j.1432-1033.2002.03304.x Abstract >>
Photobacterium phosphoreum IFO 13896 emits light strongly when cultured in medium containing 3% NaCl, but only weakly in medium containing 1% NaCl. It is known that dim or dark mutants appear frequently and spontaneously from this parent strain. To confirm that riboflavin biosynthesis is stimulated when the lux operon is active, the amount of light emitted and flavins synthesized under strongly or weakly light emitting conditions was determined. In comparison with the parent strain cultured in 3% NaCl, the same strain cultured in 1% NaCl emitted 1/36 the light and produced 1/4 the flavins, while three dim or dark mutants, M1, M2 and M3 cultured in 3% NaCl, emitted almost no light, 1/58 the light and 1/10 the light and produced 1/8, 1/5 and 1/3 the amount of flavins, respectively. From these results, we deduced that the genes for riboflavin synthesis, rib genes, are organized in an operon in this strain. In P. phosphoreum NCMB 844, it has been reported that a rib gene cluster is present just downstream of the lux operon. However, among rib genes, the gene for pyrimidine deaminase/pyrimidine reductase, ribD, was not found in this cluster. Because a complete rib operon seems to be necessary for efficient regulation at the transcriptional level, we expected ribD to be present downstream of this cluster and sequenced this region, using SUGDAT, Sequencing Using Genomic DNA As a Template. We could not find this gene but found a gene for hybrid-cluster protein (prismane protein). To find ribD in a different region, a partial ribD sequence was amplified and sequenced using a PCR-based method, and subsequently the genomic DNA was sequenced in both directions from this partial sequence using SUGDAT. Because ribC was found just downstream of ribD, we sequenced further downstream of ribC and confirmed that another complete set of rib genes, ribD, ribC, ribBA, and ribE, is present in P. phosphoreum. The presence of a complete rib operon in P. phosphoreum explains why this species can synthesize flavins at enhanced levels to sustain a strong light emission. Furthermore, we sequenced the rib operon in Vibrio fischeri, another representative luminous bacterium, in a manner similar to that described above, and confirmed that a complete operon is present also in this species. The organization of rib genes in an operon in the Proteobacteria gamma-subdivision is discussed.
|
3. |
Rowe-Magnus DA,
Guerout AM,
Ploncard P,
Dychinco B,
Davies J,
Mazel D,
( 2001 ) The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. PMID : 11209061 : DOI : 10.1073/pnas.98.2.652 PMC : PMC14643 Abstract >>
Integrons are genetic elements that acquire and exchange exogenous DNA, known as gene cassettes, by a site-specific recombination mechanism. Characterized gene cassettes consist of a target recombination sequence (attC site) usually associated with a single open reading frame coding for an antibiotic resistance determinant. The affiliation of multiresistant integrons (MRIs), which contain various combinations of antibiotic resistance gene cassettes, with transferable elements underlies the rapid evolution of multidrug resistance among diverse Gram-negative bacteria. Yet the origin of MRIs remains unknown. Recently, a chromosomal super-integron (SI) harboring hundreds of cassettes was identified in the Vibrio cholerae genome. Here, we demonstrate that the activity of its associated integrase is identical to that of the MRI integrase, IntI1. We have also identified equivalent integron superstructures in nine distinct genera throughout the gamma-proteobacterial radiation. Phylogenetic analysis revealed that the evolutionary history of the system paralleled that of the radiation, indicating that integrons are ancient structures. The attC sites of the 63 antibiotic-resistance gene cassettes identified thus far in MRIs are highly variable. Strikingly, one-fifth of these were virtually identical to the highly related yet species-specific attC sites of the SIs described here. Furthermore, antimicrobial resistance homologues were identified among the thousands of genes entrapped by these SIs. Because the gene cassettes of SIs are substrates for MRIs, these data identify SIs as the source of contemporary MRIs and their cassettes. However, our demonstration of the metabolic functions, beyond antibiotic resistance and virulence, of three distinct SI gene cassettes indicates that integrons function as a general gene-capture system for bacterial innovation.
|
4. |
Kato S,
( 2000 ) Detection of the Na(+)-translocating NADH-quinone reductase in marine bacteria using a PCR technique. PMID : 10779868 : Abstract >>
To examine the distribution of the Na(+)-translocating NADH-quinone reductase (Na(+)-NQR) among marine bacteria, we developed a simple screening method for the detection of this enzyme. By reference to the homologous sequences of the Na(+)-NQR operons from Vibrio alginolyticus and Haemophilus influenzae, a pair of primers was designed for amplification of a part of the sixth ORF (nqr6) of the Na(+)-NQR operon. When PCR was performed using genomic DNA from 13 marine bacteria, a 0.9-kbp fragment corresponding to nqr6 was amplified in 10 strains. Although there were three PCR-negative strains phylogenetically, based on the sequence of the 16S rRNA, these were placed far from the PCR-positive strains. No product was observed in the case of nonmarine bacteria. The nucleotide and predicted amino acid sequences of nqr6 were highly conserved among the PCR-positive marine bacteria. A phylogenetic analysis of marine bacteria, based on nqr6 sequencing, was performed.
|
5. |
Williams KP,
( 2000 ) The tmRNA website. PMID : 10592213 : DOI : 10.1093/nar/28.1.168 PMC : PMC102480 Abstract >>
The tmRNA Website collects all available tmRNA sequences into a single public resource, along with alignments and a guide to searching for new sequences. Over the last year, several sequences have been updated or newly found by monitoring ongoing genome sequencing projects; tmRNA sequence data from 70 species are now available. New features include: color-coding of sequences to mark suggested base-paired regions, a list of the literature concerning tmRNA, careful crediting of tmRNA sequence identifications, and a split browser window. Updates are very frequent. The tmRNA Website has a new URL: http:www.indiana.edu/tmrna
|
6. |
Tsukamoto H,
Takakura Y,
Yamamoto T,
( 2007 ) Purification, cloning, and expression of an alpha/beta-galactoside alpha-2,3-sialyltransferase from a luminous marine bacterium, Photobacterium phosphoreum. PMID : 17702755 : DOI : 10.1074/jbc.M701907200 Abstract >>
A novel sialyltransferase, alpha/beta-galactoside alpha-2,3-sialyltransferase, was purified from the cell lysate of a luminous marine bacterium, Photobacterium phosphoreum JT-ISH-467, isolated from the Japanese common squid (Todarodes pacificus). The gene encoding the enzyme was cloned from the genomic library of the bacterium using probes derived from the NH(2)-terminal and internal amino acid sequences. An open reading frame of 409 amino acids was identified, and the sequence had 32% identity with that of beta-galactoside alpha-2,6-sialyltrasferase in Photobacterium damselae JT0160. DNA fragments that encoded the full-length protein and a protein that lacked the sequence between the 2nd and 24th residues at the NH(2) terminus were amplified by polymerase chain reactions and cloned into an expression vector. The full-length and truncated proteins were expressed in Escherichia coli, producing active enzymes of 0.25 and 305 milliunits, respectively, per milliliter of the medium in the lysate of E. coli. The truncated enzyme was much more soluble without detergent than the full-length enzyme. The enzyme catalyzed the transfer of N-acetylneuraminic acid from CMP-N-acetylneuraminic acid to disaccharides, such as lactose and N-acetyllactosamine, with low apparent K(m) and to monosaccharides, such as alpha-methyl-galactopyranoside and beta-methyl-galactopyranoside, with much lower apparent K(m). Thus, this sialyltransferase is unique and should be very useful for achieving high productivity in E. coli with a wide substrate range.
|
7. |
Kaeding AJ,
Ast JC,
Pearce MM,
Urbanczyk H,
Kimura S,
Endo H,
Nakamura M,
Dunlap PV,
( 2007 ) Phylogenetic diversity and cosymbiosis in the bioluminescent symbioses of "Photobacterium mandapamensis". PMID : 17369329 : DOI : 10.1128/AEM.02212-06 PMC : PMC1907103 Abstract >>
Photobacterium mandapamensis (proposed name) and Photobacterium leiognathi are closely related, phenotypically similar marine bacteria that form bioluminescent symbioses with marine animals. Despite their similarity, however, these bacteria can be distinguished phylogenetically by sequence divergence of their luminescence genes, luxCDAB(F)E, by the presence (P. mandapamensis) or the absence (P. leiognathi) of luxF and, as shown here, by the sequence divergence of genes involved in the synthesis of riboflavin, ribBHA. To gain insight into the possibility that P. mandapamensis and P. leiognathi are ecologically distinct, we used these phylogenetic criteria to determine the incidence of P. mandapamensis as a bioluminescent symbiont of marine animals. Five fish species, Acropoma japonicum (Perciformes, Acropomatidae), Photopectoralis panayensis and Photopectoralis bindus (Perciformes, Leiognathidae), Siphamia versicolor (Perciformes, Apogonidae), and Gadella jordani (Gadiformes, Moridae), were found to harbor P. mandapamensis in their light organs. Specimens of A. japonicus, P. panayensis, and P. bindus harbored P. mandapamensis and P. leiognathi together as cosymbionts of the same light organ. Regardless of cosymbiosis, P. mandapamensis was the predominant symbiont of A. japonicum, and it was the apparently exclusive symbiont of S. versicolor and G. jordani. In contrast, P. leiognathi was found to be the predominant symbiont of P. panayensis and P. bindus, and it appears to be the exclusive symbiont of other leiognathid fishes and a loliginid squid. A phylogenetic test for cospeciation revealed no evidence of codivergence between P. mandapamensis and its host fishes, indicating that coevolution apparently is not the basis for this bacterium's host preferences. These results, which are the first report of bacterial cosymbiosis in fish light organs and the first demonstration that P. leiognathi is not the exclusive light organ symbiont of leiognathid fishes, demonstrate that the host species ranges of P. mandapamensis and P. leiognathi are substantially distinct. The host range difference underscores possible differences in the environmental distributions and physiologies of these two bacterial species.
|
8. |
Kanki M,
Yoda T,
Tsukamoto T,
Baba E,
( 2007 ) Histidine decarboxylases and their role in accumulation of histamine in tuna and dried saury. PMID : 17220267 : DOI : 10.1128/AEM.01907-06 PMC : PMC1828783 Abstract >>
Histamine-producing bacteria (HPB) such as Photobacterium phosphoreum and Raoultella planticola possess histidine decarboxylase (HDC), which converts histidine into histamine. Histamine fish poisoning (HFP) is attributable to the ingestion of fish containing high levels of histamine produced by HPB. Because freezing greatly decreases the histamine-producing ability of HPB, especially of P. phosphoreum, it has been speculated that HFP is caused by HDC itself from HPB cells autolyzing during frozen storage, even when HPB survive frozen storage. Here we constructed recombinant HDCs of P. phosphoreum, Photobacterium damselae, R. planticola, and Morganella morganii and investigated the ability of HDCs to produce sufficient histamine to cause HFP. To elucidate the character of these HDCs, we examined the specific activity of each recombinant HDC at various temperatures, pH levels, and NaCl concentrations. Further, we also investigated the stability of each HDC under different conditions (in reaction buffer, tuna, and dried saury) at various temperatures. P. damselae HDC readily produced sufficient histamine to cause HFP in fish samples. We consider that if HDC is implicated as an independent cause of HFP in frozen-thawed fish, the most likely causative agent is HDC of P. damselae.
|
9. |
Kasai S,
Okada K,
Hoshino A,
Iida T,
Honda T,
( 2007 ) Lateral transfer of the lux gene cluster. PMID : 17169972 : DOI : 10.1093/jb/mvm023 Abstract >>
The lux operon is an uncommon gene cluster. To find the pathway through which the operon has been transferred, we sequenced the operon and both flanking regions in four typical luminous species. In Vibrio cholerae NCIMB 41, a five-gene cluster, most genes of which were highly similar to orthologues present in Gram-positive bacteria, along with the lux operon, is inserted between VC1560 and VC1563, on chromosome 1. Because this entire five-gene cluster is present in Photorhabdus luminescens TT01, about 1.5 Mbp upstream of the operon, we deduced that the operon and the gene cluster were transferred from V. cholerae to an ancestor of Pr. luminescens. Because in both V. fischeri and Shewanella hanedai, luxR and luxI were found just upstream of the operon, we concluded that the operon was transferred from either species to the other. Because most of the genes flanking the operon were highly similar to orthologues present on chromosome 2 of vibrios, we speculated that the operon of most species is located on this chromosome. The undigested genomic DNAs of five luminous species were analysed by pulsed-field gel electrophoresis and Southern hybridization. In all the species except V. cholerae, the operons are located on chromosome 2.
|
10. |
Thompson FL,
Gevers D,
Thompson CC,
Dawyndt P,
Naser S,
Hoste B,
Munn CB,
Swings J,
( 2005 ) Phylogeny and molecular identification of vibrios on the basis of multilocus sequence analysis. PMID : 16151093 : DOI : 10.1128/AEM.71.9.5107-5115.2005 PMC : PMC1214639 Abstract >>
We analyzed the usefulness of rpoA, recA, and pyrH gene sequences for the identification of vibrios. We sequenced fragments of these loci from a collection of 208 representative strains, including 192 well-documented Vibrionaceae strains and 16 presumptive Vibrio isolates associated with coral bleaching. In order to determine the intraspecies variation among the three loci, we included several representative strains per species. The phylogenetic trees constructed with the different genetic loci were roughly in agreement with former polyphasic taxonomic studies, including the 16S rRNA-based phylogeny of vibrios. The families Vibrionaceae, Photobacteriaceae, Enterovibrionaceae, and Salinivibrionaceae were all differentiated on the basis of each genetic locus. Each species clearly formed separated clusters with at least 98, 94, and 94% rpoA, recA, and pyrH gene sequence similarity, respectively. The genus Vibrio was heterogeneous and polyphyletic, with Vibrio fischeri, V. logei, and V. wodanis grouping closer to the Photobacterium genus. V. halioticoli-, V. harveyi-, V. splendidus-, and V. tubiashii-related species formed groups within the genus Vibrio. Overall, the three genetic loci were more discriminatory among species than were 16S rRNA sequences. In some cases, e.g., within the V. splendidus and V. tubiashii group, rpoA gene sequences were slightly less discriminatory than recA and pyrH sequences. In these cases, the combination of several loci will yield the most robust identification. We can conclude that strains of the same species will have at least 98, 94, and 94% rpoA, recA, and pyrH gene sequence similarity, respectively.
|
11. |
Ast JC,
Dunlap PV,
( 2005 ) Phylogenetic resolution and habitat specificity of members of the Photobacterium phosphoreum species group. PMID : 16156737 : DOI : 10.1111/j.1462-2920.2005.00859.x Abstract >>
Substantial ambiguity exists regarding the phylogenetic status of facultatively psychrophilic luminous bacteria identified as Photobacterium phosphoreum, a species thought to be widely distributed in the world's oceans and believed to be the specific bioluminescent light-organ symbiont of several deep-sea fishes. Members of the P. phosphoreum species group include luminous and non-luminous strains identified phenotypically from a variety of different habitats as well as phylogenetically defined lineages that appear to be evolutionarily distinct. To resolve this ambiguity and to begin developing a meaningful knowledge of the geographic distributions, habitats and symbiotic relationships of bacteria in the P. phosphoreum species group, we carried out a multilocus, fine-scale phylogenetic analysis based on sequences of the 16S rRNA, gyrB and luxABFE genes of many newly isolated luminous strains from symbiotic and saprophytic habitats, together with previously isolated luminous and non-luminous strains identified as P. phosphoreum from these and other habitats. Parsimony analysis unambiguously resolved three evolutionarily distinct clades, phosphoreum, iliopiscarium and kishitanii. The tight phylogenetic clustering within these clades and the distinct separation between them indicates they are different species, P. phosphoreum, Photobacterium iliopiscarium and the newly recognized 'Photobacterium kishitanii'. Previously reported non-luminous strains, which had been identified phenotypically as P. phosphoreum, resolved unambiguously as P. iliopiscarium, and all examined deep-sea fishes (specimens of families Chlorophthalmidae, Macrouridae, Moridae, Trachichthyidae and Acropomatidae) were found to harbour 'P. kishitanii', not P. phosphoreum, in their light organs. This resolution revealed also that 'P. kishitanii' is cosmopolitan in its geographic distribution. Furthermore, the lack of phylogenetic variation within 'P. kishitanii' indicates that this facultatively symbiotic bacterium is not cospeciating with its phylogenetically divergent host fishes. The results of this fine-scale phylogenetic analysis support the emerging view that bacterial species names should designate singular historical entities, i.e. discrete lineages diagnosed by a significant divergence of shared derived nucleotide characters.
|
12. |
Lin JW,
Weng SF,
Chao YF,
Chung YT,
( 2005 ) Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum. PMID : 15596133 : DOI : 10.1016/j.bbrc.2004.11.065 Abstract >>
The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.
|
13. |
Kita A,
Kasai S,
Miyata M,
Miki K,
( 1996 ) Structure of flavoprotein FP390 from a luminescent bacterium Photobacterium phosphoreum refined at 2.7 A resolution. PMID : 15299728 : DOI : 10.1107/S0907444995009796 Abstract >>
The three-dimensional structure of a flavoprotein, FP(390), from a luminescent bacterium, Photobacterium phosphoreum, solved by the molecular-replacement method, was refined to an R factor of 24.0% for 17 433 independent reflections, from 6.0 to 2.7 A resolution, collected by synchrotron radiation. The asymmetric unit of the crystal (space group P4(3)22, a = b = 76.8 and c = 242 A) contains two monomer molecules related by a non-crystallographic twofold axis to form a dimer. There are two Q-flavin [flavin mononucleotide (FMN) with myristic acid] molecules in FP(390) monomer. One of them is located at the interface of dimer which is bound to both monomer and the another is at the molecular surface. The electron density of myristic acids of Q-flavins at the dimer interface in both monomer are weak and unclear, showing the possibility that the Q-flavins bound in this site are not a single species but a mixture of two components, 6-(3"-myristic acid)-FMN and 6-(4"- myristic acid)-FMN.
|
14. |
Thompson CC,
Thompson FL,
Vandemeulebroecke K,
Hoste B,
Dawyndt P,
Swings J,
( 2004 ) Use of recA as an alternative phylogenetic marker in the family Vibrionaceae. PMID : 15143042 : DOI : 10.1099/ijs.0.02963-0 Abstract >>
This study analysed the usefulness of recA gene sequences as an alternative phylogenetic and/or identification marker for vibrios. The recA sequences suggest that the genus Vibrio is polyphyletic. The high heterogeneity observed within vibrios was congruent with former polyphasic taxonomic studies on this group. Photobacterium species clustered together and apparently nested within vibrios, while Grimontia hollisae was apart from other vibrios. Within the vibrios, Vibrio cholerae and Vibrio mimicus clustered apart from the other genus members. Vibrio harveyi- and Vibrio splendidus-related species formed compact separated groups. On the other hand, species related to Vibrio tubiashii appeared scattered in the phylogenetic tree. The pairs Vibrio coralliilyticus and Vibrio neptunius, Vibrio nereis and Vibrio xuii and V. tubiashii and Vibrio brasiliensis clustered completely apart from each other. There was a correlation of 0.58 between recA and 16S rDNA pairwise similarities. Strains of the same species have at least 94 % recA sequence similarity. recA gene sequences are much more discriminatory than 16S rDNA. For 16S rDNA similarity values above 98 % there was a wide range of recA similarities, from 83 to 99 %.
|
15. |
Ast JC,
Dunlap PV,
( 2004 ) Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi. PMID : 15034641 : DOI : 10.1007/s00203-004-0663-7 Abstract >>
The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon (luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene (luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).
|
16. |
Gueneau de Novoa P,
Williams KP,
( 2004 ) The tmRNA website: reductive evolution of tmRNA in plastids and other endosymbionts. PMID : 14681369 : DOI : 10.1093/nar/gkh102 PMC : PMC308836 Abstract >>
tmRNA combines tRNA- and mRNA-like properties and ameliorates problems arising from stalled ribosomes. Research on the mechanism, structure and biology of tmRNA is served by the tmRNA website (http://www.indiana.edu/~ tmrna), a collection of sequences, alignments, secondary structures and other information. Because many of these sequences are not in GenBank, a BLAST server has been added; another new feature is an abbreviated alignment for the tRNA-like domain only. Many tmRNA sequences from plastids have been added, five found in public sequence data and another 10 generated by direct sequencing; detection in early-branching members of the green plastid lineage brings coverage to all three primary plastid lineages. The new sequences include the shortest known tmRNA sequence. While bacterial tmRNAs usually have a lone pseudoknot upstream of the mRNA segment and a string of three or four pseudoknots downstream, plastid tmRNAs collectively show loss of pseudoknots at both postions. The pseudoknot-string region is also too short to contain the usual pseudoknot number in another new entry, the tmRNA sequence from a bacterial endosymbiont of insect cells, Tremblaya princeps. Pseudoknots may optimize tmRNA function in free-living bacteria, yet become dispensible when the endosymbiotic lifestyle relaxes selective pressure for fast growth.
|
17. |
Nishiguchi MK,
Nair VS,
( 2003 ) Evolution of symbiosis in the Vibrionaceae: a combined approach using molecules and physiology. PMID : 14657139 : DOI : 10.1099/ijs.0.02792-0 Abstract >>
The family Vibrionaceae is considered to be one of the most diverse and well-studied groups of bacteria. Here, evolution is assessed within the Vibrionaceae to determine whether multiple origins of eukaryotic associations have occurred within this diverse group of bacteria. Analyses were based on a large molecular dataset, along with a matrix that consisted of 100 biochemical and restriction digest characters. By using direct optimization methods to analyse both datasets individually and in combination, a total-evidence cladogram has been produced, which supports the hypothesis that several important symbionts (both mutualistic and pathogenic) within the Vibrionaceae are not monophyletic. This leads us to consider that symbiosis (and subsequently, associations with Eukarya) has evolved multiple times within the Vibrionaceae lineage.
|
18. |
Budsberg KJ,
Wimpee CF,
Braddock JF,
( 2003 ) Isolation and identification of Photobacterium phosphoreum from an unexpected niche: migrating salmon. PMID : 14602659 : DOI : 10.1128/aem.69.11.6938-6942.2003 PMC : PMC262280 Abstract >>
Six luminous bacteria were isolated from migrating salmon in the Yukon River, Alaska. All isolates were identified as Photobacterium phosphoreum. Previous studies suggest that P. phosphoreum is an exclusively marine bacterium, while our Alaskan isolates are from salmon which migrated up to 1,228 km from the marine environment.
|
19. |
Hendry TA,
Dunlap PV,
( 2011 ) The uncultured luminous symbiont of Anomalops katoptron (Beryciformes: Anomalopidae) represents a new bacterial genus. PMID : 21864694 : DOI : 10.1016/j.ympev.2011.08.006 Abstract >>
Flashlight fishes (Beryciformes: Anomalopidae) harbor luminous symbiotic bacteria in subocular light organs and use the bacterial light for predator avoidance, feeding, and communication. Despite many attempts anomalopid symbionts have not been brought into laboratory culture, which has restricted progress in understanding their phylogenetic relationships with other luminous bacteria, identification of the genes of their luminescence system, as well as the nature of their symbiotic interactions with their fish hosts. To begin addressing these issues, we used culture-independent analysis of the bacteria symbiotic with the anomalopid fish, Anomalops katoptron, to characterize the phylogeny of the bacteria and to identify the genes of their luminescence system including those involved in the regulation of luminescence. Analysis of the 16S rRNA, atpA, gapA, gyrB, pyrH, recA, rpoA, and topA genes resolved the A. katoptron symbionts as a clade nested within and deeply divergent from other members of Vibrionaceae. The bacterial luminescence (lux) genes were identified as a contiguous set (luxCDABEG), as found for the lux operons of other luminous bacteria. Phylogenetic analysis based on the lux genes confirmed the housekeeping gene phylogenetic placement. Furthermore, genes flanking the lux operon in the A. katoptron symbionts differed from those flanking lux operons of other genera of luminous bacteria. We therefore propose the candidate name Candidatus Photodesmus (Greek: photo = light, desmus = servant) katoptron for the species of bacteria symbiotic with A. katoptron. Results of a preliminary genomic analysis for genes regulating luminescence in other bacteria identified only a Vibrio harveyi-type luxR gene. These results suggest that expression of the luminescence system might be continuous in P. katoptron.
|
20. |
Ferri SR,
Meighen EA,
( 1991 ) A lux-specific myristoyl transferase in luminescent bacteria related to eukaryotic serine esterases. PMID : 2071574 : Abstract >>
The diversion of fatty acids from fatty acid biosynthesis into the luminescent system is catalyzed by a lux-specific acyltransferase that catalyzes the cleavage of fatty acyl-acyl carrier protein (ACP). Analysis of the substrate specificities for fatty acyl-ACPs of the transferases from divergent luminescent bacteria, Photobacterium phosphoreum and Vibrio harveyi, has demonstrated that myristoyl-ACP is cleaved at the highest rate. Inhibition by phenylmethanesulfonyl fluoride as well as resistance of the acylated enzyme intermediate to cleavage by hydroxylamine showed that the transferase is a serine esterase. Moreover, activity was dependent on a basic residue with a pKa of 6.3 implicating a histidine residue as part of a charge relay system found in serine esterases. The nucleotide sequence of the P. phosphoreum luxD gene coding for the transferase was determined resulting in the identification of the active site motif for serine esterases, G-X-S-X-G. Replacement of the serine residue at the center of this motif by threonine, alanine, or glycine blocked the transferase acyl-ACP cleavage activity, its ability to be acylated, and complementation of a transferase defective mutant on transconjugation with the luxD gene. The sequence and location of the serine as well as a histidine residue in the lux-specific transferases were found to be similar to those involved in the charge relay system in vertebrate thioesterases. Combined with the similar kinetic properties, these results support a common metabolic role for both enzymes in the diversion of fatty acids from the fatty acid biosynthetic pathway.
|
21. |
Soly RR,
Meighen EA,
( 1991 ) Identification of the acyl transfer site of fatty acyl-protein synthetase from bioluminescent bacteria. PMID : 2023262 : DOI : 10.1016/0022-2836(91)90858-4 Abstract >>
Fatty acid activation, transfer, and reduction by the fatty acid reductase multienzyme complex from Photobacterium phosphoreum to generate fatty aldehydes for the luminescence reaction is regulated by the interaction of the synthetase and reductase subunits of this complex. Identification of the specific site involved in covalent transfer of the fatty acyl group between the sites of activation and reduction on the synthetase and reductase subunits, respectively, is a critical step in understanding how subunit interactions modulate the flow of fatty acyl groups through the fatty acid reductase complex. To accomplish this goal, the nucleotide sequence of the luxE gene coding for the acyl-protein synthetase subunit (373 amino acid residues) was determined and the conserved cysteinyl residues implicated in fatty acyl transfer identified. Using site-specific mutagenesis, each of the five conserved cysteine residues was converted to a serine residue, the mutated synthetases expressed in Escherichia coli, and the properties of the mutant proteins examined. On complementation of four of the mutants with the reductase subunit, the synthetase subunit was acylated and the acyl group could be reversibly transferred between the reductase and synthetase subunits, and fatty acid reductase activity was fully regenerated. As well, sensitivity of the acylated synthetases to hydroxylamine cleavage (under denaturation conditions to remove any conformational effects on reactivity) was retained, showing that a cysteine and not a serine residue was still acylated. However, substitution of a cysteine residue only ten amino acid residues from the carboxyl terminal (C364S) prevented acylation of the synthetase and regeneration of fatty acid reductase activity. Moreover, this mutant protein preserved its ability to activate fatty acid to fatty acyl-AMP but could not accept the acyl group from the reductase subunit, demonstrating that the C364S synthetase had retained its conformation and specifically lost the fatty acylation site. These results provide evidence that the flow of fatty acyl groups in the fatty acid reductase complex is modulated by interaction of the reductase subunit with a cysteine residue very close to the carboxyl terminal of the synthetase, which in turn acts as a flexible arm to transfer acyl groups between the sites of activation and reduction.
|
22. |
Ferri SR,
Soly RR,
Szittner RB,
Meighen EA,
( 1991 ) Structure and properties of luciferase from Photobacterium phosphoreum. PMID : 2018544 : DOI : 10.1016/0006-291x(91)90959-b Abstract >>
The nucleotide sequences of the luxA and luxB genes coding for the alpha and beta subunits, respectively, of luciferase from Photobacterium phosphoreum have been determined. The predicted amino acid sequences of the alpha and beta subunits were shown to be significantly different from other bacterial luciferases with 62 to 88% identity with the alpha subunits and 47 to 71% identity with the beta subunits of other species. Expression of the different luciferases appear to correlate with the number of modulator codons. Kinetic properties of P. phosphoreum luciferase were shown to reflect the bacterium's natural cold temperature habitat.
|
23. |
O'Kane DJ,
Woodward B,
Lee J,
Prasher DC,
( 1991 ) Borrowed proteins in bacterial bioluminescence. PMID : 1996310 : DOI : 10.1073/pnas.88.4.1100 PMC : PMC50964 Abstract >>
A library of Photobacterium phosphoreum DNA was screened in lambda 2001 for the lumazine protein gene, using two degenerate 17-mer oligonucleotide probes that were deduced from a partial protein primary sequence. The lumazine protein gene was localized to a 3.4-kilobase BamHI/EcoRI fragment in one clone. The fragment contained an open reading frame, encoding a 189-residue protein, that had a predicted amino acid sequence that concurred with the partial sequence determined for lumazine protein. Considerable sequence similarity was detected between lumazine protein, the yellow fluorescence protein from Vibrio fischeri, and the alpha subunit of riboflavin synthetase (EC 2.5.1.9). A highly conserved sequence in lumazine protein corresponds to the proposed lumazine binding sites in the alpha subunit of riboflavin synthetase. Several secondary structure programs predict the conformation of this site in lumazine protein to be a beta-sheet. A minimal model with three interactions between the ligand and this beta-sheet structure is proposed, which is consistent with the results of NMR and ligand binding studies.
|
24. |
Iwatani T,
Okino N,
Sakakura M,
Kajiwara H,
Takakura Y,
Kimura M,
Ito M,
Yamamoto T,
Kakuta Y,
( 2009 ) Crystal structure of alpha/beta-galactoside alpha2,3-sialyltransferase from a luminous marine bacterium, Photobacterium phosphoreum. PMID : 19467231 : DOI : 10.1016/j.febslet.2009.05.032 Abstract >>
Alpha/beta-galactoside alpha2,3-sialyltransferase produced by Photobacterium phosphoreum JT-ISH-467 is a unique enzyme that catalyzes the transfer of N-acetylneuraminic acid residue from cytidine monophosphate N-acetylneuraminic acid to acceptor carbohydrate groups. The enzyme recognizes both mono- and di-saccharides as acceptor substrates, and can transfer Neu5Ac to both alpha-galactoside and beta-galactoside, efficiently. To elucidate the structural basis for the broad acceptor substrate specificity, we determined the crystal structure of the alpha2,3-sialyltransferase in complex with CMP. The overall structure belongs to the glycosyltransferase-B structural group. We could model a reasonable active conformation structure based on the crystal structure. The predicted structure suggested that the broad substrate specificity could be attributed to the wider entrance of the acceptor substrate binding site.
|
25. |
Prasher DC,
O'Kane D,
Lee J,
Woodward B,
( 1990 ) The lumazine protein gene in Photobacterium phosphoreum is linked to the lux operon. PMID : 2243804 : DOI : 10.1093/nar/18.21.6450 PMC : PMC332566 Abstract >>
N/A
|
26. |
( 1997 ) Cysteine-286 as the site of acylation of the Lux-specific fatty acyl-CoA reductase. PMID : 9128139 : DOI : 10.1016/s0167-4838(96)00203-8 Abstract >>
The channelling of fatty acids into the fatty aldehyde substrate for the bacterial bioluminescence reaction is catalyzed by a fatty acid reductase multienzyme complex, which channels fatty acids through the thioesterase (LuxD), synthetase (LuxE) and reductase (LuxC) components. Although all three components can be readily acylated in extracts of different luminescent bacteria, this complex has been successfully purified only from Photobacterium phosphoreum and the sites of acylation identified on LuxD and LuxE. To identify the acylation site on LuxC, the nucleotide sequence of P. phosphoreum luxC has been determined and the gene expressed in a mutant Escherichia coli strain. Even in crude extracts, the acylated reductase intermediate as well as acyl-CoA reductase activity could be readily detected, providing the basis for analysis of mutant reductases. Comparison of the amino-acid sequences of LuxC from P. phosphoreum, P. leiognathi and other luminescent bacteria, showed that only three cysteine residues (C171, C279, and C286) were conserved. As a cysteine residue on LuxC has been implicated in fatty acyl transfer, each of the conserved cysteine residues of the P. phosphoreum and P. leiognathi reductases was converted to a serine residue, and the properties of the mutant proteins examined. Only mutation of C286-blocked reductase activity and prevented formation of the acylated reductase intermediate, showing that C286 is the site of acylation on LuxC.
|
27. |
( 1996 ) Methylenetetrahydrofolate dehydrogenase-cyclohydrolase from Photobacterium phosphoreum shares properties with a mammalian mitochondrial homologue. PMID : 8765228 : DOI : 10.1016/0167-4838(96)00052-0 Abstract >>
The marine bioluminescent bacterium Photobacterium phosphoreum expresses a bifunctional methylenetetrahydrofolate dehydrogenase-cyclohydrolase with dual cofactor specificity. An investigation of the kinetic parameters of the P. phosphoreum enzyme indicate that its utilization of dinucleotide cofactors shares similarities with the human mitochondrial dehydrogenase-cyclohydrolase. Both enzymes exhibit dual cofactor specificity and the NAD(+)-dependent dehydrogenase activities from both enzymes can be activated by inorganic phosphate. Furthermore, an analysis of multiply aligned dehydrogenase-cyclohydrolase sequences from 11 species revealed that bacterial and mitochondrial enzymes are more closely related to each other than to the dehydrogenase-cyclohydrolase domains from eukaryotic trifunctional enzymes, and that the bacterial and mitochondrial enzymes share a common point of divergence. Since the NADP+ cofactor is kinetically favoured by a factor of 18 over NAD+, and is therefore likely to be the preferred in vivo cofactor, we propose that the P. phosphoreum enzyme and the human mitochondrial enzyme evolved from a common ancestral dehydrogenase-cyclohydrolase with dual cofactor specificity, but that cofactor preference in these two enzymes diverged in response to different metabolic requirements.
|
28. |
( 1994 ) Riboflavin synthesis genes are linked with the lux operon of Photobacterium phosphoreum. PMID : 8144477 : DOI : 10.1128/jb.176.7.2100-2104.1994 PMC : PMC205317 Abstract >>
Four genes immediately downstream of luxG in the Photobacterium phosphoreum lux operon (ribEBHA) have been sequenced and shown to be involved in riboflavin synthesis. Sequence analyses and complementation of Escherichia coli riboflavin auxotrophs showed that the gene products of ribB and ribA are 3,4-dihydroxy-2-butanone 4-phosphate (DHBP) synthetase and GTP cyclohydrolase II, respectively. By expression of P. phosphoreum ribE in E. coli using the bacteriophage T7 promoter-RNA polymerase system, ribE was shown to code for riboflavin synthetase, which catalyzes the conversion of lumazine to riboflavin. Increased thermal stability of RibE on expression with RibH indicated that ribH coded for lumazine synthetase. The organization of the rib genes in P. phosphoreum is quite distinct, with ribB and ribA being linked but separated by ribH, whereas in E. coli, they are unlinked and in Bacillus subtilis, RibB and RibA functions are coded by a single gene.
|
29. |
Riendeau D,
Rodriguez A,
Meighen E,
( 1982 ) Resolution of the fatty acid reductase from Photobacterium phosphoreum into acyl protein synthetase and acyl-CoA reductase activities. Evidence for an enzyme complex. PMID : 7085612 : Abstract >>
N/A
|
30. |
Soly RR,
Mancini JA,
Ferri SR,
Boylan M,
Meighen EA,
( 1988 ) A new lux gene in bioluminescent bacteria codes for a protein homologous to the bacterial luciferase subunits. PMID : 3415691 : DOI : 10.1016/s0006-291x(88)81092-1 Abstract >>
The nucleotide sequence of a new gene, luxF, located between the luxB and E genes in the bioluminescent system of Photobacterium phosphoreum has been determined. The luxF gene codes for a polypeptide of 231 amino acids which is homologous to the alpha and beta subunits of luciferase coded by the luxA and luxB genes, respectively. The degree of homology of the luxF protein is very high with the beta subunit of luciferase (approximately 30% identity) with greatest similarity to the Vibrio luxB proteins. the luxF gene appears to have evolved by duplication of the luxB gene followed by deletion of approximately 100 codons just penultimate to the 5'-terminal. The close homology with the luciferase beta subunit implicates the luxF protein in a function related to the light-emitting reaction.
|
31. |
( 1997 ) Detection and speciation of bacteria through PCR using universal major cold-shock protein primer oligomers. PMID : 9439003 : Abstract >>
The detection of bacteria using PCR is a well-established diagnostic technique. However, conventional PCR requires the use of DNA primer oligomers that are specific to the target organism and, as a consequence, a sample can only be tested for the presence of that specific target. A significant advantage would be to probe a sample for the presence of any bacteria, followed by identification. To achieve this it is necessary to identify a DNA sequence common to all bacteria. Here we demonstrate that such a sequence may be that encoding the major cold-shock proteins. Using two universal PCR primer oligomers from conserved regions of these gene homologues, we have amplified a 200 base-pair DNA sequence from more than 30 diverse Gram-positive and Gram-negative bacteria, including representatives from the genera Aeromonas, Bacillus, Citrobacter, Enterobacter, Enterococcus, Escherichia, Klebsiella, Lactobacillus, Lactococcus, Listeria, Pediococcus, Photobacterium, Proteus, Salmonella, Shigella, Staphylococcus, Streptococcus, and Yersinia. Sequence analysis of the amplified products confirmed a high level of DNA homology. Significantly, however, there are sufficient nucleotide variations to allow the unique allocation of each amplified sequence to its parental bacterium.
|