| 1. |
Davail S,
Feller G,
Narinx E,
Gerday C,
( 1992 ) Sequence of the subtilisin-encoding gene from an antarctic psychrotroph Bacillus TA41. PMID : 1398082 : DOI : 10.1016/0378-1119(92)90080-9 Abstract >>
The nucleotide sequence of the subtilisin-encoding gene from the antarctic psychrotroph, Bacillus TA41, was determined. The primary structure of the subtilisin precursor corresponds to a preproenzyme of 419 amino acids. Asp144, His181 and Ser359 are the proposed catalytic residues of the protease active site.
|
2. |
Chung YJ,
Hansen JN,
( 1992 ) Determination of the sequence of spaE and identification of a promoter in the subtilin (spa) operon in Bacillus subtilis. PMID : 1400221 : DOI : 10.1128/jb.174.20.6699-6702.1992 PMC : PMC207657 Abstract >>
An 851-residue open reading frame (ORF) called SpaE has been discovered in the subtilin (spa) operon. Interruption of this ORF with a chloramphenicol acetyltransferase gene destroys the ability of Bacillus subtilis LH45 delta c (a derivative of B. subtilis 168) to produce subtilin, which is an antimicrobial peptide belonging to the class of ribosomally synthesized peptide antibiotics called lantibiotics. SpaE shows strong homology to NisB, which is in the nisin (nis) operon in Lactococcus lactis ATCC 11454. Despite the strong sequence homology between SpaE and NisB, the spaE and nisB genes occupy very different locations in their respective operons, indicating that they have been evolving separately for a long time. Primer extension analysis was employed to identify a promoter upstream from the spaE gene, which appears to define the 5' end of the spa operon, which contains four other ORFs (Y. J. Chung, M. T. Steen, and J. N. Hansen, J. Bacteriol. 174:1417-1422, 1992).
|
3. |
Müller J,
Walter F,
van Dijl JM,
Behnke D,
( 1992 ) Suppression of the growth and export defects of an Escherichia coli secA(Ts) mutant by a gene cloned from Bacillus subtilis. PMID : 1435734 : DOI : 10.1007/bf00286185 Abstract >>
A gene library of Bacillus subtilis chromosomal DNA was screened for genes capable of reverting the growth defects of the Escherichia coli secA51(Ts) mutant at 42 degrees C. A B. subtilis gene, designated csaA, was found to phenotypically suppress not only the growth defects of the E. coli mutant, but also to relieve the detrimental accumulation of precursors of exported proteins. The csaA gene encoded a protein of 15 kDa (137 amino acids) and was likely to be the distalmost member of an operon. No similarity to csaA was found among DNA or protein sequences deposited in databases. In contrast to other homologous or heterologous suppressors of the E. coli secA51(Ts) mutation, the csaA gene did not exert pleiotropic effects on either the E. coli secY24(Ts) or lep9(Ts) mutations. However, it restored the ability of a SecB-deficient mutant to grow on complex medium. It is proposed that CsaA serves as a molecular chaperone for exported proteins or alternatively acts by stabilizing the SecA protein.
|
4. |
Herzberg O,
( 1992 ) An atomic model for protein-protein phosphoryl group transfer. PMID : 1447219 : Abstract >>
The high resolution crystal structures of two interacting proteins from the phosphoenolpyruvate:sugar phosphotransferase system, the histidine-containing phosphocarrier protein (HPr) and the IIA domain of glucose permease (IIA(Glc)) from Bacillus subtilis, provide the basis for modeling the transient binary complex formed during the phosphoryl group transfer. The complementarity of the interacting surfaces implies that no major conformational transition is required. The negatively charged phosphoryl group is buried in the interface, suggesting a key role for electrostatic interactions. It is proposed that the phosphoryl transfer is triggered by a switch between two salt bridges involving Arg-17 of the HPr. The first, prior to phosphoryl group transfer, is intramolecular, with the phosphorylated His-15. The second, during the transfer, is intermolecular, with 2 aspartate residues associated with the active site of IIA(Glc). Such alternating ion pairs may be mechanistically important in other protein-protein phosphotransfer reactions.
|
5. |
Henriques AO,
de Lencastre H,
Piggot PJ,
( N/A ) A Bacillus subtilis morphogene cluster that includes spoVE is homologous to the mra region of Escherichia coli. PMID : 1391053 : DOI : 10.1016/0300-9084(92)90146-6 Abstract >>
It is known that there is a strong similarity in amino acid sequence between the products of the Escherichia coli morphogenes ftsW (mra region at 2 min) and rodA (mrd region at 14 min) and the Bacillus subtilis SpoVE protein which is required for spore cortex formation. We show here that the predicted amino acid sequences coded for by the genes flanking spoVE are homologous to the products of the E coli genes murD and murG, which flank ftsW, and are involved in peptidoglycan biosynthesis. During vegetative growth and early stationary phase spoVE is cotranscribed with murD and murG in the form of very long polycistronic messages originating upstream of murD. However, this transcriptional activity is shut-off soon (approximately 1 h) after the cells enter stationary phase, and spoVE is then transcribed at two times during sporulation from its own promoter(s). Insertional in vitro mutagenesis of the region revealed that although murD and murG are essential for normal vegetative growth, spoVE is only required for sporulation: spoVE null mutants display a sporulation stage V phenotype indistinguishable by light microscopy from the phenotype conferred by the spoVE85 and spoVE153 alleles that originally defined the locus.
|
6. |
Kato T,
Yamagata Y,
Arai T,
Ichishima E,
( 1992 ) Purification of a new extracellular 90-kDa serine proteinase with isoelectric point of 3.9 from Bacillus subtilis (natto) and elucidation of its distinct mode of action. PMID : 1368833 : DOI : 10.1271/bbb.56.1166 Abstract >>
A new extracellular 90-kDa serine proteinase with an isoelectric point (pI) of 3.9 was purified from Bicillus subtilis (natto). Microheterogeneity was detected in the 50-kDa protease of bacillopeptidase F with pI 4.4 reported previously by Wu et al. and the sequence for the first 25 amino acids in the internal region of the enzyme was analyzed: ATDGVEWNVDQIDAPKAWALGYDGA. The cleavage sites in the oxidized B-chain of insulin by the proteinase were CySO3H7-Gly8, Val12-Glu13, Try16-Leu17, and Phe25-Tyr26. The activity was inhibited by phenylmethylsulfonyl fluoride (PMSF) and chymostatin, while the activity was not inhibited by proteinaceous Streptomyces subtilisin inhibitor (SSI) or alpha 2-macroglubulin.
|
7. |
Park SH,
Kim HK,
Pack MY,
( 1991 ) Characterization and structure of the cellulase gene of Bacillus subtilis BSE616. PMID : 1368694 : Abstract >>
The Bacillus subtilis carboxymethyl cellulase (CMCase) gene originally cloned on a 3.2-kb PstI DNA fragment has been localized in a 1.5-kb Sau3AI fragment by a series of subclonings into plasmid pUC19. During the process the promoter region and Shine-Dalgarno (SD) sequence were deleted, but the 1.5-kb insert was shown to direct the synthesis of CMCase in scherichia coli to a high level, probably with the aid of lac promoter. We analyzed the complete nucleotide sequence of the CMCase gene. The CMCase gene is 1500-bp long, encoding a polypeptide of 499 amino acids and a stop codon. The putative "-35" region (TAGACA), "-10" region (TACAAT), and ribosome binding site (RBS) (AAGGAGG) have also been identified in the 5' flanking region. Comparison of the nucleotide sequence to three other published endo-beta-1,4-glucanase genes of B. subtilis strains shows that these sequences share very strong homology. It seems that the cellulase genes have been derived from a common ancestor by spontaneous mutation. The probability of carboxy-terminal processing of the CMCase protein is also discussed.
|
8. |
Hara T,
Nagatomo S,
Ogata S,
Ueda S,
( 1992 ) The DNA sequence of gamma-glutamyltranspeptidase gene of Bacillus subtilis (natto) plasmid pUH1. PMID : 1369479 : Abstract >>
The gamma-glutamyltranspeptidase (gamma-GTP) gene of Bacillus subtilis (natto) plasmid designated pUH1, which is responsible for polyglutamate production, has been cloned and the nucleotide sequence determined. The sequence contains a single open-reading frame stretching for 1260 bp with a relative molecular mass of 49,356. Putative -35 and -10 sequences, TTCAAA and TATTAT, were observed as the consensus sequence for the promoter recognized by the sigma 43 RNA polymerase of B. subtilis, and the ribosome binding site, the sequence of which was AACGAG, was complementary to the binding sequence of B. subtilis 16S rRNA except for one base. The amino acid sequence of the gene with the segment of putative protein C403 of staphylococcal plasmid pE194 indicates homology, whereas that with Escherichia coli and mammalian gamma-GTPs does not show any similarity at all.
|
9. |
Ogawa Y,
Hosoyama H,
Hamano M,
Motai H,
( 1991 ) Purification and properties of gamma-glutamyltranspeptidase from Bacillus subtilis (natto). PMID : 1371053 : Abstract >>
To understand the mechanism by which gamma-polyglutamic acid (gamma-PGA) in the sticky material of natto was synthesized, we purified the gamma-glutamyltranspeptidase (gamma-GTP) (EC 2.3.2.2) from the culture broth of Bacillus subtilis (natto) to homogeneity. gamma-GTP was composed of two subunits with molecular weight of 45,000 and 22,000. The N-terminal amino acid sequence of light subunit was homologous with that of gamma-GTP from Escherichia coli. The optimum pH and temperature of activity were 8.5 and 60 degrees C. The enzyme was inactivated by incubation for 15 min at pH 8.0 and 55 degrees C, but little loss of the activity was detected at 40 degrees C. gamma-GTP used glutamine as a gamma-glutamyl donor and acceptor for gamma-PGA synthesis. Dipeptides were better gamma-glutamyl acceptors than free amino acids.
|
10. |
Niersbach M,
Kreuzaler F,
Geerse RH,
Postma PW,
Hirsch HJ,
( 1992 ) Cloning and nucleotide sequence of the Escherichia coli K-12 ppsA gene, encoding PEP synthase. PMID : 1310524 : DOI : 10.1007/bf00279808 Abstract >>
We have cloned and sequenced the Escherichia coli K-12 ppsA gene. The ppsA gene codes for PEP synthase, which converts pyruvate into phosphoenolpyruvate (PEP), an essential step in gluconeogenesis when pyruvate or lactate are used as a carbon source. The open reading frame consists of 792 amino acids and shows homology with other phosphohistidine-containing enzymes that catalyze the conversion between pyruvate and PEP. These enzymes include pyruvate, orthophosphate dikinases from plants and Bacteroides symbiosus and Enzyme I of the bacterial PEP:carbohydrate phosphotransferase system.
|
11. |
Liu J,
Li Z,
Pan N,
Chen Z,
( 1992 ) Purification and partial characterization of an antibacterial protein LCIII. PMID : 1295599 : Abstract >>
Total proteins were precipitated by (NH4)2SO4 from the overnight culture supernatant of antagonistic bacterium Bacillus subtilis A014, applied to CM52 column and separated into three main peaks. The preparation of peak III showed to inhibit specifically the growth of rice bacterial blight pathogen Xanthomonas compestris pv. oryzea was further purified with Mono S column on FPLC and named antibacterial protein LCIII. The molecular weight of this protein is 26915Da, pI = 9.12. Analysis of amino acid composition was revealed to be rich in glycine, threonine and serine, and devoid of proline. Twenty-eight amino acids of N-terminal were sequenced by the Edman degradation and computer analysis of this partial sequence showed that antibacterial protein LCIII is a novel one.
|
12. |
Miao LX,
Cao JW,
Liu RJ,
Wang YL,
Zeng YH,
( 2002 ) [Cloning and sequencing of the proBA gene from the selected mutant resistant to proline analogue from Bacillus subtilis]. PMID : 12693104 : Abstract >>
NTG was used to make chemical mutation for Bacillus subtilis 93151. An enhanced osmotolerant mutant was obtained, which could grow in minimal medium containing 14% NaCl (w/v) and was not subject to proline-mediated feedback repression. The content of the intracellular free proline from the mutant increased rapidly with the rising of NaCl concentration. A 2.3 kb DNA fragment from the mutant was amplified using PCR method. Sequence analysis indicated that three bases changed within the proB gene, compared with the wild-type strain. One of the mutations was substitution of an A for a T at nt position 781, leading to a change of a Ser to a Thr at amino acid residue 261 of the deduced protein product, while other two were silent mutations. The recombinant vector pBE2-proB could functionally complement the proline auxotrophy E. coli 1.1252. Sequence analysis of proA showed that proA and proB overlapped by 4 nt, and there was a SD sequence at nt 14 upstream of the start codon of proA. The deduced amino acid of proA gene shared a high similarity with that of Bacillus subtilis 168 (77%).
|
13. |
Maravi? G,
Feder M,
Pongor S,
Flögel M,
Bujnicki JM,
( 2003 ) Mutational analysis defines the roles of conserved amino acid residues in the predicted catalytic pocket of the rRNA:m6A methyltransferase ErmC'. PMID : 12946350 : DOI : 10.1016/s0022-2836(03)00863-5 Abstract >>
Methyltransferases (MTases) from the Erm family catalyze S-adenosyl-L-methionine-dependent modification of a specific adenine residue in bacterial 23S rRNA, thereby conferring resistance to clinically important macrolide, lincosamide and streptogramin B antibiotics. Despite the available structural data and functional analyses on the level of the RNA substrate, still very little is known about the mechanism of rRNA:adenine-N(6) methylation. Only predictions regarding various aspects of this reaction have been made based on the analysis of the crystal structures of methyltransferase ErmC' (without the RNA) and their comparison with the crystallographic and biochemical data for better studied DNA:m(6)A MTases. To validate the structure-based predictions of presumably essential residues in the catalytic pocket of ErmC', we carried out the site-directed mutagenesis and studied the function of the mutants in vitro and in vivo. Our results indicate that the active site of rRNA:m(6)A MTases is much more tolerant to amino acid substitutions than the active site of DNA:m(6)A MTases. Only the Y104 residue implicated in stabilization of the target base was found to be indispensable. Remarkably, the N101 residue from the "catalytic" motif IV and two conserved residues that form the floor (F163) and one of the walls (N11) of the base-binding site are not essential for catalysis in ErmC'. This somewhat surprising result is discussed in the light of the available structural data and in the phylogenetic context of the Erm family.
|
14. |
Maravi? G,
Bujnicki JM,
Feder M,
Pongor S,
Flögel M,
( 2003 ) Alanine-scanning mutagenesis of the predicted rRNA-binding domain of ErmC' redefines the substrate-binding site and suggests a model for protein-RNA interactions. PMID : 12907737 : DOI : 10.1093/nar/gkg666 PMC : PMC169915 Abstract >>
The Erm family of adenine-N(6) methyltransferases (MTases) is responsible for the development of resistance to macrolide-lincosamide-streptogramin B antibiotics through the methylation of 23S ribosomal RNA. Hence, these proteins are important potential drug targets. Despite the availability of the NMR and crystal structures of two members of the family (ErmAM and ErmC', respectively) and extensive studies on the RNA substrate, the substrate-binding site and the amino acids involved in RNA recognition by the Erm MTases remain unknown. It has been proposed that the small C-terminal domain functions as a target-binding module, but this prediction has not been tested experimentally. We have undertaken structure-based mutational analysis of 13 charged or polar residues located on the predicted rRNA-binding surface of ErmC' with the aim to identify the area of protein-RNA interactions. The results of in vivo and in vitro analyses of mutant protein suggest that the key RNA-binding residues are located not in the small domain, but in the large catalytic domain, facing the cleft between the two domains. Based on the mutagenesis data, a preliminary three-dimensional model of ErmC' complexed with the minimal substrate was constructed. The identification of the RNA-binding site of ErmC' may be useful for structure-based design of novel drugs that do not necessarily bind to the cofactor-binding site common to many S-adenosyl-L- methionine-dependent MTases, but specifically block the substrate-binding site of MTases from the Erm family.
|
15. |
Oakley AJ,
Heinrich T,
Thompson CA,
Wilce MC,
( 2003 ) Characterization of a family 11 xylanase from Bacillus subtillis B230 used for paper bleaching. PMID : 12657781 : DOI : 10.1107/s0907444903001227 Abstract >>
Enzymes such as family 11 xylanases are increasingly being used for industrial applications. Here, the cloning, structure determination and temperature-stability data of a family 11 xylanase, Xyn11X, from the alkali-tolerant Bacillus subtilis subspecies B230 are reported. This enzyme, which degrades xylan polymers, is being produced on an industrial scale for use in the paper-bleaching industry. Xyn11X adopts the canonical family 11 xylanase fold. It has a greater abundance of side chain to side chain hydrogen bonds compared with all other family 11 xylanase crystal structures. Means by which the thermostability of Xyn11X might be improved are suggested.
|
16. |
Titok MA,
Chapuis J,
Selezneva YV,
Lagodich AV,
Prokulevich VA,
Ehrlich SD,
Jannière L,
( 2003 ) Bacillus subtilis soil isolates: plasmid replicon analysis and construction of a new theta-replicating vector. PMID : 12584001 : Abstract >>
We have searched for plasmids in a collection of 55 Bacillus subtilis strains isolated from various natural sources of the territory of Belarus. Twenty percent of the strains contained one or two plasmids of either 6-8 or approximately 90 kb. Small plasmids were shown to carry a rolling circle replicon of the pC194 type. Four out of the eight large plasmids contained a related theta replicon that has no homolog in databases as shown by sequence determination. A B. subtilis/Escherichia coli shuttle vector based on this replicon was constructed. It has a low copy number (6 units per chromosome) and is stably inherited in B. subtilis. It might thus be a useful tool for DNA cloning. These data extend previous observations, indicating that most of the small plasmids of B. subtilis replicate as rolling circles and belong to the pC194 family. On the contrary, large plasmids appear to form a large pool of theta-replicating determinants, since three different replicons have already been isolated from them.
|
17. |
Roongsawang N,
Thaniyavarn J,
Thaniyavarn S,
Kameyama T,
Haruki M,
Imanaka T,
Morikawa M,
Kanaya S,
( 2002 ) Isolation and characterization of a halotolerant Bacillus subtilis BBK-1 which produces three kinds of lipopeptides: bacillomycin L, plipastatin, and surfactin. PMID : 12486459 : DOI : 10.1007/s00792-002-0287-2 Abstract >>
Twenty-three halotolerant and biosurfactant producing strains were collected from salty conditions in central Thailand. One of the strains designated BBK-1 produced the biosurfactants with the highest activity. BBK-1 was isolated from fermented foods and was identified as B. subtilis based on its physiological characteristics and 16S rRNA gene sequence. We show that the strain grows in media containing NaCl up to 16% (w/v) and produces biosurfactants in NaCl up to 8%. We found that B. subtilis BBK-1 produces three kinds of surface-active lipopeptides simultaneously. By their respective molecular weights and amino acid compositions, it is indicated that these lipopeptides are bacillomycin L, plipastatin, and surfactin. In order to analyze the production mechanism of lipopeptides further in the strain, a generally important biosynthetic gene encoding 4'-phosphopantetheinyl transferase was cloned and sequenced. The gene existed in a single copy in the genome and the deduced amino acid sequence was almost identical to that of Lpa-14 from B. subtilis strain RB14, which co-produces iturin A and surfactin.
|
18. |
May JJ,
Kessler N,
Marahiel MA,
Stubbs MT,
( 2002 ) Crystal structure of DhbE, an archetype for aryl acid activating domains of modular nonribosomal peptide synthetases. PMID : 12221282 : DOI : 10.1073/pnas.182156699 PMC : PMC129408 Abstract >>
The synthesis of the catecholic siderophore bacillibactin is accomplished by the nonribosomal peptide synthetase (NRPS) encoded by the dhb operon. DhbE is responsible for the initial step in bacillibactin synthesis, the activation of the aryl acid 2,3-dihydroxybenzoate (DHB). The stand-alone adenylation (A) domain DhbE, the structure of which is presented here, exhibits greatest homology to other NRPS A-domains, acyl-CoA ligases and luciferases. It's structure is solved in three different states, without the ligands ATP and DHB (native state), with the product DHB-AMP (adenylate state) and with the hydrolyzed product AMP and DHB (hydrolyzed state). The 59.9-kDa protein folds into two domains, with the active site at the interface between them. In contrast to previous proposals of a major reorientation of the large and small domains on substrate binding, we observe only local structural rearrangements. The structure of the phosphate binding loop could be determined, a motif common to many adenylate-forming enzymes, as well as with bound DHB-adenylate and the hydrolyzed product DHB*AMP. Based on the structure and amino acid sequence alignments, an adapted specificity conferring code for aryl acid activating domains is proposed, allowing assignment of substrate specificity to gene products of previously unknown function.
|
19. |
Ansaldi M,
Marolt D,
Stebe T,
Mandic-Mulec I,
Dubnau D,
( 2002 ) Specific activation of the Bacillus quorum-sensing systems by isoprenylated pheromone variants. PMID : 12067344 : DOI : 10.1046/j.1365-2958.2002.02977.x Abstract >>
Natural genetic competence in Bacillus subtilis is controlled by quorum-sensing (QS). The ComP- ComA two-component system detects the signalling molecule ComX, and this signal is transduced by a conserved phosphotransfer mechanism. ComX is synthesized as an inactive precursor and is then cleaved and modified by ComQ before export to the extracellular environment. The comQXP' loci of a set of natural Bacillus isolates have been sequenced and shown to possess a striking polymorphism that determines specific patterns of both activation and inhibition of the quorum-sensing response. We have developed a simple purification method for the modified peptide signalling pheromones allowing the characterization of four distinct ComX molecules representing different pherotypes. Genetic and biochemical evidence demonstrate that all the ComX variants are isoprenylated by the post-translational modification of a conserved tryptophan residue and that the modifications on the ComX peptide backbones vary in mass among the various pherotypes. These results give new insights into peptidemediated quorum-sensing signalling in Gram-positive bacteria and emphasize the role of isoprenylation in bacterial signal transduction.
|
20. |
Maruyama R,
Nishizawa M,
Itoi Y,
Ito S,
Inoue M,
( 2002 ) The enzymes with benzil reductase activity conserved from bacteria to mammals. PMID : 11796169 : Abstract >>
The diketone compound, benzil is reduced to (S)-benzoin with living Bacillus cereus cells. Recently, we isolated a gene responsible for benzil reduction, and Escherichia coli cells in which this gene was overexpressed transformed benzil to (S)-benzoin. Although this benzil reductase showed high identity to the short-chain dehydrogenase/reductase (SDR) family, enzymological features were unknown. Here, we demonstrated that many B. cereus strains had benzil reductase activity in vivo, and that the benzil reductases shared 94-100% amino acid identities. Recombinant B. cereus benzil reductase produced optically pure (S)-benzoin with NADPH in vitro, and the ketone group distal to a benzene ring was asymmetrically reduced. B. cereus benzil reductase showed 31% amino acid identity to the yeast open reading frame YIR036C protein and 28-30% to mammalian sepiapterin reductases, sharing the seven residues consensus for the SDR family. We isolated the genes encoding yeast YIR036C protein and gerbil sepiapterin reductase, and both recombinant proteins also reduced benzil to (S)-benzoin in vitro. Green fluorescent protein-tagged B. cereus benzil reductase distributed in the bipolar cytoplasm in B. cereus cells. Asymmetric reduction with B. cereus benzil reductase, yeast YIR036C protein and gerbil sepiapterin reductase will be utilized to produce important chiral compounds.
|
21. |
Lotareva OV,
Poluéktova EU,
Titok MA,
Prozorov AA,
( N/A ) [Soil strain of Bacillus subtilis harboring a large plasmid that mediates high-frequency conjugal mobilization]. PMID : 12024828 : Abstract >>
The ability of a soil strain of Bacillus subtilis harboring a large plasmid, p19, to mobilize a small staphylococcus plasmid, pUB110, was studied. The latter plasmid was transferred to the recipient cells of Bacillus subtilis 168 at a high frequency (about 10(-2) per recipient cell) both on filter surface and in liquid medium. Mobilization was initiated 40 to 50 min after the beginning of the contact between donor and recipient cells.
|
22. |
Tsuge K,
Akiyama T,
Shoda M,
( 2001 ) Cloning, sequencing, and characterization of the iturin A operon. PMID : 11591669 : DOI : 10.1128/JB.183.21.6265-6273.2001 PMC : PMC100110 Abstract >>
Bacillus subtilis RB14 is a producer of the antifungal lipopeptide iturin A. Using a transposon, we identified and cloned the iturin A synthetase operon of RB14, and the sequence of this operon was also determined. The iturin A operon spans a region that is more than 38 kb long and is composed of four open reading frames, ituD, ituA, ituB, and ituC. The ituD gene encodes a putative malonyl coenzyme A transacylase, whose disruption results in a specific deficiency in iturin A production. The second gene, ituA, encodes a 449-kDa protein that has three functional modules homologous to fatty acid synthetase, amino acid transferase, and peptide synthetase. The third gene, ituB, and the fourth gene, ituC, encode 609- and 297-kDa peptide synthetases that harbor four and two amino acid modules, respectively. Mycosubtilin, which is produced by B. subtilis ATCC 6633, has almost the same structure as iturin A, but the amino acids at positions 6 and 7 in the mycosubtilin sequence are D-Ser-->L-Asn, while in iturin A these amino acids are inverted (i.e., D-Asn-->L-Ser). Comparison of the amino acid sequences encoded by the iturin A operon and the mycosubtilin operon revealed that ituD, ituA, and ituB have high levels of homology to the counterpart genes fenF (79%), mycA (79%), and mycB (79%), respectively. Although the overall level of homology of the amino acid sequences encoded by ituC and mycC, the counterpart of ituC, is relatively low (64%), which indicates that there is a difference in the amino acid sequences of the two lipopeptides, the levels of homology between the putative serine adenylation domains and between the asparagine adenylation domains in the two synthetases are high (79 and 80%, respectively), implying that there is an intragenic domain change in the synthetases. The fact that the flanking sequence of the iturin A synthetase coding region was highly homologous to the flanking sequence that of xynD of B. subtilis 168 and the fact that the promoter of the iturin A operon which we identified was also conserved in an upstream sequence of xynD imply that horizontal transfer of this operon occurred. When the promoter was replaced by the repU promoter of the plasmid pUB110 replication protein, production of iturin A increased threefold.
|
23. |
Lazarevic V,
Abellan FX,
Möller SB,
Karamata D,
Mauël C,
( 2002 ) Comparison of ribitol and glycerol teichoic acid genes in Bacillus subtilis W23 and 168: identical function, similar divergent organization, but different regulation. PMID : 11882717 : DOI : 10.1099/00221287-148-3-815 Abstract >>
The tar genes directing the synthesis of poly(ribitol phosphate), the main teichoic acid in Bacillus subtilis strain W23, were sequenced. They are organized in two divergently transcribed operons, tarABIJKL and tarDF, as are the tag genes specifying poly(glycerol phosphate) synthesis in B. subtilis 168. The features of the tar genes as well as the putative participation of their products in the proposed biosynthesis pathway of poly(ribitol phosphate) are presented. The tarA and tarD genes, which are most likely involved in the synthesis of the linkage unit (the entity coupling teichoic acid to peptidoglycan), are separated by 508 nt. Sequences of the outer segments of this regulatory region are similar to the two divergent promoter regions identified upstream of the tagA and tagD genes in strain 168. However, in W23, these regions, which also included functional promoters, are separated by an additional DNA segment of about 100 nt, on which two new mRNA starts, one in each direction, were identified. The regulatory regions of teichoic acid divergons of Bacillus globigii, Bacillus licheniformis and eight strains of B. subtilis were cloned and sequenced. In four B. subtilis strains and in B. globigii, their length and sequence are similar to the regulatory region of W23. In the others, including B. licheniformis, they are of the 168-type. Analysis of nucleotide sequences of a non-coding grey hole, present in the tag region of strain 168, revealed higher similarities to tar than to tag entities. This suggests that at least part of the tag genes specifying the synthesis of glucosylated poly(glycerol phosphate) in strain 168 was introduced by horizontal gene transfer into a strain originally synthesizing a ribitol-phosphate-containing teichoic acid.
|
24. |
Qi Y,
Patra G,
Liang X,
Williams LE,
Rose S,
Redkar RJ,
DelVecchio VG,
( 2001 ) Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. PMID : 11472954 : DOI : 10.1128/AEM.67.8.3720-3727.2001 PMC : PMC93078 Abstract >>
The potential use of Bacillus anthracis as a weapon of mass destruction poses a threat to humans, domesticated animals, and wildlife and necessitates the need for a rapid and highly specific detection assay. We have developed a real-time PCR-based assay for the specific detection of B. anthracis by taking advantage of the unique nucleotide sequence of the B. anthracis rpoB gene. Variable region 1 of the rpoB gene was sequenced from 36 Bacillus strains, including 16 B. anthracis strains and 20 other related bacilli, and four nucleotides specific for B. anthracis were identified. PCR primers were selected so that two B. anthracis-specific nucleotides were at their 3' ends, whereas the remaining bases were specific to the probe region. This format permitted the PCR reactions to be performed on a LightCycler via fluorescence resonance energy transfer (FRET). The assay was found to be specific for 144 B. anthracis strains from different geographical locations and did not cross-react with other related bacilli (175 strains), with the exception of one strain. The PCR assay can be performed on isolated DNA as well as crude vegetative cell lysates in less than 1 h. Therefore, the rpoB-FRET assay could be used as a new chromosomal marker for rapid detection of B. anthracis.
|
25. |
Asano Y,
Onishi H,
Tajima K,
Shinozawa T,
( 2001 ) Flagellin as a biomarker for Bacillus subtilis strains; application to the DB9011 strain and the study of interspecific diversity in amino-acid sequences. PMID : 11440144 : DOI : 10.1271/bbb.65.1218 Abstract >>
Polymerase chain reaction (PCR) for the flagellin central domain coding region (FCD-PCR) was applied to the detection and discrimination of Bacillus subtilis DB9011, a strain with useful functions in agriculture. Cross-reactions were observed in 4 B. subtilis strains with similar flagellin genes (hag). Alignment of partial amino-acid sequences of flagellin and the results of PCR for the 16S/23S rRNA spacer in 11 B. subtilis strains suggested the presence of a group including strains with antifungal activity (DB9011 and others).
|
26. |
El-Helow ER,
( 2001 ) Identification and molecular characterization of a novel Bacillus strain capable of degrading Tween-80. PMID : 11267766 : DOI : 10.1111/j.1574-6968.2001.tb10551.x Abstract >>
A Tween-80-degrading novel marine Bacillus strain, N10, has recently been isolated in Alexandria University, Egypt. The taxonomic position of this endospore forming bacterium was investigated on the basis of fatty acid analysis and 16S rRNA gene sequencing. Comparative computer database analyses revealed that the bacterium is a Bacillus subtilis strain. The gene encoding the small acid-soluble protein gamma-type (SASP-B), sspE, was successfully utilized in this study as a tool for discrimination between the two B. subtilis subspecies W23 and 168. Based on the alignment of 16S rRNA sequences and analysis of SASP-B relatedness, it has been demonstrated that the novel marine B. subtilis strain N10 is more closely related to the B. subtilis reference strain W23 than to 168. The strain, N10, has been deposited in the Bacillus Genetic Stock Center (BGSC) and assigned the accession number 3A17.
|
27. |
Le Borgne S,
Muñoz ME,
( N/A ) Molecular cloning of the gene that codes for the pyruvate kinase of Bacillus subtilis: primary characterization of a strain carrying this gene insertionally inactivated. PMID : 10932722 : Abstract >>
We have cloned and characterized the pykA gene from Bacillus subtilis which codes for a pyruvate kinase (PK) enzyme. This gene has been located downstream a putative phosphofructokinase gene, suggesting that they are part of the same operon. The deduced amino acid sequence of this PK showed a strong similarity to other PKs from different sources; however, as it has been found in other bacilli, the B. subtilis pykA enzyme had an extra C-terminal sequence consisting of about 112 amino acid residues. This gene was insertionally inactivated at the chromosomal level, with an antibiotic resistance marker. The analysis of this mutation in wild type and pts- backgrounds, indicated that B. subtilis has no other pyruvate kinase activity capable of complementing the absence of PykA.
|
28. |
Tortosa P,
Logsdon L,
Kraigher B,
Itoh Y,
Mandic-Mulec I,
Dubnau D,
( 2001 ) Specificity and genetic polymorphism of the Bacillus competence quorum-sensing system. PMID : 11133937 : DOI : 10.1128/JB.183.2.451-460.2001 PMC : PMC94899 Abstract >>
A quorum-sensing mechanism involving the pheromone ComX and the ComP-ComA two-component system controls natural competence in Bacillus subtilis. ComX is expressed as a cytoplasmic inactive precursor that is released into the extracellular medium as a cleaved, modified decapeptide. This process requires the product of comQ. In the presence of ComX, the membrane-localized ComP histidine kinase activates the response regulator ComA. We compared the sequences of the quorum-sensing genes from four closely related bacilli, and we report extensive genetic polymorphism extending through comQ, comX, and the 5' two-thirds of comP. This part of ComP encodes the membrane-localized and linker domains of the sensor protein. We also determined the sequences of the comX genes of four additional wild-type bacilli and tested the in vivo activities of all eight pheromones on isogenic strains containing four different ComP receptor proteins. A striking pattern of specificity was discovered, providing strong evidence that the pheromone contacts ComP directly. Furthermore, we show that coexpression of comQ and comX in Escherichia coli leads to the production of active pheromone in the medium, demonstrating that comQ is the only dedicated protein required for the processing, modification, and release of active competence pheromone. Some of the implications of these findings for the evolution and the mechanism of the quorum-sensing system are discussed.
|
29. |
Lee HS,
Kim DY,
Kim JW,
Kim TJ,
Kim YW,
Cho HY,
( 2000 ) Molecular characterization of a dimeric intracellular maltogenic amylase of Bacillus subtilis SUH4-2. PMID : 10825545 : DOI : 10.1016/s0167-4838(00)00037-6 Abstract >>
An additional amylase besides the typical alpha-amylase was detected in the cytoplasm of Bacillus subtilis SUH4-2, an isolate from Korean soil. The corresponding gene encoded a maltogenic amylase, which hydrolyzed cyclodextrin or starch to maltose and glucose; pullulan to panose; acarbose to glucose and acarviosine-glucose. Maltogenic amylase of B. subtilis SUH4-2 transferred sugar molecules to form various branched oligosaccharides upon the hydrolysis of substrates. The enzyme existed in a monomer-dimer equilibrium with a molar ratio of 3:2 in 50 mM KH(2)PO(4)-NaOH buffer (pH 7.0). The maltogenic amylase is most likely to be associated with carbohydrate metabolism in the cytoplasm, since the nucleotide sequence of the gene was highly homologous to the yvdF gene of B. subtilis 168, which is located in a gene cluster involved in maltose/maltodextrin utilization.
|
30. |
Tran LS,
Nagai T,
( 2000 ) A new IS4 family insertion sequence, IS4Bsu1, responsible for genetic instability of poly-gamma-glutamic acid production in Bacillus subtilis. PMID : 10762236 : DOI : 10.1128/jb.182.9.2387-2392.2000 PMC : PMC111298 Abstract >>
Certain Bacillus subtilis strains, such as B. subtilis (natto) starter strains for the manufacture of natto (fermented soybeans), produce capsular poly-gamma-glutamate (gammaPGA). In B. subtilis (natto), gammaPGA synthesis is controlled by the ComP-ComA two-component regulatory system and thereby induced at the beginning of the stationary growth phase. We have found a new insertion sequence (IS), designated IS4Bsu1, in the comP gene of a spontaneous gammaPGA-negative mutant of B. subtilis (natto) NAF4. IS4Bsu1 (1,406 bp), the first IS discovered in B. subtilis, encodes a putative transposase (Tpase) with a predicted M(r) of 34,895 (374 residues) which displays similarity to the Tpases of IS4 family members. Southern blot analyses have identified 6 to 11 copies of IS4Bsu1, among which 6 copies were at the same loci, in the chromosomes of B. subtilis (natto) strains, including NAF4, three commercial starters, and another three gammaPGA-producing B. subtilis (natto) strains. All of the eight spontaneous gammaPGA(-) mutants, which were derived from five independent NAF4 cultures, had a new additional IS4Bsu1 copy in comP at six different positions within 600 bp of the 5'-terminal region. The target sites of IS4Bsu1 were determined to be AT-rich 9-bp sequences by sequencing the flanking regions of IS4Bsu1 in mutant comP genes. These results indicate that IS4Bsu1 transposes by the replicative mechanism, in contrast to other IS4 members that use the conservative mechanism, and that most, if not all, of spontaneous gammaPGA(-) mutants appear to have resulted from the insertion of IS4Bsu1 exclusively into comP. The presence of insertion hot spots in comP, which is essential for gammaPGA synthesis, as well as high transposition activity, would account for the high frequency of spontaneous gammaPGA(-) mutation by IS4Bsu1 in B. subtilis (natto).
|
31. |
Kucera R,
Schildkraut I,
Lukacs CM,
( 2000 ) Understanding the immutability of restriction enzymes: crystal structure of BglII and its DNA substrate at 1.5 A resolution. PMID : 10655616 : DOI : 10.1038/72405 Abstract >>
Restriction endonucleases are remarkably resilient to alterations in their DNA binding specificity. To understand the basis of this immutability, we have determined the crystal structure of endonuclease BglII bound to its recognition sequence (AGATCT), at 1. 5 A resolution. We compare the structure of BglII to endonuclease BamHI, which recognizes a closely related DNA site (GGATCC). We show that both enzymes share a similar alpha/beta core, but in BglII, the core is augmented by a beta-sandwich domain that encircles the DNA to provide extra specificity. Remarkably, the DNA is contorted differently in the two structures, leading to different protein-DNA contacts for even the common base pairs. Furthermore, the BglII active site contains a glutamine in place of the glutamate at the general base position in BamHI, and only a single metal is found coordinated to the putative nucleophilic water and the phosphate oxygens. This surprising diversity in structures shows that different strategies can be successful in achieving site-specific recognition and catalysis in restriction endonucleases.
|
32. |
Reinhardt R,
Schmidt M,
Ullrich C,
Bernhard F,
Saenger W,
Seitz H,
Venema G,
Rembold M,
Hamoen LW,
Duitman EH,
( 1999 ) The mycosubtilin synthetase of Bacillus subtilis ATCC6633: a multifunctional hybrid between a peptide synthetase, an amino transferase, and a fatty acid synthase. PMID : 10557314 : DOI : 10.1073/pnas.96.23.13294 PMC : PMC23941 Abstract >>
Bacillus subtilis strain ATCC6633 has been identified as a producer of mycosubtilin, a potent antifungal peptide antibiotic. Mycosubtilin, which belongs to the iturin family of lipopeptide antibiotics, is characterized by a beta-amino fatty acid moiety linked to the circular heptapeptide Asn-Tyr-Asn-Gln-Pro-Ser-Asn, with the second, third, and sixth position present in the D-configuration. The gene cluster from B. subtilis ATCC6633 specifying the biosynthesis of mycosubtilin was identified. The putative operon spans 38 kb and consists of four ORFs, designated fenF, mycA, mycB, and mycC, with strong homologies to the family of peptide synthetases. Biochemical characterization showed that MycB specifically adenylates tyrosine, as expected for mycosubtilin synthetase, and insertional mutagenesis of the operon resulted in a mycosubtilin-negative phenotype. The mycosubtilin synthetase reveals features unique for peptide synthetases as well as for fatty acid synthases: (i) The mycosubtilin synthase subunit A (MycA) combines functional domains derived from peptide synthetases, amino transferases, and fatty acid synthases. MycA represents the first example of a natural hybrid between these enzyme families. (ii) The organization of the synthetase subunits deviates from that commonly found in peptide synthetases. On the basis of the described characteristics of the mycosubtilin synthetase, we present a model for the biosynthesis of iturin lipopeptide antibiotics. Comparison of the sequences flanking the mycosubtilin operon of B. subtilis ATCC6633, with the complete genome sequence of B. subtilis strain 168 indicates that the fengycin and mycosubtilin lipopeptide synthetase operons are exchanged between the two B. subtilis strains.
|
33. |
Shimada J,
Takada T,
Fujimoto Z,
Kaneko H,
Kuriki T,
Ohdan K,
( 1999 ) Characteristics of two forms of alpha-amylases and structural implication. PMID : 10508102 : PMC : PMC91620 Abstract >>
Complete (Ba-L) and truncated (Ba-S) forms of alpha-amylases from Bacillus subtilis X-23 were purified, and the amino- and carboxyl-terminal amino acid sequences of Ba-L and Ba-S were determined. The amino acid sequence deduced from the nucleotide sequence of the alpha-amylase gene indicated that Ba-S was produced from Ba-L by truncation of the 186 amino acid residues at the carboxyl-terminal region. The results of genomic Southern analysis and Western analysis suggested that the two enzymes originated from the same alpha-amylase gene and that truncation of Ba-L to Ba-S occurred during the cultivation of B. subtilis X-23 cells. Although the primary structure of Ba-S was approximately 28% shorter than that of Ba-L, the two enzyme forms had the same enzymatic characteristics (molar catalytic activity, amylolytic pattern, transglycosylation ability, effect of pH on stability and activity, optimum temperature, and raw starch-binding ability), except that the thermal stability of Ba-S was higher than that of Ba-L. An analysis of the secondary structure as well as the predicted three-dimensional structure of Ba-S showed that Ba-S retained all of the necessary domains (domains A, B, and C) which were most likely to be required for functionality as alpha-amylase.
|
34. |
Shoda M,
Ano T,
Hirai M,
Nakamura Y,
( 1999 ) The genes degQ, pps, and lpa-8 (sfp) are responsible for conversion of Bacillus subtilis 168 to plipastatin production. PMID : 10471562 : PMC : PMC89444 Abstract >>
Bacillus subtilis YB8 produces the lipopeptide antibiotic plipastatin. B. subtilis MI113, which is a derivative of strain 168, was converted into a new plipastatin producer, strain 406, by competence transformation with the chromosomal DNA of YB8. Transposon mini-Tn10 insertional mutagenesis was applied to strain 406, which revealed that lpa-8 (sfp) (encoding 4'-phosphopantetheinyl transferase) and the pps operon (located between 167 and 171 degrees) are essential for plipastatin production. The pps operon was previously suggested to encode putative peptide synthetases (A. Tognoni, E. Franchi, C. Magistrelli, E. Colombo, P. Cosmina, and G. Grandi, Microbiology 141:645-648, 1995) and was thought to be the fengycin operon (V. Tosato, A. M. Albertini, M. Zotti, S. Sonda, and C. V. Bruschi, Microbiology 143:3443-3450, 1997). We claim that the pps operon is the pli operon, encoding plipastatin synthetase. By using a new high-performance liquid chromatography system, we revealed that strain 168 expressing only lpa-8 can also produce plipastatin, although the yield is very low. However, the introduction of the pleiotropic regulator degQ of strain YB8 into strain 168 expressing lpa-8 resulted in a 10-fold increase in the production of plipastatin.
|
35. |
Liu ST,
Chen CL,
Chang LK,
Tschen JS,
( 1999 ) Functional and transcriptional analyses of a fengycin synthetase gene, fenC, from Bacillus subtilis. PMID : 10438779 : PMC : PMC93996 Abstract >>
A 37-kb DNA fragment containing five fengycin synthetase genes, including fenC, fenD, fenE, fenA, and fenB, was cloned and sequenced. Among these genes, fenC encodes a fengycin synthetase 2,560 amino acids long with an estimated molecular mass of 287 kDa. This protein contains two amino acid activation modules, FenC1 and FenC2, which activate L-glutamic acid and L-ornithine, respectively. Primer extension, using mRNA isolated from the log-phase cells, identified a transcription start site located 86 nucleotides upstream from the initiation codon of fenC, implying that a promoter is located upstream from the start site. Primer extension using total RNA isolated from stationary-phase cells also identified a transcription start site located 61 nucleotides upstream from the initiation codon of fenC. Gene fusion studies demonstrated that in nHA medium, the cells transcribe the fengycin synthetase genes at two different stages of cell growth. The promoter is active during the log phase, and the activity reaches the highest level during the late log phase. The activity decreases sharply but is maintained at a low level for approximately 24 h after cells enter the early stationary phase. The results of this investigation also suggest that the transcription of fenC is positively regulated during the late log phase. Results presented herein provide further insight into fengycin synthesis by B. subtilis F29-3.
|
36. |
Oppermann-Sanio FB,
Steinbüchel A,
( 1999 ) Biochemical and molecular characterization of the Bacillus subtilis acetoin catabolic pathway. PMID : 10368162 : PMC : PMC93865 Abstract >>
A recent study indicated that Bacillus subtilis catabolizes acetoin by enzymes encoded by the acu gene cluster (F. J. Grundy, D. A. Waters, T. Y. Takova, and T. M. Henkin, Mol. Microbiol. 10:259-271, 1993) that are completely different from those in the multicomponent acetoin dehydrogenase enzyme system (AoDH ES) encoded by aco gene clusters found before in all other bacteria capable of utilizing acetoin as the sole carbon source for growth. By hybridization with a DNA probe covering acoA and acoB of the AoDH ES from Clostridium magnum, genomic fragments from B. subtilis harboring acoA, acoB, acoC, acoL, and acoR homologous genes were identified, and some of them were functionally expressed in E. coli. Furthermore, acoA was inactivated in B. subtilis by disruptive mutagenesis; these mutants were impaired to express PPi-dependent AoDH E1 activity to remove acetoin from the medium and to grow with acetoin as the carbon source. Therefore, acetoin is catabolized in B. subtilis by the same mechanism as all other bacteria investigated so far, leaving the function of the previously described acu genes obscure.
|
37. |
Thomas CM,
Poluektova EU,
( 1999 ) Complete sequence of Bacillus subtilis plasmid p1414 and comparison with seven other plasmid types found in Russian soil isolates of Bacillus subtilis. PMID : 10366533 : DOI : 10.1006/plas.1999.1393 Abstract >>
We determined the complete sequence of a cryptic 7949-bp plasmid isolated from naturally occurring Bacillus subtilis found in Russian soil from Moscow. We found 15 putative open reading frames (ORFs), all of which were preceded by a ribosome binding site. One encodes the gene (rep) which should be essential for vegetative rolling circle replication (RCR). The putative double-stranded origin as well as a palT1-like single-stranded origin was also identified. The predicted product of another ORF showed similarity to a moblization protein while a third showed similarity to a ubiquitous family of small proteins whose members have so far been associated with stress response. We used fragments with these latter ORFs to probe representatives of seven other groups of cryptic RCR plasmids from geographically related B. subtilis isolates. All plasmids carried the mob function, suggesting a common ancestor for the rep/mob region but the putative hsp was present only on some of the plasmids. This suggests that the putative hsp gene is not an essential plasmid component and may therefore be present as a phenotypic marker-perhaps providing response to stress. This adds weight to the growing evidence that these small Bacillus plasmids may not be cryptic but may provide an adaptive advantage for the host in its natural environment.
|
38. |
Abad-Zapatero C,
Zhong P,
Stewart KD,
Kavanaugh TJ,
( 1999 ) The 2.2 A structure of the rRNA methyltransferase ErmC' and its complexes with cofactor and cofactor analogs: implications for the reaction mechanism. PMID : 10366505 : DOI : 10.1006/jmbi.1999.2788 Abstract >>
The rRNA methyltransferase ErmC' transfers methyl groups from S -adenosyl-l-methionine to atom N6 of an adenine base within the peptidyltransferase loop of 23 S rRNA, thus conferring antibiotic resistance against a number of macrolide antibiotics. The crystal structures of ErmC' and of its complexes with the cofactor S -adenosyl-l-methionine, the reaction product S-adenosyl-l-homocysteine and the methyltransferase inhibitor Sinefungin, respectively, show that the enzyme undergoes small conformational changes upon ligand binding. Overall, the ligand molecules bind to the protein in a similar mode as observed for other methyltransferases. Small differences between the binding of the amino acid parts of the different ligands are correlated with differences in their chemical structure. A model for the transition-state based on the atomic details of the active site is consistent with a one-step methyl-transfer mechanism and might serve as a first step towards the design of potent Erm inhibitors.
|
39. |
Derewenda ZS,
Holm C,
Osterlund T,
Matern U,
Kneusel RE,
( 1999 ) Crystal structure of brefeldin A esterase, a bacterial homolog of the mammalian hormone-sensitive lipase. PMID : 10201402 : DOI : 10.1038/7576 Abstract >>
Brefeldin A esterase (BFAE), a detoxifying enzyme isolated from Bacillus subtilis, hydrolyzes and inactivates BFA, a potent fungal inhibitor of intracellular vesicle-dependent secretory transport and poliovirus RNA replication. We have solved the crystal structure of BFAE and we discovered that the previously reported amino acid sequence was in serious error due to frame shifts in the cDNA sequence. The correct sequence, inferred from the experimentally phased electron density map, revealed that BFAE is a homolog of the mammalian hormone sensitive lipase (HSL). It is a canonical alpha/beta hydrolase with two insertions forming the substrate binding pocket. The enzyme contains a lipase-like catalytic triad, Ser 202, Asp 308 and His 338, consistent with mutational studies that implicate the homologous Ser 424, Asp 693 and His 723 in the catalytic triad in human HSL.
|
40. |
Hu LB,
Shi ZQ,
Zhang T,
Yang ZM,
( 2007 ) Fengycin antibiotics isolated from B-FS01 culture inhibit the growth of Fusarium moniliforme Sheldon ATCC 38932. PMID : 17490402 : DOI : 10.1111/j.1574-6968.2007.00743.x Abstract >>
Strain B-FS01, isolated from rape (Brassica napus) stem infected by Slerotinia sclerotiorum and identified as Bacillus subtilis, exhibited predominantly antagonistic activities against Fusarium moniliforme Sheldon ATCC 38932. Antifungal active compounds (AAC) were isolated and purified from the cultures of strain B-FS01 against ATCC 38932. The HPLC/electron spray ionization/collision-induced dissociation mass spectrum of AAC revealed a cluster of fengycin homologues containing fengycins A, fengycins B and a new type of fengycin. Further toxic assay of AAC in vitro against F. moniliforme indicated that AAC could strongly inhibit the growth of both mycelia and spores. In addition, treatment with AAC significantly modified the maize seed infection by ATCC 38932.
|
41. |
Wang LT,
Lee FL,
Tai CJ,
Kasai H,
( 2007 ) Comparison of gyrB gene sequences, 16S rRNA gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. PMID : 17684269 : DOI : 10.1099/ijs.0.64685-0 Abstract >>
The Bacillus subtilis group comprises eight closely related species that are indistinguishable from one another by 16S rRNA gene sequence analysis. Therefore, the gyrB gene, which encodes the subunit B protein of DNA gyrase, was selected as an alternative phylogenetic marker. To determine whether gyrB gene sequence analysis could be used for phylogenetic analysis and species identification of members of the B. subtilis group, the congruence of gyrB grouping with both 16S rRNA gene sequencing and DNA-DNA hybridization data was evaluated. Ranges of gyrB nucleotide and translated amino acid sequence similarities among the eight type strains were 75.4-95.0 % and 88.5-99.2 %, respectively, whereas 16S rRNA gene sequence similarities were 98.1-99.8 %. Results showed that gyrB gene sequences provide higher resolution than 16S rRNA gene sequences. The classification achieved by gyrB sequence analysis was in agreement with results obtained with DNA-DNA hybridization. It is concluded that the gyrB gene may be an efficient alternative target for identification and taxonomic analysis of members of the B. subtilis group.
|
42. |
Singh JK,
Makde RD,
Kumar V,
Panda D,
( 2007 ) A membrane protein, EzrA, regulates assembly dynamics of FtsZ by interacting with the C-terminal tail of FtsZ. PMID : 17718511 : DOI : 10.1021/bi700710j Abstract >>
FtsZ polymerizes to form a dynamic ring structure called the Z-ring at the midcell of bacteria. EzrA, a membrane protein, has been shown to prevent the formation of aberrant Z-rings in the low GC Gram-positive bacteria by inhibiting FtsZ assembly. In this study, we show that Bacillus subtilis (B. subtilis) EzrA inhibited the assembly and bundling of B. subtilis FtsZ. It increased the critical concentration of FtsZ assembly and depolymerized the preformed FtsZ polymers in vitro. We obtained evidence suggesting that B. subtilis EzrA forms complex with B. subtilis FtsZ in vitro. EzrA was found to bind to FtsZ at a single site with a dissociation constant of 4.3 +/- 0.6 microM. EzrA-FtsZ interaction has a significant electrostatic contribution as apparent from the effect of salt on their binding interactions. To elucidate the site of interaction between EzrA and FtsZ, we deleted 16 amino acid residues from the extreme C-terminal tail of B. subtilis FtsZ, which are conserved in FtsZ orthologues. EzrA did not inhibit the assembly of C-terminal truncated B. subtilis FtsZ. It also did not bind to the C-terminal truncated FtsZ detectably, suggesting that EzrA interacts with FtsZ through its conserved C-terminal tail residues. Further, a 17-residue synthetic peptide (365-382) of the C-terminal tail of FtsZ (CTP17) was used to probe the interaction of EzrA with the C-terminal tail of FtsZ. CTP17 bound to EzrA, inhibited the binding of EzrA to FtsZ, and surmounted the inhibitory effects of EzrA on the assembly of FtsZ in vitro. The data together showed that EzrA binds to the C-terminal tail of FtsZ. FtsA, a positive regulator of FtsZ assembly, is also known to interact with the C-terminal tail of FtsZ. The results indicated an interesting possibility that the assembly dynamics of FtsZ in the Z-ring is regulated by the competition between positive and negative regulators sharing the same binding site on FtsZ.
|
43. |
Chung YJ,
Steen MT,
Hansen JN,
( 1992 ) The subtilin gene of Bacillus subtilis ATCC 6633 is encoded in an operon that contains a homolog of the hemolysin B transport protein. PMID : 1735728 : DOI : 10.1128/jb.174.4.1417-1422.1992 PMC : PMC206441 Abstract >>
Sequence analysis upstream from the subtilin structural gene (spaS) in Bacillus subtilis ATCC 6633 revealed several open reading frames, SpaB, SpaC, and SpaD. SpaB, consisting of 599 amino acid residues, shows excellent homology with a variety of membrane translocator proteins, such as HlyB from Escherichia coli and some mammalian multidrug resistance proteins. When the spaB gene was interrupted by integration of a chloramphenicol acetyltransferase gene, the ability of the cell to produce subtilin, as determined by a halo assay, was lost. The homology of SpaB to translocator proteins, including transmembrane and ATP-binding regions, suggests that SpaB may play a role in subtilin secretion. The SpaB open reading frame overlaps with another open reading frame called SpaC, and the possibility that the SpaB and SpaC proteins become fused by frameshifting is considered. Regions of homology between SpaD (177 residues) and HlyD were also found, suggesting that SpaD may participate with SpaB in translocation of subtilin through the membrane. Although no readily interpretable homologies to SpaC (442 residues) were found, its sequence suggests that it is membrane associated. The absence of rho-independent transcription terminators between these open reading frames suggests that they are all part of the same operon.
|
44. |
Aron ZD,
Fortin PD,
Calderone CT,
Walsh CT,
( 2007 ) FenF: servicing the Mycosubtilin synthetase assembly line in trans. PMID : 17330903 : DOI : 10.1002/cbic.200600575 Abstract >>
N/A
|
45. |
Harms K,
de Vries J,
Wackernagel W,
( 2007 ) A double kill gene cassette for the positive selection of transforming non-selective DNA segments in Acinetobacter baylyi BD413. PMID : 17250911 : DOI : 10.1016/j.mimet.2006.12.006 Abstract >>
Natural transformation has been widely used for the monitoring of DNA in biological and environmental samples. These assays depended on selectable traits on the tested DNA. We have now developed a transformation assay system in which recombinational removal of a cassette with two conditional kill genes (hok and sacB) from the recipient genome provides positive selection for non-selective DNA. The cassette was integrated into the Acinetobacter baylyi BD413 chromosome within trpE and was flanked by two segments of non-selective test DNA, which in this study were from a T-DNA construct previously used to generate a transgenic potato. Genes for tetracycline and spectinomycin/streptomycin resistance located at the sides of the cassette allowed to maintain selection pressure against spontaneous loss of the cassette. Plasmid DNA containing the T-DNA gave transformation frequencies ranging linearly from 10(-4) per recipient (at 1 mug DNA ml(-1)) down to 10(-7) (1 ng DNA ml(-1)) by selecting for survivors after activation of both kill functions. Transformation depended on the two flanking homologous segments for recombinational exchange. DNA of the transgenic potato also gave positive scores in spite of the about 10(5)-fold dilution of T-DNA by potato DNA. False positives having a spontaneous deletion of hok and sacB occurred at a frequency of 1.8x10(-9) per cell but could be distinguished by PCR from real transformants. Thus, the system is suitable for detection of transformation frequencies down to about 10(-9). Hok and sacB as well as the regulatory system used (LacI-lac operator and T5 promoter) are known to function in many organisms suggesting wide applicability of the cassette for positive selection.
|
46. |
Kapfer W,
Walter J,
Trautner TA,
( 1991 ) Cloning, characterization and evolution of the BsuFI restriction endonuclease gene of Bacillus subtilis and purification of the enzyme. PMID : 1721700 : DOI : 10.1093/nar/19.23.6457 PMC : PMC329197 Abstract >>
The restriction endonuclease (R.BsuFI) of Bacillus subtilis recognizes the target DNA sequence 5' CCGG. The R.BsuFI gene was found in close proximity to the cognate M.BsuFI gene, which had previously been characterized (1). Cloning of the R.BsuFI gene in E.coli was only possible with the M.BsuFI Mtase gene present on a compatible plasmid. The cloned R.BsuFI gene was expressed in E. coli and restriction activity was observed in vivo and in vitro. The R.BsuFI gene consists of 1185 bp, coding for a protein of 395 amino acids with a calculated molecular weight of 45.6 kD. The R.BsuFI enzyme was purified to homogeneity following overexpression. It presumably works as a dimer and cleaves the 5' CCGG target sequence between the two cytosines to produce sticky ends with 5' CG overhangs, like the isoschizomers R.MspI and R.HpaII. The relatedness between R.BsuFI and R.MspI is reflected by significant similarities of the amino acid sequences of both enzymes. This is the first case where such similarities have been observed between isoschizomeric restriction endonucleases which belong to 5mC specific R/M systems. This observation suggests that R.BsuFI and R.MspI genes derive from a common ancestor. In spite of such functional and evolutionary relatedness, the R/M systems differ in the arrangement of their R and M genes. In the BsuFI system transcription of the two genes is convergent, whereas divergent transcription occurs in the MspI system.
|
47. |
Xiang TH,
Wang LL,
Wang HZ,
( 2006 ) Sequence analysis of a novel insertion site of transposon IS10. PMID : 17112977 : DOI : 10.1016/S0379-4172(06)60141-8 Abstract >>
A sacB mutant was obtained by transposon IS10 inactivation of a plasmid pXT3sacB carrying the sacB gene. Sequencing of this mutant plasmid DNA (GenBank accession No. AY580883.1) showed that the IS10 flanking the 22 bp inverted repeats were 5'-CTGAGAGATCCCCTCATAATTT-3' and 5'-AAATCATTAGGGGATTCATCAG-3', which were the similar to those published in reports previously. However, the target sequence adjacent to IS10 was 5'-TGCTTGGTT-3' instead of the previously reported 5'-NGCTNAGCN-3'. To our knowledge, this is the first report on the novel insertion site of IS10. In addition, Southern blot hybridization confirmed that the mobile IS10 originated from the chromosomal DNA of the host strain Escherichia coli DH5alpha and that there were two copies in the DH5alpha genome.
|
48. |
Samel SA,
Wagner B,
Marahiel MA,
Essen LO,
( 2006 ) The thioesterase domain of the fengycin biosynthesis cluster: a structural base for the macrocyclization of a non-ribosomal lipopeptide. PMID : 16697411 : DOI : 10.1016/j.jmb.2006.03.062 Abstract >>
Many secondary metabolic peptides from bacteria and fungi are produced by non-ribosomal peptide synthetases (NRPS) where the final step of biosynthesis is often catalysed by designated thioesterase domains. Here, we report the 1.8A crystal structure of the fengycin thioesterase (FenTE) from Bacillus subtilis F29-3, which catalyses the regio- and stereoselective release and macrocyclization of the antibiotic fengycin from the NRPS template. A structure of the PMSF-inactivated FenTE domain suggests the location of the oxyanion hole and the binding site of the C-terminal residue l-Ile11 of the lipopeptide. Using a combination of docking, molecular dynamics simulations and in vitro activity assays, a model of the FenTE-fengycin complex was derived in which peptide cyclization requires strategic interactions with residues lining the active site canyon.
|
49. |
Rueckert A,
Ronimus RS,
Morgan HW,
( 2006 ) Development of a real-time PCR assay targeting the sporulation gene, spo0A, for the enumeration of thermophilic bacilli in milk powder. PMID : 16943008 : DOI : 10.1016/j.fm.2005.05.003 Abstract >>
Thermophilic bacilli, such as Anoxybacillus, Geobacillus and Bacillus, are common contaminants growing within the processing lines of milk powder producing factories. These contaminants are used as indicator organisms for plant hygiene and specification limits based on their numbers have been implemented to ensure milk powder quality. In this study, we present a SYBR Green-based real-time PCR assay for the rapid detection and enumeration of these thermophilic bacilli in milk powder using the spo0A sporulation gene as quantification target. With this method the detection of thermophilic bacilli in milk powder can be accomplished within 1 h. The detection limit for reconstituted and inoculated milk was 80 vegetative cfu ml(-1) and 640 spores ml(-1), respectively.
|
50. |
Wu S,
Zhong J,
Huan L,
( 2006 ) Genetics of subpeptin JM4-A and subpeptin JM4-B production by Bacillus subtilis JM4. PMID : 16647040 : DOI : 10.1016/j.bbrc.2006.04.022 Abstract >>
Subpeptin JM4-A and subpeptin JM4-B are two novel antimicrobial peptides produced by Bacillus subtilis JM4. To identify putative genes involved in their production, degenerate PCR primers targeted to conserved motifs of nonribosomal peptide synthetases (NRPSs) were used. A resulting 1.2 kb PCR product had high sequence similarity to genes of NRPSs, and then a 2.8 kb DNA fragment flanking it was cloned subsequently. Gene disruption of the resulting 4 kb DNA fragment produced subpeptin-deficient mutant, suggesting that subpeptin JM4-A and subpeptin JM4-B were biosynthesized by NRPSs. Based on this result, a 48 kb gene cluster was cloned, which consisted of nine coding sequences (CDSs) involved in antimicrobial peptide biosynthesis, regulation, and resistance. Disruption of two relatively large CDSs subA and subC led to subpeptin-deficient mutants, which supported the involvement of the cloned gene cluster in subpeptin biosynthesis.
|
51. |
Lu P,
Feng MG,
Li WF,
Hu CX,
( 2006 ) Construction and characterization of a bifunctional fusion enzyme of Bacillus-sourced beta-glucanase and xylanase expressed in Escherichia coli. PMID : 16907724 : DOI : 10.1111/j.1574-6968.2006.00367.x Abstract >>
A chimeric gene, Glu-Xyl, encoding Bacillus amyloliquefaciens glucanase (Glu, 24.4 kDa) and Bacillus subtilis xylanase (Xyl, 21.2 kDa), was constructed via end-to-end fusion and expressed successfully in Escherichia coli. The purified fusion protein (46.1 kDa) exhibited both glucanase and xylanase activities. Compared with parental enzymes, the Glu moiety was characterized by kinetic parameters of decreased K(m) (0.66-fold) and increased K(cat) (2.75-fold), whereas the Xyl moiety had an increased K(m) (1.37-fold) and decreased K(cat) (0.79-fold). These indicate a 3.15-fold net increase and a 31% decrease in catalytic efficiency (K(cat)/K(m)) of the Glu and Xyl moieties. Activities and stabilities of both moieties at 40-90 degrees C or pH 3.0-10.0 were compared with those of the parental enzymes. Despite some variations, common optima were 40 degrees C and pH 9.0 for the Glu moiety and parent, and 50-60 degrees C and pH 9.0 for the Xyl counterparts. Thus, the fusion enzyme Glu-Xyl was bifunctional, with greatly enhanced glucanase activity associated with a decrease in xylanase activity.
|
52. |
Titok M,
Suski C,
Dalmais B,
Ehrlich SD,
Jannière L,
( 2006 ) The replicative polymerases PolC and DnaE are required for theta replication of the Bacillus subtilis plasmid pBS72. PMID : 16622063 : DOI : 10.1099/mic.0.28693-0 Abstract >>
Plasmids are the tools of choice for studying bacterial functions involved in DNA maintenance. Here a genetic study on the replication of a novel, low-copy-number, Bacillus subtilis plasmid, pBS72, is reported. The results show that two plasmid elements, the initiator protein RepA and an iteron-containing origin, and at least nine host-encoded replication proteins, the primosomal proteins DnaB, DnaC, DnaD, DnaG and DnaI, the DNA polymerases DnaE and PolC, and the polymerase cofactors DnaN and DnaX, are required for pBS72 replication. On the contrary, the cellular initiators DnaA and PriA, the helicase PcrA and DNA polymerase I are dispensable. From this, it is inferred that pBS72 replication is of the theta type and is initiated by an original mechanism. Indirect evidence suggests that during this process the DnaC helicase might be delivered to the plasmid origin by the weakly active DnaD pathway stimulated by a predicted interaction between DnaC and a domain of RepA homologous to the major DnaC-binding domain of the cellular initiator DnaA. The plasmid pBS72 replication fork appears to require the same functions as the bacterial chromosome and the unrelated plasmid pAMbeta1. Most importantly, this replication machinery contains the two type C polymerases, PolC and DnaE. As the mechanism of initiation of the three genomes is substantially different, this suggests that both type C polymerases might be required in any Cairns replication in B. subtilis and presumably in other bacteria encoding PolC and DnaE.
|
53. |
Maqbool QU,
Johri S,
Rasool S,
Riyaz-ul-Hassan S,
Verma V,
Nargotra A,
Koul S,
Qazi GN,
( 2006 ) Molecular cloning of carboxylesterase gene and biochemical characterization of encoded protein from Bacillus subtilis (RRL BB1). PMID : 16621096 : DOI : 10.1016/j.jbiotec.2006.02.018 Abstract >>
An isolated strain of Bacillus subtilis identified by 16S rDNA sequence analysis produces an enantioselective ester hydrolase. Whole cells of B. subtilis (RRL BB1) and enzyme derived from it was capable of enantioselective hydrolysis of several racemates including drug intermediates with moderate to high enantioselectivity as already reported by us. In this communication, we describe cloning of the gene encoding the enantioselective esterase designated as estBB1. The primary structure of the enzyme determined from the nucleotide sequence indicated that esterase estBB1 has Mw approximately 52kDa and pI approximately 5.2 and belongs to the family of type B carboxylesterases with 50-60% similarity at amino acid level. Alignment studies of sequences of the estBB1 and Pnb esterase 56C8 from B. subtilis showed that estBB1 has an alpha/beta hydrolase fold with catalytic triad formed by Ser190, Glu305 and His394 at active site and Ser190 is located in the conserved motif -G-X-S-X-G-.
|
54. |
Stankovic S,
Soldo B,
Beric-Bjedov T,
Knezevic-Vukcevic J,
Simic D,
Lazarevic V,
( 2007 ) Subspecies-specific distribution of intervening sequences in the Bacillus subtilis prophage ribonucleotide reductase genes. PMID : 16621400 : DOI : 10.1016/j.syapm.2006.02.007 Abstract >>
A collection of 212 gram-positive bacilli isolated from natural habitats was screened for the presence of intervening sequences (introns and intein-coding sequences) in the SPbeta prophage-related ribonucleotide reductase genes bnrdE and bnrdF. Three novel configurations were identified on the basis of the presence of (i) intervening sequences in bnrdE and bnrdF, and (ii) an ORF in the bnrdE-bnrdF spacer. Analysis of the cell wall genetic determinants as well as of the incorporation of radio-labelled glycerol into cell wall allowed newly and previously identified B. subtilis strains with different configurations of bnrdE/bnrdF intervening sequences to be assigned to one of two subspecies. Strains apparently belonging to the subsp. subtilis contain three intervening sequences many of which are associated with the putative homing endonuclease activity. Strains of the subsp. spizizenii contain only one or two ORF-less group I introns. Introns occupying bnrdF are confined to the subspecies subtilis.
|
55. |
Sugiura W,
Yoda T,
Matsuba T,
Tanaka Y,
Suzuki Y,
( 2006 ) Expression and characterization of the genes encoding azoreductases from Bacillus subtilis and Geobacillus stearothermophilus. PMID : 16861800 : DOI : 10.1271/bbb.60014 Abstract >>
Azoreductases have been characterized as enzymes that can decolorize azo dyes by reducing azo groups. In this study, genes encoding proteins having homology with the azoreductase gene of Bacillus sp. OY1-2 were obtained from Bacillus subtilis ATCC6633, B. subtilis ISW1214, and Geobacillus stearotherophilus IFO13737 by polymerase chain reaction. All three genes encoded proteins with 174 amino acids. The deduced amino acid sequences of azoreductase homologs from B. subtilis ISW1214, B. subtilis ATCC6633, and G. stearotherophilus IFO13737 showed similarity of 53.3, 53.9, and 53.3% respectively to that of Bacillus sp. OY1-2. All three genes were expressed in Escherichia coli, and were characterized as having the decolorizing activity of azo dyes in a beta-NADPH dependent manner. The transformation of several azo dyes into colorless compounds by recombinant enzymes was demonstrated to have distinct substrate specificity from that of azoreductase from Bacillus sp. OY1-2.
|
56. |
Sakaya N,
Kaneko S,
Matsunaga S,
Itaya M,
( 2006 ) Experimental basis for a stable plasmid, pLS30, to shuttle between Bacillus subtilis species by conjugational transfer. PMID : 16567421 : DOI : 10.1093/jb/mvj058 Abstract >>
The use of Bacillus subtilis 168 as the initial host for molecular cloning and subsequent delivery of the engineered DNA to other Bacillus hosts appears attractive, and would lead to an efficient DNA manipulation system. However, methods of delivery to other Bacillus species are limited due to their inability to develop natural competence. An alternative, unexplored conjugational transfer method drew our attention and a B. subtilis native plasmid, pLS30, isolated from B. subtilis (natto) strain IAM1168 was characterized for this aim. The nucleotide sequence (6,610 bp) contained the mob gene and its recognition sequence, oriT, that features pLS30 as a mobile plasmid between Bacillus species on conjugational transfer. Plasmid pLS3001, a chimera with a pBR322-based plasmid prepared in Escherichia coli to confer an antibiotic resistance marker, showed apparent mobilizing activity in the pLS20-mediated conjugational transfer system recently established. The rep gene and associated palT1-like sequence common to all other pLS plasmids previously sequenced indicated that pLS30 is a typical rolling circle replicating (RCR) type plasmid. Due to the significant stability of pLS30 in IAM1168, application of a mobile plasmid would allow quick propagation to Bacillus species.
|
57. |
Hou X,
Boyetchko SM,
Brkic M,
Olson D,
Ross A,
Hegedus D,
( 2006 ) Characterization of the anti-fungal activity of a Bacillus spp. associated with sclerotia from Sclerotinia sclerotiorum. PMID : 16496141 : DOI : 10.1007/s00253-006-0315-8 Abstract >>
Sclerotinia sclerotiorum fruiting bodies (sclerotia) were found to harbour bacteria that possess anti-fungal activity. Among 1,140 bacterial isolates collected, 32 were found to inhibit the growth of four common fungal pathogens of canola, S. sclerotiorum, Rhizoctonia solani, Alternaria brassicae and Leptosphaeria maculans. One of these broad-spectrum isolates, LEV-006, was found to be closely related to Bacillus subtilis based on 16S rRNA analysis. The anti-fungal activities were purified and found to be associated with a low molecular weight peptide complex consisting mostly of the cyclic lipopeptide fengycin A and B, as revealed by matrix-assisted laser desorption/ionization time-of-flight and post-source decay analysis, as well as two proteins of 20 and 55 kDa. Peptide mass fingerprinting revealed that the 55-kDa protein was similar to vegetative catalase 1; however, when the enzyme was expressed in Escherichia coli, it exhibited catalase but not anti-fungal activity. The sequences of several peptides from the 20-kDa protein were obtained and indicated that it was a unique anti-fungal protein.
|
58. |
Carr JF,
Hamburg DM,
Gregory ST,
Limbach PA,
Dahlberg AE,
( 2006 ) Effects of streptomycin resistance mutations on posttranslational modification of ribosomal protein S12. PMID : 16484214 : DOI : 10.1128/JB.188.5.2020-2023.2006 PMC : PMC1426572 Abstract >>
Ribosomal protein S12 contains a highly conserved aspartic acid residue that is posttranslationally beta-methylthiolated. Using mass spectrometry, we have determined the modification states of several S12 mutants of Thermus thermophilus and conclude that beta-methylthiolation is not a determinant of the streptomycin phenotype.
|
59. |
Rooney AP,
Swezey JL,
Wicklow DT,
McAtee MJ,
( 2005 ) Bacterial species diversity in cigarettes linked to an investigation of severe pneumonitis in U.S. Military personnel deployed in operation iraqi freedom. PMID : 15942700 : DOI : 10.1007/s00284-005-4491-z Abstract >>
This report presents results from a study on the bacterial diversity of cigarette brands collected from military personnel during the U.S. Army's investigation of a series of cases of acute eosinophilic pneumonitis in military personnel deployed in Operation Iraqi Freedom. Eight species of Bacillus, including five new species, and one new species of Kurthia were isolated from the cigarettes. Some of these species have been identified elsewhere as causes of hypersensitivity pneumonitis and other respiratory syndromes. All of the isolates were facultative anaerobes, and many displayed mucoid growth under anaerobic conditions. In addition, many isolates also displayed the ability to form surface biofilms under liquid culture. Although biofilm formation and mucoid growth were not correlated, the former was found to be much more pronounced under anaerobic conditions as opposed to aerobic ones. The implications of these findings are discussed.
|
60. |
Rathinaswamy P,
Pundle AV,
Prabhune AA,
Sivaraman H,
Brannigan JA,
Dodson GG,
Suresh CG,
( 2005 ) Cloning, purification, crystallization and preliminary structural studies of penicillin V acylase from Bacillus subtilis. PMID : 16511127 : DOI : 10.1107/S1744309105017987 PMC : PMC1952454 Abstract >>
Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their beta-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris-HCl buffer pH 8.2. Diffraction data were collected under cryogenic conditions to a spacing of 2.5 A. The crystals belonged to the orthorhombic space group C222(1), with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 A. The estimated Matthews coefficient was 3.23 A3 Da(-1), corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.
|
61. |
Aron ZD,
Dorrestein PC,
Blackhall JR,
Kelleher NL,
Walsh CT,
( 2005 ) Characterization of a new tailoring domain in polyketide biogenesis: the amine transferase domain of MycA in the mycosubtilin gene cluster. PMID : 16248612 : DOI : 10.1021/ja055247g Abstract >>
We report the expression and characterization of a truncated form of MycA from the Mycosubtilin gene cluster from Bacillus subtilis. The MycA fragment contains a new amino transferase (AMT) tailoring domain, allowing the first detailed study of a PLP-dependent enzyme operating in cis within the PKS and NRPS biosynthetic paradigm. As the AMT domain acts on covalently bound beta-ketothioesters, and is therefore a single-turnover system, electrospray ionization-Fourier transform mass spectrometry (ESI-FTMS) was used to observe the amine-transfer reaction both for amine donor substrate specificity and to regiospecifically determine enzyme-bound intermediates. We confirm the function of the AMT domain, dissect the mechanistic steps of amine transfer, identify the preferred amine source, and localize the beta-ketothioester substrate during amine transfer.
|
62. |
Ni J,
Tokuyama S,
Sogabe A,
Kawamura Y,
Tahara Y,
( 2001 ) Cloning and high expression of catalase gene from bacillus sp. TE124. PMID : 16233016 : Abstract >>
An efficient expression system for producing catalase in Bacillus was developed. A catalase was purified from Bacillus sp. TE124 and the catalase gene was cloned by plaque hybridization with a probe constructed from the N-terminal amino acid sequence of the enzyme. The gene, containing an open reading frame of 1452 bp, was subcloned into pHY300PLK for self-cloning into the organism. As a result, the production of catalase increased 20-fold over that of the parent strain.
|
63. |
Wu S,
Jia S,
Sun D,
Chen M,
Chen X,
Zhong J,
Huan L,
( 2005 ) Purification and characterization of two novel antimicrobial peptides Subpeptin JM4-A and Subpeptin JM4-B produced by Bacillus subtilis JM4. PMID : 16211432 : DOI : 10.1007/s00284-005-0004-3 Abstract >>
An antimicrobial peptides-producing strain was isolated from soil and identified as Bacillus subtilis JM4 according to biochemical tests and 16S rDNA sequence analysis. The corresponding antimicrobial peptides were purified to homogeneity by ammonium sulfate precipitation, sequential SP-Sepharose Fast Flow, Sephadex G-25 and C18 reverse-phase chromatography, and in the final purification step, two active fractions were harvested, designated as Subpeptin JM4-A and Subpeptin JM4-B. The molecular weights, determined by mass spectrometry, were 1422.71 Da for Subpeptin JM4-A and 1422.65 Da for Subpeptin JM4-B, respectively. Amino acid sequencing showed that they differed from each other only at the seventh amino acid except for three unidentified residues, and the two peptides had no significant sequence homology to the known peptides in the database, indicating that they are two novel antimicrobial peptides. In addition, characteristic measurements indicated that both peptides had a relatively broad inhibitory spectrum and remained active over a wide pH and temperature range.
|
64. |
Reizer J,
Sutrina SL,
Wu LF,
Deutscher J,
Reddy P,
Saier MH,
( 1992 ) Functional interactions between proteins of the phosphoenolpyruvate:sugar phosphotransferase systems of Bacillus subtilis and Escherichia coli. PMID : 1577753 : Abstract >>
Proteins of the phosphoenolpyruvate:sugar phosphotransferase system (PTS) of Bacillus subtilis were overexpressed, purified to near homogeneity, and characterized. The proteins isolated include Enzyme I, HPr, the glucose-specific IIA domain of the glucose-specific Enzyme II (IIAglc), and the mannitol-specific IIA protein, IIAmtl. Site specific mutant proteins of IIAglc and HPr were also overexpressed and purified, and their properties were compared with those of the wild type proteins. These proteins and their phosphorylated derivatives were characterized with respect to their immunological cross-reactivities employing the Western blot technique and in terms of their migratory behavior during sodium dodecyl sulfate-gel electrophoresis, nondenaturing gel electrophoresis, and isoelectric focusing. The interactions between homologous and heterologous Enzymes I and HPrs, between homologous and heterologous HPrs and the IIAglc proteins, and between homologous and heterologous IIAglc proteins and IIBCscr of B. subtilis as well as IICBglc of Escherichia coli were defined and compared kinetically. The mutant HPrs and IIAglc proteins were also characterized kinetically as PTS phosphocarrier proteins and/or as inhibitors of the phosphotransferase reactions of the PTS. These studies revealed that complexation of IIAglc with the mutant form of HPr in which serine 46 was replaced by aspartate (S46D) did not increase the rate of phosphoryl transfer from phospho Enzyme I to S46D HPr more than when IIAmtl was complexed to S46D HPr. These findings do not support a role for HPr(Ser-P) in the preferential utilization of one PTS carbohydrate relative to another. Functional analyses in E. coli established that IIAglc of B. subtilis can replace IIAglc of E. coli with respect both to sugar transport and to regulation of non-PTS permeases, catabolic enzymes, and adenylate cyclase. Site-specific mutations in histidyl residues 68 and 83 (H68A and H83A) inactivated IIAglc of B. subtilis with respect to phosphoryl transfer and its various regulatory roles.
|
65. |
Kearns DB,
Chu F,
Branda SS,
Kolter R,
Losick R,
( 2005 ) A master regulator for biofilm formation by Bacillus subtilis. PMID : 15661000 : DOI : 10.1111/j.1365-2958.2004.04440.x Abstract >>
Wild strains of Bacillus subtilis are capable of forming architecturally complex communities of cells known as biofilms. Critical to biofilm formation is the eps operon, which is believed to be responsible for the biosynthesis of an exopolysaccharide that binds chains of cells together in bundles. We report that transcription of eps is under the negative regulation of SinR, a repressor that was found to bind to multiple sites in the regulatory region of the operon. Mutations in sinR bypassed the requirement in biofilm formation of two genes of unknown function, ylbF and ymcA, and sinI, which is known to encode an antagonist of SinR. We propose that these genes are members of a pathway that is responsible for counteracting SinR-mediated repression. We further propose that SinR is a master regulator that governs the transition between a planktonic state in which the bacteria swim as single cells in liquid or swarm in small groups over surfaces, and a sessile state in which the bacteria adhere to each other to form bundled chains and assemble into multicellular communities.
|
66. |
Borchert S,
Patil SS,
M?rahiel MA,
( 1992 ) Identification of putative multifunctional peptide synthetase genes using highly conserved oligonucleotide sequences derived from known synthetases. PMID : 1601288 : DOI : 10.1016/0378-1097(92)90508-l Abstract >>
Many peptide antibiotics in prokaryotes and lower eukaryotes are produced non-ribosomally by multi-enzyme complexes. Analysis of gene-derived amino acid sequences of some peptide synthetases of bacterial and fungal origins revealed a high degree of conservation (35-50% identity). The genes encoding those peptide synthetases are clustered into large operons with repetitive domains (about 600 amino acids), in the case of synthetases activating more than one amino acid. We used two 35-mer oligonucleotides derived from two highly conserved regions of known peptide synthetases to identify the surfactin synthetase operon in Bacillus subtilis ATCC 21332, a strain not accessible to genetic manipulation. We show that the derived oligonucleotides can be used not only for the identification of unknown peptide synthetase genes by hybridization experiments but also in sequencing reactions as primers to identify internal domain sequences. Using this method, a 25.8-kb chromosomal DNA fragment bearing a part of the surfactin biosynthesis operon was cloned and partial sequences of two internal domains were obtained.
|
67. |
Ogasawara N,
Yoshikawa H,
( 1992 ) Genes and their organization in the replication origin region of the bacterial chromosome. PMID : 1552862 : DOI : 10.1111/j.1365-2958.1992.tb01510.x Abstract >>
Genes and their organization are conserved in the replication origin region of the bacterial chromosome. To determine the extent of the conserved region in Gram-positive and Gram-negative bacteria, which diverged 1.2 billion years ago, we have further sequenced the region upstream from the dnaA genes in Bacillus subtilis and Pseudomonas putida. Fifteen open reading frames (ORFs) and 11 ORFs were identified in the 13.6 kb and the 9.8 kb fragments in B. subtilis and P. putida, respectively. Eight consecutive P. putida genes, except for one small ORF (homologous to gene 9K of Escherichia coli) in between, are homologous in sequence and relative locations to genes in B. subtilis. Altogether, 12 genes and their organization are conserved in B. subtilis and P. putida in the origin region. We found that the conserved region terminated on one side after the orf290 in P. putida (orf282 in B. subtilis). In the B. subtilis chromosome, five additional ORFs were found in between the conserved genes, suggesting that they are added after Gram-positive bacteria were diverged from the Gram-negative bacteria. One of the ORFs is a duplicate of the conserved gene. The third non-translatable region containing multiple repeats of DnaA-box (second in the case of P. putida) was found flanking gidA in both organisms. This result shows clearly that E. coli oriC and flanking genes gidA and gidB have been translocated by the inversion of some 40 kb fragment.
|
68. |
Steinborn G,
Hajirezaei MR,
Hofemeister J,
( 2005 ) bac genes for recombinant bacilysin and anticapsin production in Bacillus host strains. PMID : 15609023 : DOI : 10.1007/s00203-004-0743-8 Abstract >>
The genes encoding the biosynthesis of the dipeptide bacilysin and its antibiotic constituent anticapsin were isolated from several strains of Bacillus subtilis as well as B. amyloliquefaciens and B. pumilus. The ywfBCDEF genes of B. subtilis 168 were shown to carry the biosynthetic core functions and were renamed bacABCDE. Mutation of the bacD gene or transformation of the bacABC genes into a B. subtilis Delta (ywfA-bacABCDE) deletion mutant led to the accumulation of anticapsin, which was fourfold higher after transformation of the bacABC genes into a bacD mutant. The genes bacD and bacE proved to encode the functions of amino acid ligation and self-protection to bacilysin, respectively. Amplification of the bacABCDE gene cluster in a bacAB gene-deficient host strain of B. amyloliquefaciens resulted in a tenfold bacilysin overproduction. Some host strains required distinct glucosamine and yeast extract supplements in order to prevent suicidal effects of the recombinant antibiotic production. The bac genes from different Bacillus species revealed the same arrangement and 72.6-88.6% of sequence identity.
|
69. |
Whiteaker JR,
Warscheid B,
Pribil P,
Hathout Y,
Fenselau C,
( 2004 ) Complete sequences of small acid-soluble proteins from Bacillus globigii. PMID : 15468161 : DOI : 10.1002/jms.668 Abstract >>
Three abundant small acid-soluble proteins (SASPs) from spores of Bacillus globigii were sequenced using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with post-source decay and nanoelectrospray collision-induced dissociation tandem mass spectrometry. The proteins were extracted from spores with 1 M HCl. Scanning electron micrographs of spores before and after acid extraction show that the spores retain their overall structure but have a shriveled texture following the acid treatment. Extracted SASPs were purified by high-performance liquid chromatography and molecular masses of the SASPs were identified at 7068 (SASP-1), 7332 (SASP-2), and 8889 (gamma-SASP). De novo peptide sequencing was used to determine the protein sequences. The correct ordering of peptide sequences was aided by mapping overlapping enzymatic digests and by comparison with homologous SASPs from Bacillus stearothermophilus. B. globigii is used in many field tests as a surrogate for B. anthracis. Thus complete SASP sequences from B. globigii will facilitate the development of methods for rapid identification of bacteria based on mass spectrometry and the examination of taxonomic relationships between Bacillus species.
|
70. |
Chan WC,
Bycroft BW,
Leyland ML,
Lian LY,
Yang JC,
Roberts GC,
( 1992 ) Sequence-specific resonance assignment and conformational analysis of subtilin by 2D NMR. PMID : 1547888 : DOI : 10.1016/0014-5793(92)80163-b Abstract >>
Subtilin, a 32-amino acid peptide with potent antimicrobial activity, has been isolated from Bacillus subtilis ATCC6633. The chemical structure has been confirmed by the unambiguous sequence-specific assignment of its 1H NMR spectrum. Detailed NMR analysis revealed that subtilin is a rather flexible molecule; the only observed conformational contraints were those imposed by the cyclic structures created by the lanthionine and 3-methyllanthionine residues. These results suggest that in aqueous solution subtilin and the homologous peptide nisin have similar conformations.
|
71. |
Klein C,
Kaletta C,
Schnell N,
Entian KD,
( 1992 ) Analysis of genes involved in biosynthesis of the lantibiotic subtilin. PMID : 1539969 : PMC : PMC195183 Abstract >>
Lantibiotics are peptide-derived antibiotics with high antimicrobial activity against pathogenic gram-positive bacteria. They are ribosomally synthesized and posttranslationally modified (N. Schnell, K.-D. Entian, U. Schneider, F. G?tz, H. Z?hner, R. Kellner, and G. Jung, Nature [London] 333:276-278, 1988). The most important lantibiotics are subtilin and the food preservative nisin, which both have a very similar structure. By using a hybridization probe specific for the structural gene of subtilin, spaS, the DNA region adjacent to spaS was isolated from Bacillus subtilis. Sequence analysis of a 4.9-kb fragment revealed several open reading frames with the same orientation as spaS. Downstream of spaS, no reading frames were present on the isolated XbaI fragment. Upstream of spaS, three reading frames, spaB, spaC, and spaT, were identified which showed strong homology to genes identified near the structural gene of the lantibiotic epidermin. The SpaT protein derived from the spaT sequence was homologous to hemolysin B of Escherichia coli, which indicated its possible function in subtilin transport. Gene deletions within spaB and spaC revealed subtilin-negative mutants, whereas spaT gene disruption mutants still produced subtilin. Remarkably, the spaT mutant colonies revealed a clumpy surface morphology on solid media. After growth on liquid media, spaT mutant cells agglutinated in the mid-logarithmic growth phase, forming longitudinal 3- to 10-fold-enlarged cells which aggregated. Aggregate formation preceded subtilin production and cells lost their viability, possibly as a result of intracellular subtilin accumulation. Our results clearly proved that reading frames spaB and spaC are essential for subtilin biosynthesis whereas spaT mutants are probably deficient in subtilin transport.
|
72. |
Hofemeister J,
Conrad B,
Adler B,
Hofemeister B,
Feesche J,
Kucheryava N,
Steinborn G,
Franke P,
Grammel N,
Zwintscher A,
Leenders F,
Hitzeroth G,
Vater J,
( 2004 ) Genetic analysis of the biosynthesis of non-ribosomal peptide- and polyketide-like antibiotics, iron uptake and biofilm formation by Bacillus subtilis A1/3. PMID : 15480790 : DOI : 10.1007/s00438-004-1056-y Abstract >>
The Bacillus subtilis strain A1/3 shows exceptionally diverse antibiotic capacities compared to other B. subtilis strains. To analyze this phenomenon, mutants for the putative pantotheinyltransferase gene (pptS), and for several genes involved in non-ribosomal peptide synthesis and polyketide synthesis were constructed and characterized, using bioassays with blood cells, bacterial and fungal cells, and mass spectrometry. Among at least nine distinct bioactive compounds, five antibiotics and one siderophore activity were identified. The anti-fungal and hemolytic activities of strain A1/3 could be eliminated by mutation of the fen and srf genes essential for the synthesis of fengycins and surfactins. Both pptS- and dhb -type mutants were defective in iron uptake, indicating an inability to produce a 2,3-dihydroxybenzoate-type iron siderophore. Transposon mutants in the malonyl CoA transacylase gene resulted in the loss of hemolytic and anti-fungal activities due to the inhibition of bacillomycin L synthesis, and this led to the discovery of bmyLD-LA-LB* genes. In mutants bearing disruption mutations in polyketide (pksM- and/or pksR -like) genes, the biosynthesis of bacillaene and difficidins, respectively, was inactivated and was accompanied by the loss of discrete antibacterial activities. The formation of biofilms (pellicles) was shown to require the production of surfactins, but no other lipopeptides, indicating that surfactins serve specific developmental functions.
|
73. |
Lagodich AV,
Shtaniuk IuV,
Prozorov AA,
Titok MA,
( N/A ) [The replication system of plasmids from Bacillus subtilis environmental isolates]. PMID : 15285612 : Abstract >>
Restriction enzyme analysis, cloning, and sequencing showed that large (more than 90-kb) plasmids isolated from different Bacillus subtilis strains are identical in structure of the region ensuring stable inheritance of plasmid replicons and are widespread in Belarussian environmental strains of B. subtilis.
|
74. |
Moyne AL,
Cleveland TE,
Tuzun S,
( 2004 ) Molecular characterization and analysis of the operon encoding the antifungal lipopeptide bacillomycin D. PMID : 15109718 : DOI : 10.1016/j.femsle.2004.03.011 Abstract >>
Bacillus subtilis AU195 produces bacillomycin D, a cyclic lipopeptide that is an inhibitor of the aflatoxin producing fungus Aspergillus flavus. Sequence analysis of the bacillomycin D operon revealed four ORFs with the structural organization of the peptide synthetases. Disruption of ORF 2, which links the amino acid moiety to the b-amino fatty acid, resulted in the loss of antifungal activity. By comparing the sequence of bacillomycin D, iturin A and mycosubtilin operons, our results showed that intergenic module replacement have occurred between B. subtilis lipopeptide synthetases including the iturin family and the plipastatin and fengycin family.
|
75. |
Laupitz R,
Hecht S,
Amslinger S,
Zepeck F,
Kaiser J,
Richter G,
Schramek N,
Steinbacher S,
Huber R,
Arigoni D,
Bacher A,
Eisenreich W,
Rohdich F,
( 2004 ) Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways. PMID : 15206931 : DOI : 10.1111/j.1432-1033.2004.04194.x Abstract >>
An open reading frame (Acc. no. P50740) on the Bacillus subtilis chromosome extending from bp 184,997-186,043 with similarity to the idi-2 gene of Streptomyces sp. CL190 specifying type II isopentenyl diphosphate isomerase was expressed in a recombinant Escherichia coli strain. The recombinant protein with a subunit mass of 39 kDa was purified to apparent homogeneity by column chromatography. The protein was shown to catalyse the conversion of dimethylallyl diphosphate into isopentenyl diphosphate and vice versa at rates of 0.23 and 0.63 micromol.mg(-1).min(-1), respectively, as diagnosed by 1H spectroscopy. FMN and divalent cations are required for catalytic activity; the highest rates were found with Ca2+. NADPH is required under aerobic but not under anaerobic assay conditions. The enzyme is related to a widespread family of (S)-alpha-hydroxyacid oxidizing enzymes including flavocytochrome b2 and L-lactate dehydrogenase and was shown to catalyse the formation of [2,3-13C2]lactate from [2,3-13C2]pyruvate, albeit at a low rate of 1 nmol.mg(-1).min(-1). Putative genes specifying type II isopentenyl diphosphate isomerases were found in the genomes of Archaea and of certain eubacteria but not in the genomes of fungi, animals and plants. The analysis of the occurrence of idi-1 and idi-2 genes in conjunction with the mevalonate and nonmevalonate pathway in 283 completed and unfinished prokaryotic genomes revealed 10 different classes. Type II isomerase is essential in some important human pathogens including Staphylococcus aureus and Enterococcus faecalis where it may represent a novel target for anti-infective therapy.
|
76. |
Kirimura K,
Harada K,
Iwasawa H,
Tanaka T,
Iwasaki Y,
Furuya T,
Ishii Y,
Kino K,
( 2004 ) Identification and functional analysis of the genes encoding dibenzothiophene-desulfurizing enzymes from thermophilic bacteria. PMID : 15221222 : DOI : 10.1007/s00253-004-1652-0 Abstract >>
Thermophilic bacteria Bacillus subtilis WU-S2B and Mycobacterium phlei WU-F1 desulfurize dibenzothiophene (DBT) and alkylated DBTs through specific cleavage of the carbon-sulfur bonds over a temperature range up to 52 degrees C. In order to identify and functionally analyze the DBT-desulfurization genes, the gene cluster containing bdsA, bdsB, and bdsC was cloned from B. subtilis WU-S2B. The nucleotide and amino acid sequences of bdsABC show homologies to those of the other known DBT-desulfurization genes and enzymes; e.g. a nucleotide sequence homology of 61.0% to dszABC of the mesophilic bacterium Rhodococcus sp. IGTS8 and 57.8% to tdsABC of the thermophilic bacterium Paenibacillus sp. A11-2. Deletion and subcloning analysis of bdsABC revealed that the gene products of bdsC, bdsA and bdsB oxidized DBT to DBT sulfone (DBTO(2)), converted DBTO(2) to 2'-hydroxybiphenyl-2-sulfinate (HBPSi), and desulfurized HBPSi to 2-hydroxybiphenyl (2-HBP), respectively. Resting cells of a recombinant Escherichia coli JM109 harboring bdsABC converted DBT to 2-HBP over a temperature range of 30-52 degrees C, indicating that the gene products of bdsABC were functional in the recombinant. The activities of DBT degradation at 50 degrees C and DBT desulfurization (2-HBP production) at 40 degrees C in resting cells of the recombinant were approximately five times and twice, respectively, as high as those in B. subtilis WU-S2B. The recombinant E. coli cells also degraded alkylated DBTs, such as 2,8-dimethylDBT and 4,6-dimethylDBT. The nucleotide sequences of B. subtilis WU-S2B bdsABC and the corresponding genes from M. phlei WU-F1 were found to be completely identical to each other although the strains are genetically different.
|
77. |
Sasaki M,
Kawamura F,
Kurusu Y,
( 2004 ) Genetic analysis of an incomplete bio operon in a biotin auxotrophic strain of Bacillus subtilis natto OK2. PMID : 15056910 : DOI : 10.1271/bbb.68.739 Abstract >>
We describe the genetic analysis of the bio operon of the biotin auxotrophic Bacillus subtilis natto OK2 strain. The OK2 strain would only cross-feed with the Escherichia coli bioB mutant and also grew well in medium containing dethiobiotin. Sequencing analysis revealed two significant genetic alterations in the bioW and bioF genes within the bio operon of the OK2 strain. Complementation analysis with B. subtilis 168 bio mutants demonstrated that only the bioB gene could complement, but other bio operon genes could not. A bio(+) transformant, isolated from an OK2 strain, has biotin autotrophy.
|
78. |
Xu GL,
Kapfer W,
Walter J,
Trautner TA,
( 1992 ) BsuBI--an isospecific restriction and modification system of PstI: characterization of the BsuBI genes and enzymes. PMID : 1480472 : DOI : 10.1093/nar/20.24.6517 PMC : PMC334566 Abstract >>
The enzymes of the Bacillus subtilis BsuBI restriction/modification (R/M) system recognize the target sequence 5'CTGCAG. The genes of the BsuBI R/M system have been cloned and sequenced and their products have been characterized following overexpression and purification. The gene of the BsuBI DNA methyltransferase (M.BsuBI) consists of 1503 bp, encoding a protein of 501 amino acids with a calculated M(r) of 57.2 kD. The gene of the restriction endonuclease (R.BsuBI), comprising 948 bp, codes for a protein of 316 amino acids with a predicted M(r) of 36.2 kD. M.BsuBI modifies the adenine (A) residue of the BsuBI target site, thus representing the first A-N6-DNA methyltransferase identified in B. subtilis. Like R.PstI, R.BsuBI cleaves between the A residue and the 3' terminal G of the target site. Both enzymes of the BsuBI R/M system are, therefore, functionally identical with those of the PstI R/M system, encoded by the Gram negative species Providencia stuartii. This functional equivalence coincides with a pronounced similarity of the BsuBI/PstI DNA methyltransferases (41% amino acid identity) and restriction endonucleases (46% amino acid identity). Since the genes are also very similar (58% nucleotide identity), the BsuBI and PstI R/M systems apparently have a common evolutionary origin. In spite of the sequence conservation the gene organization is strikingly different in the two R/M systems. While the genes of the PstI R/M system are separated and transcribed divergently, the genes of the BsuBI R/M system are transcribed in the same direction, with the 3' end of the M gene overlapping the 5' end of the R gene by 17 bp.
|
79. |
Ansaldi M,
Dubnau D,
( 2004 ) Diversifying selection at the Bacillus quorum-sensing locus and determinants of modification specificity during synthesis of the ComX pheromone. PMID : 14679219 : DOI : 10.1128/jb.186.1.15-21.2004 PMC : PMC303460 Abstract >>
The competence quorum-sensing system of Bacillus subtilis consists of two-component regulatory proteins, ComP (histidine kinase) and the response regulator, ComA, an extracellular pheromone (ComX), and a protein that is needed for the proteolytic cleavage and modification of pre-ComX (ComQ). ComQ and pre-ComX are both necessary and sufficient for the production of active pheromone, which is released as an isoprenylated peptide. Laboratory strain 168 and a number of natural isolates of bacilli differ in the primary sequences of their pheromones as well as in the masses of their isoprenyl adducts. We have shown that ComX, ComQ, and the membrane-localized sensor domain of ComP are highly polymorphic in natural isolates of bacilli all closely related to the laboratory strain of B. subtilis. In this study, we used two statistical tests (the ratio of synonymous and nonsynonymous substitution rates and the Tajima D test) to demonstrate that these polymorphic sequences evolved by diversifying selection rather than by neutral drift. We show that the choice of isoprenyl derivative is determined by the C-terminal (mature) sequence of pre-ComX rather than by the ComQ protein. The implications of these findings for the evolution of the quorum-sensing system and for the protein-protein interactions involved in determining specificity are discussed.
|
80. |
Furuya T,
Takahashi S,
Ishii Y,
Kino K,
Kirimura K,
( 2004 ) Cloning of a gene encoding flavin reductase coupling with dibenzothiophene monooxygenase through coexpression screening using indigo production as selective indication. PMID : 14697229 : DOI : 10.1016/j.bbrc.2003.11.157 Abstract >>
The thermophilic dibenzothiophene (DBT)-desulfurizing bacterium, Bacillus subtilis WU-S2B, possesses the ability to convert DBT to 2-hydroxybiphenyl with the release of inorganic sulfur over a wide temperature range up to 50 degrees C. The conversion is initiated by consecutive sulfur atom-specific oxidations by two monooxygenases, and flavin reductase is essential in combination with these flavin-dependent monooxygenases. The recombinant Escherichia coli cells expressing the DBT monooxygenase gene (bdsC) from B. subtilis WU-S2B also oxidize indole to blue pigment indigo in the presence of a heterologous flavin reductase. Thus, to clone a gene encoding flavin reductase from B. subtilis WU-S2B, indigo production by coexpression of the gene with bdsC in E. coli was used as a selection. Using this method, the corresponding gene (frb) was obtained from a recombinant strain forming a blue colony due to indigo production on a nutrient agar plate, and it was confirmed that this gene product Frb exhibited flavin reductase activity. The deduced amino acid sequence of frb consists of 174 amino acid residues and shares 61% identity with that of nitroreductase (YwrO) of Bacillus amyloliquefaciens. In addition, coexpression of frb with the DBT-desulfurization genes (bdsABC) from B. subtilis WU-S2B was critical for high DBT-desulfurizing ability over a wide temperature range of 20-55 degrees C. This coexpression screening using indigo production as selective indication may be widely applicable for cloning novel genes encoding either component of flavin reductase or flavin-dependent monooxygenase which efficiently couples with the other component in two-component monooxygenases.
|
81. |
Gueneau de Novoa P,
Williams KP,
( 2004 ) The tmRNA website: reductive evolution of tmRNA in plastids and other endosymbionts. PMID : 14681369 : DOI : 10.1093/nar/gkh102 PMC : PMC308836 Abstract >>
tmRNA combines tRNA- and mRNA-like properties and ameliorates problems arising from stalled ribosomes. Research on the mechanism, structure and biology of tmRNA is served by the tmRNA website (http://www.indiana.edu/~ tmrna), a collection of sequences, alignments, secondary structures and other information. Because many of these sequences are not in GenBank, a BLAST server has been added; another new feature is an abbreviated alignment for the tRNA-like domain only. Many tmRNA sequences from plastids have been added, five found in public sequence data and another 10 generated by direct sequencing; detection in early-branching members of the green plastid lineage brings coverage to all three primary plastid lineages. The new sequences include the shortest known tmRNA sequence. While bacterial tmRNAs usually have a lone pseudoknot upstream of the mRNA segment and a string of three or four pseudoknots downstream, plastid tmRNAs collectively show loss of pseudoknots at both postions. The pseudoknot-string region is also too short to contain the usual pseudoknot number in another new entry, the tmRNA sequence from a bacterial endosymbiont of insect cells, Tremblaya princeps. Pseudoknots may optimize tmRNA function in free-living bacteria, yet become dispensible when the endosymbiotic lifestyle relaxes selective pressure for fast growth.
|
82. |
Yao S,
Gao X,
Fuchsbauer N,
Hillen W,
Vater J,
Wang J,
( 2003 ) Cloning, sequencing, and characterization of the genetic region relevant to biosynthesis of the lipopeptides iturin A and surfactin in Bacillus subtilis. PMID : 14629006 : Abstract >>
Bacillus subtilis B3 was found to produce lipopeptides iturins and fengycin that have activity against several plant pathogens such as Fusarium graminearum, Rhizoctonia solani, Rhizoctonia cerealis, and Pyricularia grisea. A 3642-bp genomic region of B. subtilis B3 comprising srfDB3, aspB3, lpaB3, and yczEB3 genes that resulted in biosynthesis of surfactin in B. subtilis 168 was cloned, sequenced, and characterized. Among them, the srfDB3 gene encodes thioesterase, which is required for biosynthesis of surfactin in B. subtilis; the aspB3 gene encodes a putative aspartate aminotransferase-like protein; the lpaB3 encodes phosphopantetheinyl transferase, which shows high identity to the product of lpa-14 gene regulating the biosynthesis of iturin A and surfactin in B. subtilis RB14; the yczEB3 encodes a YczE-like protein with significant similarities in signal peptide and part of the ABC transport system. The genetic regions between the srfD gene and lpa gene from B. subtilis B3 and B. subtilis A13, which produces iturin A, contain an approximate 1-kb nucleotide fragment encoding an aspartate aminotransferase-like protein; however, the relevant regions from B. subtilis 168 and B. subtilis ATCC21332 producing surfactin comprise an approximately 4-kb nucleotide fragment encoding four unknown proteins. There is 73% identity between the Lpa family and the Sfp family, although both are highly conserved.
|
83. |
Hu X,
Roberts DP,
Maul JE,
Emche SE,
Liao X,
Guo X,
Liu Y,
McKenna LF,
Buyer JS,
Liu S,
( 2011 ) Formulations of the endophytic bacterium Bacillus subtilis Tu-100 suppress Sclerotinia sclerotiorum on oilseed rape and improve plant vigor in field trials conducted at separate locations. PMID : 21767217 : DOI : 10.1139/w11-041 Abstract >>
Sclerotinia sclerotiorum causes serious yield losses in crops in the People's Republic of China. Two formulations of oilseed rape seed containing the bacterium Bacillus subtilis Tu-100 were evaluated for suppression of this pathogen in field trials conducted at two independent locations. The pellet formulation significantly reduced disease (incidence and disease index) and increased plant dry mass, while the wrap formulation significantly reduced disease incidence and significantly increased plant dry mass at both field locations. Mean seed yield per 120 plants with both formulations of isolate Tu-100 was significantly greater than the appropriate controls, but at only one of the locations. Both formulations provided stable B. subtilis Tu-100 biomass (?10(5) CFU�Pg(-1)) and seed germination (?85%) over a 6 month period at room temperature. Polymerase chain reaction and DNA sequence analysis identified ituC and ituD, and bacAB and bacD in the genome of isolate Tu-100. These genes are involved in the biosynthesis of iturin and bacilysin. Iturin was detected in culture filtrates from isolate Tu-100, with thin layer chromatography. Detection of bacilysin was not attempted. Experiments reported here indicate the commercial viability of B. subtilis Tu-100 for suppression of S. sclerotiorum on oilseed rape.
|
84. |
Kubo Y,
Rooney AP,
Tsukakoshi Y,
Nakagawa R,
Hasegawa H,
Kimura K,
( 2011 ) Phylogenetic analysis of Bacillus subtilis strains applicable to natto (fermented soybean) production. PMID : 21764950 : DOI : 10.1128/AEM.00448-11 PMC : PMC3187134 Abstract >>
Spore-forming Bacillus strains that produce extracellular poly-�^-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group.
|
85. |
Summpunn P,
Chaijan S,
Isarangkul D,
Wiyakrutta S,
Meevootisom V,
( 2011 ) Characterization, gene cloning, and heterologous expression of �]-mannanase from a thermophilic Bacillus subtilis. PMID : 21369984 : DOI : 10.1007/s12275-011-0357-1 Abstract >>
Bacillus subtilis BCC41051 producing a thermostable �]-mannanase was isolated from soybean meal-enriched soil and was unexpectedly found to be thermophilic in nature. The extracellular �]-mannanase (ManA) produced was hydrophilic, as it was not precipitated even with ammonium sulfate at 80% saturation. The estimated molecular weight of ManA was 38.0 kDa by SDS-PAGE with a pi value of 5.3. Optimal pH and temperature for mannan-hydrolyzing activity was 7.0 and 60�XC, respectively. The enzyme was stable over a pH range of 5.0-11.5, and at temperatures of up to 60�XC for 30 min, with more than 80% of its activity retained. ManA was strongly inhibited by Hg(2+) (1 mM), but was sensitive to other divalent ions to a lesser degree. The gene of ManA encoded a protein of 362 amino acid residues, with the first 26 residues identified as a signal peptide. High expression of recombinant ManA was achieved in both Escherichia coli BL21 (DE3) (415.18 U/ml) and B. megaterium UNcat (359 U/ml).
|
86. |
Takenaka S,
Yoshida N,
Yoshida K,
Murakami S,
Aoki K,
( 2011 ) Molecular cloning and sequence analysis of two distinct halotolerant extracellular proteases from Bacillus subtilis FP-133. PMID : 21228481 : DOI : 10.1271/bbb.100588 Abstract >>
We cloned the genes encoding the two distinct extracellular halotolerant proteases of Bacillus subtilis FP-133 Expro-I and Expro-II, which were classified as alkaline serine and neutral proteases respectively. Three-dimensional modeling suggested that acidic and polar amino acid residues located on the surface stabilize protein structure in the presence of relatively high NaCl concentrations.
|
87. |
Walter J,
Noyer-Weidner M,
Trautner TA,
( 1990 ) The amino acid sequence of the CCGG recognizing DNA methyltransferase M.BsuFI: implications for the analysis of sequence recognition by cytosine DNA methyltransferases. PMID : 2108858 : PMC : PMC551770 Abstract >>
The Bacillus subtilis FI DNA methyltransferase (M.BsuFI) modifies the outer cytosine of the DNA sequence CCGG, causing resistance against R.BsuFI and R.MspI restriction. The M.BsuFI gene was cloned and expressed in B.subtilis and Escherichia coli. As derived from the nucleotide sequence, the M.BsuFI protein has 409 amino acids, corresponding to a molecular mass of 46,918 daltons. Including these data we have compared the nucleotide and amino acid sequences of different CCGG recognizing enzymes. These analyses showed that M.BsuFI is highly related to two other CCGG specific methyltransferases, M.MspI and M.HpaII, which were isolated from Gram-negative bacteria. Between M.BsuFI and M.MspI the sequence similarity is particularly significant in a region, which has been postulated to contain the target recognition domains (TRDs) of cytosine-specific DNA methyltransferases. Apparently M.BsuFI and M.MspI, derived from phylogenetic distant organisms, use highly conserved structural elements for the recognition of the CCGG target sequence. In contrast the very same region of M.HpaII is quite different from those of M.BsuFI and M.MspI. We attribute this difference to the different targeting of methylation within the sequence CCGG, where M.HpaII methylates the inner, M.BsuFI/M.MspI the outer cytosine. Also the CCGG recognizing TRD of the multispecific B.subtilis phage SPR Mtase is distinct from that of the host enzyme, possibly indicating different requirements for TRDs operative in mono- and multispecific enzymes.
|
88. |
Alonso JC,
Shirahige K,
Ogasawara N,
( 1990 ) Molecular cloning, genetic characterization and DNA sequence analysis of the recM region of Bacillus subtilis. PMID : 2124672 : DOI : 10.1093/nar/18.23.6771 PMC : PMC332730 Abstract >>
In Bacillus subtilis the recM gene, whose product is associated with DNA repair and recombination, has been located between the dnaX and rrnA genes. The recM gene has been cloned and analyzed. Analysis of the nucleotide sequence (3.741-kilobase) around recM revealed five open reading frames (orf). We have assigned recM and dnaX to two of this orf, given the gene order dnaX-orf107-recM-orf74-orf87. The organization of genes of the dnaX-orf107-recM region resembles the organization of genes in the dnaX-orf12-recR region of the Escherichia coli chromosome. Proteins of 24.2 and 17.0 kDa would result from translation of the wild type and in vitro truncated recM genes, and radioactive bands of proteins of molecular weights of 24.5 and 17.0 kDa were detected by the use of the T7promoter-expression system. The RecM protein contains a potential zinc finger domain for nucleic acid binding and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. Strains, in which the recM gene has been insertionally inactivated, were generated and show a phenotype essentially the same as previously described recM mutants.
|
89. |
Wu XC,
Nathoo S,
Pang AS,
Carne T,
Wong SL,
( 1990 ) Cloning, genetic organization, and characterization of a structural gene encoding bacillopeptidase F from Bacillus subtilis. PMID : 2108961 : Abstract >>
Bacillopeptidase F is an extracellular serine protease that is expressed at the beginning of the stationary phase. To study its structure, regulation of expression, and physiological roles, we have cloned and characterized the structural gene (bpf) encoding this protease from Bacillus subtilis. DNA sequence analysis suggests this protease is synthesized as a preproenzyme (Mr = 92,000). Through processing at both the NH2 and COOH termini, it is gradually converted into various forms with molecular mass ranging from 80 to 48 kDa. Shortening the 3' end of bpf demonstrates that at least 290 amino acid residues from the COOH-terminus of bacillopeptidase F are not required for either catalytic activity or secretion. Bacillopeptidase F exhibits sequence similarity with several serine proteases. Its gene is found immediately downstream from the fts operon which was mapped at 135 degrees on the B. subtilis genetic linkage map. Inactivation of the chromosomal copy of bpf shows no effect on cell growth and sporulation. A triple protease-deficient strain (WB300 with the structural genes for bacillopeptidase F and two other major proteases inactivated) was constructed to serve as a better expression host for the production and secretion of foreign proteins.
|
90. |
Emori M,
Takagi M,
Maruo B,
Yano K,
( 1990 ) Molecular cloning, nucleotide sequencing, and expression of the Bacillus subtilis (natto) IAM1212 alpha-amylase gene, which encodes an alpha-amylase structurally similar to but enzymatically distinct from that of B. subtilis 2633. PMID : 2118504 : DOI : 10.1128/jb.172.9.4901-4908.1990 PMC : PMC213144 Abstract >>
An alpha-amylase gene of Bacillus subtilis (natto) IAM1212 was cloned in a lambda EMBL3 bacteriophage vector, and the nucleotide sequence was determined. An open reading frame encoding the alpha-amylase (AMY1212) consists of 1,431 base pairs and contains 477 amino acid residues, which is the same in size as the alpha-amylase (AMY2633) of B. subtilis 2633, an alpha-amylase-hyperproducing strain, and smaller than that of B. subtilis 168, Marburg strain. The amino acid sequence of AMY1212 is different from that of AMY2633 at five residues. Enzymatic properties of these two alpha-amylases were examined by introducing the cloned genes into an alpha-amylase-deficient strain, B. subtilis M15. It was revealed that products of soluble starch hydrolyzed by AMY1212 are maltose and maltotriose, while those of AMY2633 are glucose and maltose. From the detailed analyses with oligosaccharides as substrates, it was concluded that the difference in hydrolysis products of the two similar alpha-amylases should be ascribed to the different activity hydrolyzing low-molecular-weight substrates, especially maltotriose; AMY1212 slowly hydrolyzes maltotetraose and cannot hydrolyze maltotriose, while AMY2633 efficiently hydrolyzes maltotetraose and maltotriose. Further analyses with chimeric alpha-amylase molecules constructed from the cloned genes revealed that only one amino acid substitution is responsible for the differences in hydrolysis products.
|
91. |
Sato T,
Samori Y,
Kobayashi Y,
( 1990 ) The cisA cistron of Bacillus subtilis sporulation gene spoIVC encodes a protein homologous to a site-specific recombinase. PMID : 2105293 : DOI : 10.1128/jb.172.2.1092-1098.1990 PMC : PMC208541 Abstract >>
The nucleotide sequence of the sporulation gene spoIVC cisA in Bacillus subtilis was determined and found to encode a protein of 500 amino acid residues with a calculated molecular weight of 57,481, which is in good agreement with the size of the gene product estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The amino acid sequence of the N-terminal region of this protein is homologous to the site-specific DNA recombinases. Hybridization of a 3.6-kilobase EcoRI fragment carrying the spoIVC cisA gene with the EcoRI-restricted chromosomal DNA prepared from cells of various stages showed that DNA rearrangement occurs only in the mother cell in the region adjacent to spoIVC cisA 3 h after the initiation of sporulation. This result coincides with that of Stragier et al. (P. Stragier, B. Kunkel, L. Kroos, and R. Losick, Science 243:507-512, 1989). The timing of the DNA rearrangement coincides very well with the timing of spoIVC cisA gene expression. The DNA rearrangement was not observed in spoIVC cisA mutants. These results strongly suggest that the spoIVC cisA gene encodes a site-specific DNA recombinase having a very important role in sporulation.
|
92. |
Fujiwara S,
Tsubokura N,
Kurusu Y,
Minami K,
Kobayashi Y,
( 1990 ) Heat-inducible translational coupling in Bacillus subtilis. PMID : 2107530 : DOI : 10.1093/nar/18.4.739 PMC : PMC330321 Abstract >>
Bacillus subtilis plasmid pGR71 is a promoter-probe shuttle vector derived from pUB110. The expression of the cat gene on pGR71 in B. subtilis requires the insertion of a Bacillus promoter and a ribosomal binding site (RBS) into the HindIII cloning site immediately upstream from the cat gene. A recombinant plasmid of pGR71, named pGR71-369, was obtained by a spontaneous deletion of a fragment containing most of the inserted HindIII fragment and the replication origin necessary for multiplication in Escherichia coli. The expression of the cat gene in B. subtilis cells carrying this plasmid was inducible by heat. Nucleotide sequence analysis of the upstream region of the cat gene, deletion analysis, and dot blot hybridization analysis of mRNA in various conditions revealed that the cat gene was expressed by heat-inducible translational coupling and that the regulatory region of heat inducibility was present in the upstream region of the cat gene.
|
93. |
Ouattara HG,
Reverchon S,
Niamke SL,
Nasser W,
( 2010 ) Biochemical properties of pectate lyases produced by three different Bacillus strains isolated from fermenting cocoa beans and characterization of their cloned genes. PMID : 20543060 : DOI : 10.1128/AEM.00705-10 PMC : PMC2916476 Abstract >>
Pectinolytic enzymes play an important role in cocoa fermentation. In this study, we characterized three extracellular pectate lyases (Pels) produced by bacilli isolated from fermenting cocoa beans. These enzymes, named Pel-22, Pel-66, and Pel-90, were synthesized by Bacillus pumilus BS22, Bacillus subtilis BS66, and Bacillus fusiformis BS90, respectively. The three Pels were produced under their natural conditions and purified from the supernatants using a one-step chromatography method. The purified enzymes exhibited optimum activity at 60 degrees C, and the half-time of thermoinactivation at this temperature was approximately 30 min. Pel-22 had a low specific activity compared with the other two enzymes. However, it displayed high affinity for the substrate, about 2.5-fold higher than those of Pel-66 and Pel-90. The optimum pHs were 7.5 for Pel-22 and 8.0 for Pel-66 and Pel-90. The three enzymes trans-eliminated polygalacturonate in a random manner to generate two long oligogalacturonides, as well as trimers and dimers. A synergistic effect was observed between Pel-22 and Pel-66 and between Pel-22 and Pel-90, but not between Pel-90 and Pel-66. The Pels were also strongly active on highly methylated pectins (up to 60% for Pel-66 and Pel-90 and up to 75% for Pel-22). Fe(2+) was found to be a better cofactor than Ca(2+) for Pel-22 activity, while Ca(2+) was the best cofactor for Pel-66 and Pel-90. The amino acid sequences deduced from the cloned genes showed the characteristics of Pels belonging to Family 1. The pel-66 and pel-90 genes appear to be very similar, but they are different from the pel-22 gene. The characterized enzymes form two groups, Pel-66/Pel-90 and Pel-22; members of the different groups might cooperate to depolymerize pectin during the fermentation of cocoa beans.
|
94. |
Liu X,
Xu JH,
Pan J,
Zhao J,
( 2010 ) Efficient production of (S)-naproxen with (R)-substrate recycling using an overexpressed carboxylesterase BsE-NP01. PMID : 20237863 : DOI : 10.1007/s12010-010-8939-7 Abstract >>
An (S)-enantioselective esterase from Bacillus subtilis ECU0554, named BsE-NP01, has been cloned and over-expressed in a heterologous host Escherichia coli BL21. BsE-NP01 was shown to be a carboxylesterase with a molecular mass of about 32 kDa, and temperature and pH optima at 50 degrees C and 8.5, respectively. It could catalyze the selective hydrolysis of the (S)-enantiomer of racemic naproxen methyl ester, giving optically pure (S)-naproxen with 98% enantiomeric excess. A mechanic-grinding approach to substrate dispersion was also reported, which was considered to be an alternative to take the place of deleterious surfactants such as Tween-80, with improved performance of the hydrolysis reaction. Batch production of (S)-naproxen was repeatedly carried out in a solid-water biphasic system at 2-L scale, achieving an average total yield of about 85% after ten runs with complete recycling of (R)-substrate.
|
95. |
Kino K,
Arai T,
Tateiwa D,
( 2010 ) A novel L-amino acid ligase from Bacillus subtilis NBRC3134 catalyzed oligopeptide synthesis. PMID : 20057135 : DOI : 10.1271/bbb.90649 Abstract >>
L-Amino acid ligase catalyzes dipeptide synthesis from unprotected L-amino acids in an ATP-dependent manner. We have purified a new L-amino acid ligase, RizA, which synthesizes dipeptides whose N-terminus is Arg, from Bacillus subtilis NBRC3134, a microorganism that produces a rhizocticin peptide antibiotic. It was suggested that RizA is probably involved in rhizocticin biosynthesis. In this study, we performed sequence analysis of unknown regions around rizA, and newly identified a gene that encodes a protein that possesses an ATP-grasp motif upstream of rizA. This gene was designated rizB, and its recombinant protein was prepared. Recombinant RizB synthesized homo-oligomers of branched-chain L-amino acids and L-methionine consisting of two to five amino acids in an ATP-dependent manner. RizB also synthesized various heteropeptides. Further examination showed that RizB might elongate a peptide chain at the N-terminus. This is the first report on an L-amino acid ligase catalyzing oligopeptide synthesis.
|
96. |
Yoon KH,
( 2009 ) Cloning of a Bacillus subtilis AMX-4 xylanase gene and characterization of the gene product. PMID : 20075612 : Abstract >>
A gene encoding the xylanase of Bacillus subtilis AMX-4 isolated from soil was cloned into Escherichia coli, and the gene product was purified from the cell-free extract of the recombinant strain. The gene, designated xylA, consisted of 639 nucleotides encoding a polypeptide of 213 residues. The deduced amino acid sequence was highly homologous to those of xylanase belonging to glycosyl hydrolase family 11. The molecular mass of the purified xylanase was 23 kDa as estimated by SDS-PAGE. The enzyme had a pH optimum at 6.0-7.0 and a temperature optimum at 50-55 degrees C. Xylanase activity was significantly inhibited by 5 mM Cu2+ and 5 mM Mn2+, and noticeably enhanced by 5 mM Fe2+. The enzyme was active on xylans including arabinoxylan, birchwood xylan, and oat spelt xylan, but it did not exhibit activity toward carboxymethylcellulose or p-nitrophenyl-beta-xylopyranoside. The predominant products resulting from xylan and xylooligosaccharide hydrolysis were xylobiose and xylotriose. The enzyme could hydrolyze xylooligosaccharides larger than xylotriose.
|
97. |
Rooney AP,
Price NP,
Ehrhardt C,
Swezey JL,
Bannan JD,
( 2009 ) Phylogeny and molecular taxonomy of the Bacillus subtilis species complex and description of Bacillus subtilis subsp. inaquosorum subsp. nov. PMID : 19622642 : DOI : 10.1099/ijs.0.009126-0 Abstract >>
The Bacillus subtilis species complex is a tight assemblage of closely related species. For many years, it has been recognized that these species cannot be differentiated on the basis of phenotypic characteristics. Recently, it has been shown that phylogenetic analysis of the 16S rRNA gene also fails to differentiate species within the complex due to the highly conserved nature of the gene, yet DNA-DNA hybridization values fall well below 70 % for the same species comparisons. As a complementary approach, we propose that phylogenetic analysis of multiple protein-coding loci can be used as a means to detect and differentiate novel Bacillus taxa. Indeed, our phylogenetic analyses revealed the existence of a previously unknown group of strains closely related to, but distinct from, Bacillus subtilis subsp. spizizenii. Results of matrix-assisted laser desorption ionization-time of flight mass spectrometry analyses revealed that the group produces a novel surfactin-like lipopeptide with mass m/z 1120.8 that is not produced by the other currently recognized subspecies. In addition, the group displayed differences in the total cellular content of the fatty acids C(16 : 0) and iso-C(17 : 1)omega10c that distinguish it from the closely related B. subtilis subsp. spizizenii. Consequently, the correlation of these novel phenotypic traits with the phylogenetic distinctiveness of this previously unknown subspecies group showed that phylogenetic analysis of multiple protein-coding loci can be used as a means to detect and differentiate novel Bacillus taxa. Therefore, we propose that this new group should be recognized as representing a novel taxon, Bacillus subtilis subsp. inaquosorum subsp. nov., with the type strain NRRL B-23052(T) (=KCTC 13429(T)=BGSC 3A28(T)).
|
98. |
Derman AI,
Becker EC,
Truong BD,
Fujioka A,
Tucey TM,
Erb ML,
Patterson PC,
Pogliano J,
( 2009 ) Phylogenetic analysis identifies many uncharacterized actin-like proteins (Alps) in bacteria: regulated polymerization, dynamic instability and treadmilling in Alp7A. PMID : 19602153 : DOI : 10.1111/j.1365-2958.2009.06771.x PMC : PMC2814180 Abstract >>
Actin, one of the most abundant proteins in the eukaryotic cell, also has an abundance of relatives in the eukaryotic proteome. To date though, only five families of actins have been characterized in bacteria. We have conducted a phylogenetic search and uncovered more than 35 highly divergent families of actin-like proteins (Alps) in bacteria. Their genes are found primarily on phage genomes, on plasmids and on integrating conjugative elements, and are likely to be involved in a variety of functions. We characterize three Alps and find that all form filaments in the cell. The filaments of Alp7A, a plasmid partitioning protein and one of the most divergent of the Alps, display dynamic instability and also treadmill. Alp7A requires other elements from the plasmid to assemble into dynamic polymers in the cell. Our findings suggest that most if not all of the Alps are indeed actin relatives, and that actin is very well represented in bacteria.
|
99. |
Peerzada K,
Ul Hussain M,
Jan N,
Verma V,
Qazi GN,
Andrabi KI,
( 2009 ) Functional cloning and predictive structural modeling of a novel esterase from Bacillus subtilis strain, RRL 1789. PMID : 19940376 : Abstract >>
We have recently reported the purification and characterization of a novel esterase from the Bacillus subtilis strain. In the present study we report the genomic DNA cloning and predictive structural modeling of this novel esterase. Tributyrin- and Rhodamine B-based functional screen of a Bacillus subtilis genomic library led to the identification of a potential lipolytic gene. DNA sequence analysis of the cloned gene showed that it encodes a protein of 489 amino acid residues. Sequence homology search and multiple sequence alignment showed that the protein was highly homologous to known esterases. Secondary structure-driven multiple sequence alignment with the homologous esterase of known three-dimensional structures was performed and a 3D structure model of this enzyme was constructed. Based on the topological organization of the secondary structures, this protein belongs to the alpha/beta hydrolase superfamily. Moreover, the presence of serine in the context of amino acid sequence G/A-X-S-X-G (with X an arbitrary amino acid residue) in the protein indicates that it belong to the class of serine hydrolases of this superfamily.
|
100. |
Qiao J,
Rao Z,
Dong B,
Cao Y,
( 2010 ) Expression of Bacillus subtilis MA139 beta-mannanase in Pichia pastoris and the enzyme characterization. PMID : 19504356 : DOI : 10.1007/s12010-009-8688-7 Abstract >>
The 1014 nucleotides long gene-encoding beta-mannanase from Bacillus subtilis strain MA139 was cloned using PCR. To obtain high expression levels in Pichia pastoris, the beta-mannanase gene was optimized according to the codon usage bias of P. pastoris and fused downstream of GAP promoter. The reconstituted plasmid pGAP-mann was transformed into P. pastoris X-33 strain to constitutively express beta-mannanase. When cultured at 28 degrees Celsius for 3 days protein yields up to 2.7 mg/mL was obtained with the enzyme activity of up to 230 U/mL. In comparison, wild-type gene product yielded 1.9 mg/mL and 170 U/mL, respectively indicating that the protein yield and enzyme activity were significantly improved by codon modification. After purification, the enzyme properties were characterized. The optimal activity was at pH 6.0 and 50 degrees Celsius. In the pH range of 3.0 to 9.0, beta-mannanase showed above 60% of its peak activity. Among the numerous ions tested copper significantly inhibited the enzyme activity. These results suggested that codon-optimized beta-mannanase expressed in P. pastoris could potentially be used as an additive in the feed for monogastric animals.
|
101. |
Sung JH,
Ahn SJ,
Kim NY,
Jeong SK,
Kim JK,
Chung JK,
Lee HH,
( 2010 ) Purification, molecular cloning, and biochemical characterization of subtilisin JB1 from a newly isolated Bacillus subtilis JB1. PMID : 19902383 : DOI : 10.1007/s12010-009-8830-6 Abstract >>
An extracellular gelatinolytic enzyme obtained from the newly isolated Bacillus subtilis JB1, a thermophilic microorganism relevant to the aerobic biodegradation process of fish-meal production, was purified via ammonium sulfate precipitation, Sephadex G-200 Gel filtration chromatography, and one-dimensional gel electrophoresis separation and subsequently identified via peptide mass fingerprinting and chemically assisted fragmentation matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The subtilisin JB1 gene was sequenced and its recombinant protein prosubtilisin JB1 was expressed in Escherichia coli, and the purified prosubtilisin JB1 (62 kDa) protein was digested with gelatin, bovine serum albumin, azocasein, fibrinogen, and the fluorogenic peptide substrate Ala-Ala-Phe-7-amido-4-methylcoumarin hydrochloride, whereas the serine protease inhibitors phenylmethylsulfonyl fluoride and chymostatin completely inhibited its enzyme activity at an optimal pH of 7.5. Thus, our results show that subtilisin JB1 may serve as a potential source material for use in industrial applications of proteolytic enzymes and microorganisms for fishery waste degradation and fish by-product processing.
|
102. |
Gonzy-Tréboul G,
de Waard JH,
Zagorec M,
Postma PW,
( 1991 ) The glucose permease of the phosphotransferase system of Bacillus subtilis: evidence for IIGlc and IIIGlc domains. PMID : 1956301 : DOI : 10.1111/j.1365-2958.1991.tb01898.x Abstract >>
Glucose is taken up in Bacillus subtilis via the phosphoenolpyruvate:glucose phosphotransferase system (glucose PTS). Two genes, orfG and ptsX, have been implied in the glucose-specific part of this PTS, encoding an Enzyme IIGlc and an Enzyme IIIGlc, respectively. We now show that the glucose permease consists of a single, membrane-bound, polypeptide with an apparent molecular weight of 80,000, encoded by a single gene which will be designated ptsG. The glucose permease contains domains that are 40-50% identical to the IIGlc and IIIGlc proteins of Escherichia coli. The B. subtilis IIIGlc domain can replace IIIGlc in E. coli crr mutants in supporting growth on glucose and transport of methyl alpha-glucoside. Mutations in the IIGlc and IIIGlc domains of the B. subtilis ptsG gene impaired growth on glucose and in some cases on sucrose. ptsG mutants lost all methyl alpha-glucoside transport but retained part of the glucose-transport capacity. Residual growth on glucose and transport of glucose in these ptsG mutants suggested that yet another uptake system for glucose existed, which is either another PT system or regulated by the PTS. The glucose PTS did not seem to be involved in the regulation of the uptake or metabolism of non-PTS compounds like glycerol. In contrast to ptsl mutants in members of the Enterobacteriaceae, the defective growth of B. subtilis ptsl mutants on glycerol was not restored by an insertion in the ptsG gene which eliminated IIGlc. Growth of B. subtilis ptsG mutants, lacking IIGlc, was not impaired on glycerol. From this we concluded that neither non-phosphorylated nor phosphorylated IIGlc was acting as an inhibitor or an activator, respectively, of glycerol uptake and metabolism.
|
103. |
Jarvis ED,
Cheng S,
Rudner R,
( 1990 ) Genetic structure and DNA sequences at junctions involved in the rearrangements of Bacillus subtilis strains carrying the trpE26 mutation. PMID : 1981762 : PMC : PMC1204278 Abstract >>
Studies on the region upstream to ribosomal operon rrnD of Bacillus subtilis led to the characterization of two of the four chromosomal junctions involved in the rearrangements (a translocation and an inversion) of the strains carrying the trpE26 mutation. Genetic analysis, by integrative mapping, showed linkage of rrnD to cysB and hisA (both on segment A) in the trpE26-type strains. Physical analysis showed that the region upstream to rrnD is now linked to the trpE-ilvA chromosome segment as demonstrated by analyzing restriction site-polymorphism between 168 and trpE26-type strains. Similar experiments confirmed the previous genetic data on linkage in these areas in strains carrying novel rearrangements derived from the trpE26-type strains: stable merodiploids and inversions. The nucleotide sequence of the area 5' to rrnD in both types of strains (168 and trpE26), the region downstream of the citG gene and the region carrying the trpE26 mutation (made available to us by D. Henner) provided evidence for the molecular basis of the differences in structure, allowed the identification of the break points and revealed the presence of a polypurine region upstream to rrnD as seen in other systems in B. subtilis. No extensive homology was found between pairs of junctions so far sequenced. The models proposed by C. Anagnostopoulos for the role of DNA sequences of intrachromosomal homology involved in the transfer of the trpE26 mutation and the formation of novel arrangements require therefore reevaluation.
|
104. |
Nagarajan DR,
Krishnan C,
( 2010 ) Use of a new catabolite repression resistant promoter isolated from Bacillus subtilis KCC103 for hyper-production of recombinant enzymes. PMID : 19815075 : DOI : 10.1016/j.pep.2009.09.020 Abstract >>
Bacillus subtilis KCC103 hyper-produces alpha-amylase and the synthesis is resistant to carbon catabolite repression. The strain efficiently produced alpha-amylase in low cost agro-biomass based medium rich in simple sugars without catabolite repression. Here, the catabolite repression resistant promoter (amyR4) of alpha-amylase was isolated from KCC103 and used to synthesize recombinant enzymes in B. subtilis. When the bgaB gene encoding beta-galactosidase of Bacillus stearothermophilus was cloned and expressed under the amyR4 promoter, high level of beta-galactosidase activity was found in Escherichia coli (28 U/ml)) and B. subtilis (19 U/ml). Further, the genes encoding endoxylanase (xynA) and carboxymethyl cellulase (bglC) from B. subtilis were cloned with signal peptides and expressed with CCR-resistant amyR4 promoter. In E. coli, the expression was intracellular with activities of cellulase and xylanase at 76 and 105IU/ml respectively. The expression was extracellular in B. subtilis with activities at 17 and 17 IU/ml of cellulase and xylanase respectively in LB medium. When recombinant B. subtilis was cultured in LB-glucose medium, the synthesis of recombinant enzymes was not subject to catabolite repression and the expression was observed throughout the growth. This is important as glucose in the medium can prevent sporulation of the Bacillus and prevent activation of the other scavenger pathways that leads to degradation of recombinant proteins. The catabolite derepressed promoter of alpha-amylase from B. subtilis KCC103 can be efficiently used for overexpression of various industrial enzymes.
|
105. |
Kimura K,
Tran LS,
Do TH,
Itoh Y,
( 2009 ) Expression of the pgsB encoding the poly-gamma-DL-glutamate synthetase of Bacillus subtilis (natto). PMID : 19420703 : DOI : 10.1271/bbb.80913 Abstract >>
An industrial strain of Bacillus subtilis (natto) was used to produce poly-gamma-DL-glutamate (gammaPGA), a polymer of DL-glutamate linked by a gamma-peptide bond. In spite of efforts to improve gammaPGA production by modifying the medium, little attention has been paid to the expression of the gammaPGA synthetase gene. In this study, we investigated the expression of the gammaPGA synthetic gene and the gammaPGA product under various conditions with the LacZ-fusion of the synthetic gene (pgsB-lacZ). The 5' upstream regulatory region of the pgsB gene was also investigated by constructing deletion mutations of lacZ-fusion. The pgsB-lacZ was clearly expressed in the early stationary phase and was abolished by degU gene disruption. The results showed that pgsB-lacZ expression was repressed in rich media, and that gammaPGA production was limited by the substrate supply rather than by the amount of synthetase. Adding D-glutamate to the medium reduced gammaPGA production and synthetic gene expression. The transcription start point was determined by primer extension, and it was found that up to -721 bp (translation start point = +1) of the 5' untranslated region (UTR) was required for optimal pgsB-lacZ fusion gene expression.
|
106. |
Oskam L,
Hillenga DJ,
Venema G,
Bron S,
( 1991 ) The large Bacillus plasmid pTB19 contains two integrated rolling-circle plasmids carrying mobilization functions. PMID : 1946749 : Abstract >>
Plasmid pTB19 is a 27-kb plasmid originating from a thermophilic Bacillus species. It was shown previously that pTB19 contains an integrated copy of the rolling-circle type plasmid pTB913. Here we describe the analysis of a 4324-bp region of pTB19 conferring resistance to tetracycline. The nucleotide sequence of this region revealed all the characteristics of a second plasmid replicating via the rolling-circle mechanism. This sequence contained (i) the tetracycline resistance marker of pTB19, which is highly similar to other tetL-genes of gram-positive bacteria; (ii) a hybrid mob gene, which bears relatedness to both the mob-genes of pUB110 and pTB913; (iii) a palU type minus origin identical to those of pUB110 and pTB913; and (iv) a plus origin of replication similar to that of pTB913. A repB-type replication initiation gene sequence identical to that of pTB913 was present, which lacked the middle part (492 bp), thus preventing autonomous replication of this region. The hybrid mob gene was functional in conjugative mobilization of plasmids between strains of Bacillus subtilis.
|
107. |
Kino K,
Kotanaka Y,
Arai T,
Yagasaki M,
( 2009 ) A novel L-amino acid ligase from Bacillus subtilis NBRC3134, a microorganism producing peptide-antibiotic rhizocticin. PMID : 19352016 : DOI : 10.1271/bbb.80842 Abstract >>
L-amino acid ligase catalyzes the formation of an alpha-peptide bond from unprotected L-amino acids in an ATP-dependent manner, and this enzyme is very useful in efficient peptide production. We performed enzyme purification to obtain a novel L-amino acid ligase from Bacillus subtilis NBRC3134, a microorganism producing peptide-antibiotic rhizocticin. Rhizocticins are dipeptide or tripeptide antibiotics and commonly possess L-arginyl-L-2-amino-5-phosphono-3-cis-pentenoic acid. The purification was carried out by detecting L-arginine hydroxamate synthesis activity, and a target enzyme was finally purified 1,280-fold with 0.8% yield. The corresponding gene was then cloned and designated rizA. rizA was 1,242 bp and coded for 413 amino acid residues. Recombinant RizA was prepared, and it was found that the recombinant RizA synthesized dipeptides whose N-terminus was L-arginine in an ATP-dependent manner. RizA had strict substrate specificity toward L-arginine as the N-terminal substrate; on the other hand, the substrate specificity at the C-terminus was relaxed.
|
108. |
Li W,
Huan X,
Zhou Y,
Ma Q,
Chen Y,
( 2009 ) Simultaneous cloning and expression of two cellulase genes from Bacillus subtilis newly isolated from Golden Takin (Budorcas taxicolor Bedfordi). PMID : 19366617 : DOI : 10.1016/j.bbrc.2009.04.027 Abstract >>
A bacterial strain with high cellulase activity was isolated of feces sample of Golden Takin (Budorcas taxicolor Bedfordi). The bacterium was classified and designated Bacillus subtilis LN by morphological and 16SrDNA gene sequence analysis. Two putative cellulase genes, CelL15 and CelL73, were simultaneously cloned from the isolated strain by PCR. The putative gene CelL15 consisted of an open reading frame (ORF) of 1470 nucleotides and encoded a protein of 490 amino acids with a molecular weight of 54kDa. The CelL73 gene consisted of an open reading frame (ORF) of 741 nucleotides and encoded a protein of 247 amino acids with a molecular weight of 27kDa. Both genes were purified and cloned into pET-28a for expression in Escherichia coli BL21 (DE3). The ability of E. coli to degrade cellulose was enhanced when the two recombinants were cultured together.
|
109. |
Yang D,
Weng H,
Wang M,
Xu W,
Li Y,
Yang H,
( 2010 ) Cloning and expression of a novel thermostable cellulase from newly isolated Bacillus subtilis strain I15. PMID : 19669599 : DOI : 10.1007/s11033-009-9635-y Abstract >>
A novel bacterial strain with high cellulase activity (2.82 U/ml) was isolated, and then identified by its morphological character and 16S rRNA sequence, and named Bacillus subtilis strain I15. The extracellular thermostable cellulase exhibited the maximum activity at 60 degrees C and pH 6.0. It was very stable since more than 90% of original CMCase activity was maintained at 65 degrees C after incubation for 2 h. The cellulase gene, celI15, was cloned and extracellularly expressed by Escherichia coli BL21 (DE3), which encoded the extracellular protein of about 52 kDa. The extracellular activity of CelI15 from E. coli BL21 was up to about 6.78 U/ml, and all the other properties were almost the same as that from the wild-type strain.
|
110. |
Jalal A,
Rashid N,
Rasool N,
Akhtar M,
( 2009 ) Gene cloning and characterization of a xylanase from a newly isolated Bacillus subtilis strain R5. PMID : 19332293 : DOI : 10.1016/j.jbiosc.2008.12.005 Abstract >>
A novel mesophilic strain, R5, was isolated from Osaka, Japan. The growth temperature of the strain ranged from 10 to 40 degrees C with optimal growth at 30 degrees C. Cells of strain R5 were highly motile small rods. The full-length 16S rRNA sequence was 99% homologous to that of Bacillus subtilis strain 168. The optimum pH and NaCl concentration for growth of the strain were 7.0 and 3%, respectively. Based on the biochemical characteristics and 16S rRNA sequences R5 was identified as a strain of B. subtilis. The strain R5 produced protease, cellulase, amylase, lipase/esterase, xylanase and a biosurfactant extracellularly. The gene encoding xylanase was cloned and expressed in Escherichia coli. The gene encoded a protein consisting of 213 amino acids with a relative molecular mass of 23 kDa. The gene product was purified and examined for enzymatic characteristics. The recombinant enzyme exhibited highest activity at temperatures ranging from 40 to 50 degrees C and at pH 6.0. The enzyme activity was enhanced in the presence of metal cations. The V(max) and K(m) values of the recombinant enzyme towards xylan from beech-wood were 5550 nkat/mg and 4.5 mg/mL, respectively.
|
111. |
Liu Y,
Lu F,
Chen G,
Snyder CL,
Sun J,
Li Y,
Wang J,
Xiao J,
( 2010 ) High-level expression, purification and characterization of a recombinant medium-temperature alpha-amylase from Bacillus subtilis. PMID : 19728109 : DOI : 10.1007/s10529-009-0112-4 Abstract >>
Alpha-amylases are important industrial enzymes with a wide range of applications. Although medium-temperature alpha amylase (AmyE) has some practical advantages, its low yield has limited its applications. When an amyE gene from Bacillus subtilis BF768 was cloned into vector pWB980 and over-expressed in B. subtilis WB600, high activities (723 U ml(-1)) of secreted AmyE were produced. Recombinant AmyE was purified to a specific activity of 36 U mg(-1) having optimal activity at pH 6.0 and 60 degrees C.
|
112. |
Kim JH,
Prabhu P,
Jeya M,
Tiwari MK,
Moon HJ,
Singh RK,
Lee JK,
( 2010 ) Characterization of an L-arabinose isomerase from Bacillus subtilis. PMID : 19727704 : DOI : 10.1007/s00253-009-2210-6 Abstract >>
An isolated gene from Bacillus subtilis str. 168 encoding a putative isomerase was proposed as an L-arabinose isomerase (L-AI), cloned into Escherichia coli, and its nucleotide sequence was determined. DNA sequence analysis revealed an open reading frame of 1,491 bp, capable of encoding a polypeptide of 496 amino acid residues. The gene was overexpressed in E. coli and the protein was purified using nickel-nitrilotriacetic acid chromatography. The purified enzyme showed the highest catalytic efficiency ever reported, with a k(cat) of 14,504 min(-1) and a k(cat)/K(m) of 121 min(-1) mM(-1) for L-arabinose. A homology model of B. subtilis L-AI was constructed based on the X-ray crystal structure of E. coli L-AI. Molecular dynamics simulation studies of the enzyme with the natural substrate, L-arabinose, and an analogue, D-galactose, shed light on the unique substrate specificity displayed by B. subtilis L-AI only towards L-arabinose. Although L-AIs have been characterized from several other sources, B. subtilis L-AI is distinguished from other L-AIs by its high substrate specificity and catalytic efficiency for L-arabinose.
|
113. |
Liu CH,
Chiu CS,
Ho PL,
Wang SW,
( 2009 ) Improvement in the growth performance of white shrimp, Litopenaeus vannamei, by a protease-producing probiotic, Bacillus subtilis E20, from natto. PMID : 19320951 : DOI : 10.1111/j.1365-2672.2009.04284.x Abstract >>
To isolate and identify a benefic bacterium, Bacillus subtilis E20, from natto (fermented soybeans), and incorporate it into shrimp feed to promote shrimp growth performance. A protease-producing bacterium, E20, isolated from natto was identified as B. subtilis by an API 50 CHB kit and the 16S rDNA sequence. B. subtilis E20 was able to grow at a broad range of temperatures (10-50 degrees C), pH values (5-10), and NaCl levels (0-9%). The best culture conditions for B. subtilis E20 to produce the protease were 40 degrees C, a pH of 6-8 and 0% NaCl. No shrimp died after being injected with B. subtilis E20 [up to 10(9) colony-forming units (CFU) per shrimp]. Bacillus subtilis E20 was incorporated in diets at the levels of 0 (control), 10(6), 10(7), and 10(8) CFU kg(-1) for shrimp grow-out culture, and results showed that after feeding on B. subtilis E20-containing diets (10(8) CFU kg(-1) of diet), shrimp had excellent growth performance and production compared to the control because protease activities in the digestive tract were improved by B. subtilis E20. Bacillus subtilis E20 isolated from natto is a great protease producer and is able to improve shrimp growth performance through increasing the digestibility of food. Results suggest that B. subtilis E20 is a potential candidate for use as a probiotic to improve shrimp growth performance, and consequently reduce feed costs.
|
114. |
Hu XF,
Li SX,
Wu JG,
Wang JF,
Fang QL,
Chen JS,
( 2010 ) Transfer of Bacillus mucilaginosus and Bacillus edaphicus to the genus Paenibacillus as Paenibacillus mucilaginosus comb. nov. and Paenibacillus edaphicus comb. nov. PMID : 19643872 : DOI : 10.1099/ijs.0.008532-0 Abstract >>
Bacillus mucilaginosus and Bacillus edaphicus were reclassified based on their 16S rRNA and gyrB gene sequences, DNA-DNA hybridization, fatty acid methyl esters and other taxonomic characteristics. Phylogenetic analysis based on 16S rRNA and gyrB gene sequences indicated that strains of B. mucilaginosus and B. edaphicus were members of the genus Paenibacillus, with over 90.4 % and 70.3 % sequence similarity, respectively. Their DNA G+C contents were 54.5-56.8 mol%. The DNA-DNA relatedness values of B. edaphicus VKPM B-7517(T) with B. mucilaginosus KNP414 and B. mucilaginosus CGMCC 1.236 were 89.2 % and 88.7 %, respectively. The major isoprenoid quinone of B. mucilaginosus and B. edaphicus was MK-7 (94.1-95.7 %). The peptidoglycan type was A1gamma (meso-diaminopimelic acid) and the major polar lipids were phosphatidylglycerol and diphosphatidylglycerol. The major fatty acids were anteiso-C(15 : 0), C(16 : 1)omega11c and C(16 : 0). Phenotypic features and fatty acid profiles supported the similarity of B. mucilaginosus and B. edaphicus to Paenibacillus validus CCTCC 95016(T) and confirmed their relationship with members of the genus Paenibacillus. Therefore, it is proposed that Bacillus mucilaginosus and Bacillus edaphicus be transferred to the genus Paenibacillus as Paenibacillus mucilaginosus comb. nov. (type strain HSCC 1605(T)=VKPM B-7519(T)=VKM B-1480D(T)=CIP 105815(T)=KCTC 3870(T)) and Paenibacillus edaphicus comb. nov. (type strain VKPM B-7517(T)=DSM 12974(T)=CIP 105814(T)), respectively.
|
115. |
Stefanic P,
Mandic-Mulec I,
( 2009 ) Social interactions and distribution of Bacillus subtilis pherotypes at microscale. PMID : 19114482 : DOI : 10.1128/JB.01290-08 PMC : PMC2648371 Abstract >>
Bacillus subtilis strains communicate through the comQXPA quorum sensing (QS) system, which regulates genes expressed during early stationary phase. A high polymorphism of comQXP' loci was found in closely related strains isolated from desert soil samples separated by distances ranging from meters to kilometers. The observed polymorphism comprised four communication groups (pherotypes), such that strains belonging to the same pherotype exchanged information efficiently but strains from different pherotypes failed to communicate. To determine whether the same level of polymorphism in the comQXP' QS system could be detected at microscale, B. subtilis isolates were obtained from two separate 1-cm(3) soil samples, which were progressively divided into smaller sections. Cross-activation studies using pherotype-responsive reporter strains indicated the same number of communication pherotypes at microscale as previously determined at macroscale. Sequencing of the housekeeping gene gyrA and the QS comQ gene confirmed different evolutionary rates of these genes. Furthermore, an asymmetric communication response was detected inside the two pherotype clusters, suggesting continuous evolution of the QS system and possible development of new languages. To our knowledge, this is the first microscale study demonstrating the presence of different QS languages among isolates of one species, and the implications of this microscale diversity for microbial interactions are discussed.
|
116. |
Mauël C,
Young M,
Karamata D,
( 1991 ) Genes concerned with synthesis of poly(glycerol phosphate), the essential teichoic acid in Bacillus subtilis strain 168, are organized in two divergent transcription units. PMID : 1906926 : DOI : 10.1099/00221287-137-4-929 Abstract >>
Insertional mutagenesis has revealed that a 22 kbp segment from the hisA region of the Bacillus subtilis 168 chromosome (310 degrees on the genetic map) contains at least six independent transcription units, all apparently devoted to production of cell envelope components. Genes concerned with synthesis of poly(glycerol phosphate), poly(groP), an essential cell wall polymer in B. subtilis 168, are organized in two divergently transcribed operons denoted tagABC and tagDEF. Nucleotide sequence analysis indicates that three of these six genes encode extremely basic polypeptides. The deduced products of the tagABC operon may be involved in poly(groP) assembly and export, whereas those of the tagDEF operon, which are very hydrophilic, are more likely to be implicated in poly(groP) precursor biosynthesis. The first gene of the tagDEF operon encodes glycerol-3-phosphate cytidylyltransferase (Pooley et al., 1991, Journal of General Microbiology 137, 921-928) and its deduced product has significant homology with cholinephosphate cytidylyltransferase from yeast. There is also substantial homology between the deduced products of tagB in the tagABC operon and tagF in the tagDEF operon.
|
117. |
Kwon GH,
Lee HA,
Park JY,
Kim JS,
Lim J,
Park CS,
Kwon DY,
Kim YS,
Kim JH,
( 2009 ) Development of a RAPD-PCR method for identification of Bacillus species isolated from Cheonggukjang. PMID : 19157616 : DOI : 10.1016/j.ijfoodmicro.2008.12.013 Abstract >>
A RAPD-PCR (Randomly Amplified Polymorphic DNA-PCR) method was developed for rapid identification of Bacillus species, especially B. subtilis, B. licheniformis, and B. amyloliquefaciens, the most frequently isolated organisms from fermented soy foods such as Cheonggukjang, a Korean traditional food. A RAPD-PCR using a 10-mer (S-30) produced species specific bands reproducibly. All B. subtilis strains tested produced common bands of 0.5 and 0.88 kb in size. All B. amyloliquefaciens strains generated 1.1 and 1.5 kb bands together with 0.5 kb fragment whereas B. licheniformis strains produced 1.25, 1.70, and 1.9 kb bands with an occasional 0.5 kb band. Using the RAPD-PCR protocol, six bacilli strains isolated from Cheonggukjang were identified to the species level, which was difficult by 16S rRNA gene and recA gene sequencing for some isolates. The 0.5 kb fragment, the major band for B. subtilis strains, was an internal part of a ytcP gene encoding a hypothetical ABC-type transporter. A B. subtilis species specific primer pair was designed based on ytcP sequences and PCR using the primer pair produced a 0.46 kb fragment only from B. subtilis strains.
|
118. |
Lin L,
Meng X,
Liu P,
Hong Y,
Wu G,
Huang X,
Li C,
Dong J,
Xiao L,
Liu Z,
( 2009 ) Improved catalytic efficiency of endo-beta-1,4-glucanase from Bacillus subtilis BME-15 by directed evolution. PMID : 19050861 : DOI : 10.1007/s00253-008-1789-3 Abstract >>
Bacillus subtilis endo-beta-1,4-glucanase (Cel5A) hydrolyzes cellulose by cleavage of the internal bonds in the glucose chains, producing new ends randomly. Using directed evolution techniques of error-prone polymerase chain reaction (PCR) and DNA shuffling, several Cel5A variants with improved catalytic activity had been screened from the mutant library, which contained 71,000 colonies. Compared with the wild-type enzyme, the variants (M44-11, S75 and S78) showed 2.03 to 2.68-fold increased activities toward sodium carboxymethyl cellulose (CMC), while the M44-11 also exhibited a wider pH tolerance and higher thermostability. Structural models of M44-11, S75, S78, and WT proteins revealed that most of the substitutions were not located in the strictly conserved regions, except the mutation V255A of S75, which was closed to the nucleophile Glu257 in the catalytic center of the enzyme. Moreover, V74A and D272G of M44-11, which were not located in the substrate binding sites and the catalytic center, might result in improved stability and catalytic activity. These results provided useful references for directed evolution of the enzymes that belonged to the glycoside hydrolase family 5 (GH5).
|
119. |
Ying CW,
Scoffone F,
Albertini AM,
Galizzi A,
Ordal GW,
( 1991 ) Properties of the Bacillus subtilis chemotaxis protein CheF, a homolog of the Salmonella typhimurium flagellar protein FliJ. PMID : 1904439 : DOI : 10.1128/jb.173.11.3584-3586.1991 PMC : PMC207976 Abstract >>
The nucleotide sequence of Bacillus subtilis cheF was corrected. It encodes an 18-kDa protein that is homologous to FliJ, a protein required for formation of basal bodies in Escherichia coli and Salmonella typhimurium. Methanol release is abnormal in cheF mutants, suggesting that the morphology and functioning of the motor affects methanol formation.
|
120. |
Wang Y,
Yuan H,
Wang J,
Yu Z,
( 2009 ) Truncation of the cellulose binding domain improved thermal stability of endo-beta-1,4-glucanase from Bacillus subtilis JA18. PMID : 18632263 : DOI : 10.1016/j.biortech.2008.06.001 Abstract >>
The C-terminus region of endo-beta-glucanase Egl499 from Bacillus subtilis JA18 was suggested to be a putative family 3 cellulose-binding domain (CBD) by computer analysis. To prove this proposal, C-terminus truncation mutant Egl330 was constructed and expressed. Compared with Egl499, Egl330 lost the cellulose binding capability at 4 degrees C, confirming the C-terminus region was a CBD. Binding of the CBD to Avicel was inhibited by carboxymethylcellulose (CMC), but not by barley beta-glucan and glucose at concentration of 0.1% and 0.5%. Kinetic analysis showed both the turnover rate (k(cat)) and the catalytic efficiency (k(cat)/K(m)) of Egl330 increased for the substrate CMC compared to Egl499. A great improvement in thermal stability was observed in Egl330. The half life of Egl330 at 65 degrees C increased to three folds that of Egl499, from 10 to 29 min. After treated at 80 degrees C for 10 min, Egl330 could recover more than 60% of its original activity while Egl499 only recovered 12% activity. UV spectrometry analysis showed Egl330 and Egl499 differed in refolding efficiency after heat treatment.
|
121. |
Almog O,
González A,
Godin N,
de Leeuw M,
Mekel MJ,
Klein D,
Braun S,
Shoham G,
Walter RL,
( 2009 ) The crystal structures of the psychrophilic subtilisin S41 and the mesophilic subtilisin Sph reveal the same calcium-loaded state. PMID : 18655058 : DOI : 10.1002/prot.22175 Abstract >>
We determine and compare the crystal structure of two proteases belonging to the subtilisin superfamily: S41, a cold-adapted serine protease produced by Antarctic bacilli, at 1.4 A resolution and Sph, a mesophilic serine protease produced by Bacillus sphaericus, at 0.8 A resolution. The purpose of this comparison was to find out whether multiple calcium ion binding is a molecular factor responsible for the adaptation of S41 to extreme low temperatures. We find that these two subtilisins have the same subtilisin fold with a root mean square between the two structures of 0.54 A. The final models for S41 and Sph include a calcium-loaded state of five ions bound to each of these two subtilisin molecules. None of these calcium-binding sites correlate with the high affinity known binding site (site A) found for other subtilisins. Structural analysis of the five calcium-binding sites found in these two crystal structures indicate that three of the binding sites have two side chains of an acidic residue coordinating the calcium ion, whereas the other two binding sites have either a main-chain carbonyl, or only one acidic residue side chain coordinating the calcium ion. Thus, we conclude that three of the sites are of high affinity toward calcium ions, whereas the other two are of low affinity. Because Sph is a mesophilic subtilisin and S41 is a psychrophilic subtilisin, but both crystal structures were found to bind five calcium ions, we suggest that multiple calcium ion binding is not responsible for the adaptation of S41 to low temperatures.
|
122. |
Pang AS,
Nathoo S,
Wong SL,
( 1991 ) Cloning and characterization of a pair of novel genes that regulate production of extracellular enzymes in Bacillus subtilis. PMID : 1898926 : DOI : 10.1128/jb.173.1.46-54.1991 PMC : PMC207154 Abstract >>
Two novel Bacillus subtilis genes that regulate the production of several extracellular enzymes were clones and characterized. These two genes are organized as part of an operon. When cloned in a multicopy plasmid, the first gene (tenA, transcription enhancement) stimulates alkaline protease production at the transcriptional level. The second gene (tenI) exerts an opposite effect to reduce alkaline protease production. The production of neutral protease, levansucrase, and alkaline protease can be stimulated up to 11- to 55-fold. Thus, tenA is a new member of the deg (regulatory genes for degradative enzymes) family in B. subtilis. A functional degS product is required to observe the stimulatory effect from tenA. Between the promoter and the ribosome-binding site of tenA, there exists a terminatorlike structure. Deletion of this structure doubles the expression of tenA. Neither tenA nor tenI is essential for cell growth and the production of extracellular enzymes. However, inactivation of these genes causes a delay in sporulation. This operon is located close to tre on the genetic linkage map. The overall organization of this operon and its relationship with other known regulatory factors in the deg family are discussed.
|
123. |
Reddy VA,
Venu K,
Rao DE,
Rao KV,
Reddy VD,
( 2009 ) Chimeric gene construct coding for bi-functional enzyme endowed with endoglucanase and phytase activities. PMID : 18987844 : DOI : 10.1007/s00203-008-0437-8 Abstract >>
Phytase and endoglucanase enzymes are being widely used as feed additives in poultry industry. In our earlier studies, the Bacillus phytase, when expressed in Escherichia coli, was found in inclusion bodies, whereas endoglucanase was found in active soluble form. Herein, we report the development of a chimeric gene construct coding for ~73 kDa fusion protein and its over-expression in E. coli in soluble form. The novel enzyme exhibited both endoglucanase and phytase activities across broad pH (4.0-8.0) and temperature (25-75 degrees C) ranges. As such, the bi-functional enzyme seems promising and might serve as a potential feed additive for enhanced nutrition uptake in monogastric animals.
|
124. |
Li W,
Zhang WW,
Yang MM,
Chen YL,
( 2008 ) Cloning of the thermostable cellulase gene from newly isolated Bacillus subtilis and its expression in Escherichia coli. PMID : 18576142 : DOI : 10.1007/s12033-008-9079-y Abstract >>
A bacterial strain with high cellulase activity (0.26 U/ml culture medium) was isolated from hot spring, and classified and named as B. subtilis DR by morphological and 16SrDNA gene sequence analysis. A thermostable endocellulase, CelDR, was purified from the isolated strain. The optimum temperature of the enzyme reaction was 50 degrees C, and CelDR retained 70% of its maximum activity at 75 degrees C after incubation for 30 min. The putative gene celDR, consisting an open reading frame (ORF) of 1,524 nucleotides and encoding a protein of 508 amino acids with a molecular weight of 55 kDa, was purified from B. subtilis DR and cloned into pET-28a for expression. The cellulase production in E. coli BL21 (DE3) was enhanced to approximately three times that of the wild-type strain.
|
125. |
Blair KM,
Turner L,
Winkelman JT,
Berg HC,
Kearns DB,
( 2008 ) A molecular clutch disables flagella in the Bacillus subtilis biofilm. PMID : 18566286 : DOI : 10.1126/science.1157877 Abstract >>
Biofilms are multicellular aggregates of sessile bacteria encased by an extracellular matrix and are important medically as a source of drug-resistant microbes. In Bacillus subtilis, we found that an operon required for biofilm matrix biosynthesis also encoded an inhibitor of motility, EpsE. EpsE arrested flagellar rotation in a manner similar to that of a clutch, by disengaging motor force-generating elements in cells embedded in the biofilm matrix. The clutch is a simple, rapid, and potentially reversible form of motility control.
|
126. |
Joshi R,
McSpadden Gardener BB,
( 2006 ) Identification and Characterization of Novel Genetic Markers Associated with Biological Control Activities in Bacillus subtilis. PMID : 18943917 : DOI : 10.1094/PHYTO-96-0145 Abstract >>
ABSTRACT Suppressive subtractive hybridization (SSH) was used to identify genetic markers associated with biological control of plant pathogens by Bacillus subtilis. The genomes of two commercialized strains, GB03 and QST713, were compared with that of strain 168, which has no defined biocontrol capacities, to obtain a pool of DNA fragments unique to the two biocontrol strains. The sequences of 149 subtracted fragments were determined and compared with those present in GenBank, but only 80 were found to correspond to known Bacillus genes. Of these, 65 were similar to genes with a wide range of metabolic functions, including the biosynthesis of cell wall components, sporulation, and antibiotic biosynthesis. Sixteen subtracted fragments shared a high degree of similarity to sequences found in multiple B. subtilis strains with proven biocontrol capacities. Oligonucleotide primers specific to nine of these genes were developed. The targeted genes included five genes involved in antibiotic synthesis (bmyB, fenD, ituC,srfAA, and srfAB) and four additional genes (yndJ, yngG, bioA, and a hypothetical open reading frame) not previously associated with biological control. All nine markers were amplified from the commercialized B. subtilis strains GB03, QST713, and MBI600, with the exception of ituC, which was not detected in GB03. The markers also were amplified from four other B. subtilis isolates, but they were not amplified from other related Bacillus strains, including the plant growth-promoting rhizobacteria IN937a and IN937b. Sequencing of the amplified markers revealed that all seven of the isolates that scored positive for multiple markers were genotypically distinct strains. Interestingly, strains scored positive for the amplifiable markers generally were more effective at inhibiting the growth of Rhizoctonia solani and Pythium ultimum than other Bacillus isolates that lacked the markers. The potential utility of the defined genetic markers to further define the diversity, ecology, and biocontrol activities of B. subtilis are discussed.
|
127. |
Chung S,
Kong H,
Buyer JS,
Lakshman DK,
Lydon J,
Kim SD,
Roberts DP,
( 2008 ) Isolation and partial characterization of Bacillus subtilis ME488 for suppression of soilborne pathogens of cucumber and pepper. PMID : 18542950 : DOI : 10.1007/s00253-008-1520-4 Abstract >>
Environmentally friendly control measures are needed for suppression of soilborne pathogens of vegetable crops in the Republic of Korea. In vitro challenge assays were used to screen approximately 500 bacterial isolates from 20 Korean greenhouse soils for inhibition of diverse plant pathogens. One isolate, Bacillus subtilis ME488, suppressed the growth of 39 of 42 plant pathogens tested. Isolate ME488 also suppressed the disease caused by Fusarium oxysporum f. sp. cucumerinum on cucumber and Phytophthora capsici on pepper in pot assays. Polymerase chain reaction was used to screen isolate ME488 for genes involved in biosynthesis of 11 antibiotics produced by various isolates of B. subtilis. Amplicons of the expected sizes were detected for bacD and bacAB, ituC and ituD, and mrsA and mrsM involved in the biosynthesis of bacilysin, iturin, and mersacidin, respectively. The identity of these genes was confirmed by DNA sequence analysis of the amplicons. Bacilysin and iturin were detected in culture filtrates from isolate ME488 by gas chromatography coupled with mass spectroscopy and by thin layer chromatography, respectively. Detection of mersacidin in ME488 culture filtrates was not attempted. Experiments reported here indicate that B. subtilis ME488 has potential for biological control of pathogens of cucumber and pepper possibly due to the production of antibiotics.
|
128. |
Farhat A,
Chouayekh H,
Ben Farhat M,
Bouchaala K,
Bejar S,
( 2008 ) Gene cloning and characterization of a thermostable phytase from Bacillus subtilis US417 and assessment of its potential as a feed additive in comparison with a commercial enzyme. PMID : 18543132 : DOI : 10.1007/s12033-008-9068-1 Abstract >>
An extracellular phytase from Bacillus subtilis US417 (PHY US417) was purified and characterized. The purified enzyme of 41 kDa was calcium-dependent and optimally active at pH 7.5 and 55 degrees C. The thermal stability of PHY US417 was drastically improved by calcium. Indeed, it recovered 77% of its original activity after denaturation for 10 min at 75 degrees C in the presence of 5 mM CaCl2, while it retained only 22% of activity when incubated for 10 min at 60 degrees C without calcium. In addition, PHY US417 was found to be highly specific for phytate and exhibited pH stability similar to Phyzyme, a commercial phytase with optimal activity at pH 5.5 and 60 degrees C. The phytase gene was cloned by PCR from Bacillus subtilis US417. Sequence analysis of the encoded polypeptide revealed one residue difference from PhyC of Bacillus subtilis VTTE-68013 (substitution of arginine in position 257 by proline in PHY US417) which was reported to exhibit lower thermostability especially in the absence of calcium. With its neutral pH optimum as well as its great pH and thermal stability, the PHY US417 enzyme presumed to be predominantly active in the intestine has a high potential for use as feed additive.
|
129. |
Yan XX,
An XM,
Gui LL,
Liang DC,
( 2008 ) From structure to function: insights into the catalytic substrate specificity and thermostability displayed by Bacillus subtilis mannanase BCman. PMID : 18455734 : DOI : 10.1016/j.jmb.2008.03.068 Abstract >>
BCman, a beta-mannanase from the plant root beneficial bacterium Bacillus subtilis Z-2, has a potential to be used in the production of mannooligosaccharide, which shows defense induction activity on both melon and tobacco, and plays an important role in the biological control of plant disease. Here we report the biochemical properties and crystal structure of BCman-GH26 enzyme. Kinetic analysis reveals that BCman is an endo-beta-mannanase, specific for mannan, and has no activity on mannooligosaccharides. The catalytic acid/base Glu167 and nucleophile Glu266 are positioned on the beta4 and beta7 strands, respectively. The 1.45-A crystal structure reveals that BCman is a typical (beta/alpha)(8) folding type. One large difference from the saddle-shaped active center of other endo-beta-mannanases is the presence of a shallow-dish-shaped active center and substrate-binding site that are both unique to BCman. These differences are mainly due to important changes in the length and position of loop 1 (Phe37-Met47), loop 2 (Ser103-Ala134), loop3 (Phe162-Asn185), loop 4 (Tyr215-Ile236), loop 5 (Pro269-Tyr278), and loop 6 (Trp298-Gly309), all of which surround the active site. Data from isothermal titration calorimetry and crystallography indicated only two substrate-binding subsites (+1 and -1) within the active site of BCman. These two sites are involved in the enzyme's mannan degradation activity and in restricting the binding capacity for mannooligosaccharides. Binding and catalysis of BCman to mannan is mediated mainly by a surface containing a strip of solvent-exposed aromatic rings of Trp302, Trp298, Trp172, and Trp72. Additionally, BCman contains a disulfide bond (Cys66Cys86) and a special His1-His23-Glu336 metal-binding site. This secondary structure is a key factor in the enzyme's stability.
|
130. |
Felici C,
Vettori L,
Toffanin A,
Nuti M,
( 2008 ) Development of a strain-specific genomic marker for monitoring a Bacillus subtilis biocontrol strain in the rhizosphere of tomato. PMID : 18462399 : DOI : 10.1111/j.1574-6941.2008.00489.x Abstract >>
A strain-specific molecular marker enabling the detection and tracking of the biological control agent Bacillus subtilis 101, when released into the environment, was developed. Random amplified polymorphic DNA (RAPD) technique was used to differentiate this from other B. subtilis strains. A differentially amplified fragment obtained from RAPD profiles was sequenced and characterized as sequence-characterized amplified region (SCAR) marker, and four primer pairs were designed and evaluated for their specificity towards this strain. The sensibility of the selected SCAR primer pair was evaluated by qualitative PCR and Southern blotting, and the detection limit was assessed around 10(2) CFU (g dry wt soil)(-1), thus providing a reliable tool for the traceability of this B. subtilis strain in greenhouse or field trials. A plating assay coupled to PCR with the SCAR primer pair was then used as a detection method in microcosm experiments for monitoring the population of B. subtilis 101 in the rhizosphere of tomato, grown under two different soil conditions, i.e. nonsterile peat-based substrate and sandy-loam agricultural soil, respectively. The data of rhizosphere colonization indicated that the soil conditions significantly affected the rhizosphere establishment of strain 101.
|
131. |
Zeigler DR,
Prágai Z,
Rodriguez S,
Chevreux B,
Muffler A,
Albert T,
Bai R,
Wyss M,
Perkins JB,
( 2008 ) The origins of 168, W23, and other Bacillus subtilis legacy strains. PMID : 18723616 : DOI : 10.1128/JB.00722-08 PMC : PMC2580678 Abstract >>
Bacillus subtilis is both a model organism for basic research and an industrial workhorse, yet there are major gaps in our understanding of the genomic heritage and provenance of many widely used strains. We analyzed 17 legacy strains dating to the early years of B. subtilis genetics. For three--NCIB 3610T, PY79, and SMY--we performed comparative genome sequencing. For the remainder, we used conventional sequencing to sample genomic regions expected to show sequence heterogeneity. Sequence comparisons showed that 168, its siblings (122, 160, and 166), and the type strains NCIB 3610 and ATCC 6051 are highly similar and are likely descendants of the original Marburg strain, although the 168 lineage shows genetic evidence of early domestication. Strains 23, W23, and W23SR are identical in sequence to each other but only 94.6% identical to the Marburg group in the sequenced regions. Strain 23, the probable W23 parent, likely arose from a contaminant in the mutagenesis experiments that produced 168. The remaining strains are all genomic hybrids, showing one or more "W23 islands" in a 168 genomic backbone. Each traces its origin to transformations of 168 derivatives with DNA from 23 or W23. The common prototrophic lab strain PY79 possesses substantial W23 islands at its trp and sac loci, along with large deletions that have reduced its genome 4.3%. SMY, reputed to be the parent of 168, is actually a 168-W23 hybrid that likely shares a recent ancestor with PY79. These data provide greater insight into the genomic history of these B. subtilis legacy strains.
|
132. |
Castiglioni S,
Pomati F,
Miller K,
Burns BP,
Zuccato E,
Calamari D,
Neilan BA,
( 2008 ) Novel homologs of the multiple resistance regulator marA in antibiotic-contaminated environments. PMID : 18771790 : DOI : 10.1016/j.watres.2008.07.004 Abstract >>
Antibiotics are commonly detected in the environment as contaminants. Exposure to antibiotics may induce antimicrobial-resistance, as well as the horizontal transfer of resistance genes in bacterial populations. We selected the resistance gene marA, mediating resistance to multiple antibiotics, and explored its distribution in sediment and water samples from surface and sewage treatment waters. Ciprofloxacin and ofloxacin (fluoroquinolones), sulphamethoxazole (sulphonamide), erythromycin, clarythromycin, and spiramycin (macrolides), lincomycin (lincosamide), and oxytetracycline (tetracycline) were measured in the same samples to determine antibiotic contamination. Bacterial populations from environmental samples were challenged with antibiotics to identify resistant isolates. The gene marA was found in almost all environmental samples and was confirmed by PCR amplification in antibiotic-resistant colonies. 16S rDNA sequencing revealed that the majority of resistant isolates belonged to the Gram-positive genus Bacillus, not previously known to possess the regulator marA. We assayed the incidence of marA in environmental bacterial populations of Escherichia coli and Bacillus by quantitative real-time PCR in correlation with the levels of antibiotics. Phylogenetic analysis indicated the possible lateral acquisition of marA by Bacillus from Gram-negative Enterobacteriaceae revealing a novel marA homolog in Bacillus. Quantitative PCR assays indicate that the frequency of this gene in antropised environments seems to be related to bacterial exposure to water-borne antibiotics.
|
133. |
Pottathil M,
Jung A,
Lazazzera BA,
( 2008 ) CSF, a species-specific extracellular signaling peptide for communication among strains of Bacillus subtilis and Bacillus mojavensis. PMID : 18375560 : DOI : 10.1128/JB.00187-08 PMC : PMC2395031 Abstract >>
ComX and CSF are Bacillus subtilis extracellular signaling peptides. Many different strains of B. subtilis do not communicate due to strain-specific variation of ComX. We demonstrate that CSF is a species-specific signaling molecule that partially compensates for the lack of ComX-mediated communication between different strains of B. subtilis.
|
134. |
Qiao J,
Dong B,
Li Y,
Zhang B,
Cao Y,
( 2009 ) Cloning of a beta-1,3-1,4-glucanase gene from Bacillus subtilis MA139 and its functional expression in Escherichia coli. PMID : 18365147 : DOI : 10.1007/s12010-008-8193-4 Abstract >>
A gene encoding beta-1,3-1,4-glucanase was cloned by polymerase chain reaction (PCR) from Bacillus subtilis MA139. Sequencing result showed 97% homology to the corresponding gene from Bacillus licheniformis. The open reading frame (ORF) of the gene contained 690 bp coding for a 226 amino-acid matured protein with the estimated molecular weight of 24.44 kDa. The beta-1,3-1,4-glucanase gene was subcloned into an expression vector of pET28a and expressed in Escherichia coli BL21 and then purified by metal affinity chromatography using a nickel-nitrilotriacetic acid (Ni-NTA) column. The purified beta-1,3-1,4-glucanase demonstrated 24.05 and 12.52 U ml(-1) activities for the substrates of barley beta-glucan and lichenan, respectively, and the specific activities were 728.79 and 379.1 U mg(-1) for them, respectively. The optimal temperature and pH of the purified enzyme were 40 degrees C and 6.4, respectively. When barley beta-glucan was used as the substrate, K (m) was 5.34 mg ml(-1), and K (cat) showed 7,206.71 S(-1), thus the ratio of K (cat) and K (m) was 1,349.67 ml s(-1) mg(-1). The activity of beta-1,3-1,4-glucanase was affected by a range of metal ions or ethylenediaminetetraacetic acid (EDTA).
|
135. |
Koeppel A,
Perry EB,
Sikorski J,
Krizanc D,
Warner A,
Ward DM,
Rooney AP,
Brambilla E,
Connor N,
Ratcliff RM,
Nevo E,
Cohan FM,
( 2008 ) Identifying the fundamental units of bacterial diversity: a paradigm shift to incorporate ecology into bacterial systematics. PMID : 18272490 : DOI : 10.1073/pnas.0712205105 PMC : PMC2268166 Abstract >>
The central questions of bacterial ecology and evolution require a method to consistently demarcate, from the vast and diverse set of bacterial cells within a natural community, the groups playing ecologically distinct roles (ecotypes). Because of a lack of theory-based guidelines, current methods in bacterial systematics fail to divide the bacterial domain of life into meaningful units of ecology and evolution. We introduce a sequence-based approach ("ecotype simulation") to model the evolutionary dynamics of bacterial populations and to identify ecotypes within a natural community, focusing here on two Bacillus clades surveyed from the "Evolution Canyons" of Israel. This approach has identified multiple ecotypes within traditional species, with each predicted to be an ecologically distinct lineage; many such ecotypes were confirmed to be ecologically distinct, with specialization to different canyon slopes with different solar exposures. Ecotype simulation provides a long-needed natural foundation for microbial ecology and systematics.
|
136. |
Pan J,
Huang T,
Yao F,
Huang Z,
Powell CA,
Qiu S,
Guan X,
( 2008 ) Expression and characterization of aiiA gene from Bacillus subtilis BS-1. PMID : 18261893 : DOI : 10.1016/j.micres.2007.12.002 Abstract >>
AHL-lactonase (AiiA), a metallo-beta-lactamase produced by Bacillus thuringiensis, Bacillus cereus and Bacillus anthracis, specifically hydrolyzes N-acyl-homoserine lactones (AHLs) secreted by Gram-negative bacteria and thereby attenuates the symptoms caused by plant pathogens. In this study, an aiiA gene was cloned from Bacillus subtilis BS-1 by PCR with a pair of degenerate primers. The deduced 250 amino acid sequence contained two small conserved regions, 103SHLHFDH109 and 166TPGHTPGH173, which are characteristic of the metallo-beta-lactamase family. Homology comparison revealed that the deduced amino acid sequence had a high degree of similarity with those of the known AiiA proteins in the B. cereus group. Additionally, the aiiA gene was expressed in Escherichia coli BL21 (DE3) pLysS and the expressed AiiA protein could attenuate the soft rot symptoms caused by Erwinia carotovora var. carotovora.
|
137. |
Meerak J,
Iida H,
Watanabe Y,
Miyashita M,
Sato H,
Nakagawa Y,
Tahara Y,
( 2007 ) Phylogeny of gamma-polyglutamic acid-producing Bacillus strains isolated from fermented soybean foods manufactured in Asian countries. PMID : 18187886 : Abstract >>
Natto-like fermented soybean products are manufactured and consumed in many Asian countries. In this study, we isolated thirty-four Bacillus strains capable of producing gamma-polyglutamic acid (PGA) from natto in mountainous areas of South Asia and Southeast Asia and from soils in Japan. To elucidate the phylogeny of these PGA-producing strains, phylogenetic trees based on sequences of 16S rDNA, housekeeping genes of rpoB (RNA polymerase beta-subunit) and fus (elongation factor G) were constructed. A phylogenetic tree based on 16S rDNA sequences showed that twenty-one isolates were clustered in the same group of B. subtilis. The other thirteen isolates were located in the cluster of B. amyloliquefaciens. Phylogenetic trees based on the partial sequences of rpoB and fus genes were similar to the phylogeny based on 16S rDNA sequences. The results of the present study indicate that PGA-producing strains isolated from local natto in Asian countries and soil in Japan can be divided into two species, B. subtilis and B. amyloliquefaciens.
|
138. |
Albertini AM,
Caramori T,
Crabb WD,
Scoffone F,
Galizzi A,
( 1991 ) The flaA locus of Bacillus subtilis is part of a large operon coding for flagellar structures, motility functions, and an ATPase-like polypeptide. PMID : 1828465 : DOI : 10.1128/jb.173.11.3573-3579.1991 PMC : PMC207974 Abstract >>
We cloned and sequenced 8.3 kb of Bacillus subtilis DNA corresponding to the flaA locus involved in flagellar biosynthesis, motility, and chemotaxis. The DNA sequence revealed the presence of 10 complete and 2 incomplete open reading frames. Comparison of the deduced amino acid sequences to data banks showed similarities of nine of the deduced products to a number of proteins of Escherichia coli and Salmonella typhimurium for which a role in flagellar functioning has been directly demonstrated. In particular, the sequence data suggest that the flaA operon codes for the M-ring protein, components of the motor switch, and the distal part of the basal-body rod. The gene order is remarkably similar to that described for region III of the enterobacterial flagellar regulon. One of the open reading frames was translated into a protein with 48% amino acid identity to S. typhimurium FliI and 29% identity to the beta subunit of E. coli ATP synthase.
|
139. |
Huck JR,
Woodcock NH,
Ralyea RD,
Boor KJ,
( 2007 ) Molecular subtyping and characterization of psychrotolerant endospore-forming bacteria in two New York State fluid milk processing systems. PMID : 17969618 : DOI : 10.4315/0362-028x-70.10.2354 Abstract >>
Psychrotolerant endospore-forming bacteria Bacillus and Paenibacillus spp. are important spoilage organisms in fluid milk. A recently developed rpoB subtyping method was applied to characterize the diversity and phylogenetic relationships among Bacillus and related sporeformers associated with milk processing systems. Milk samples representing the processing continuum from raw milk to pasteurized products were collected from two fluid milk processing plants, held at 6 degrees C up to the code date that had been established by each processing plant (i.e., either 18 or 21 days), and plated for bacterial enumeration throughout storage. Bacterial colonies selected to represent the visible diversity in colony morphology on enumeration plates were examined further. Among 385 bacterial isolates characterized, 35% were Bacillus spp., and 65% were Paenibacillus spp. A total of 92 rpoB allelic types were identified among these isolates, indicating considerable diversity among endospore-forming spoilage organisms present in fluid milk systems. Of the 92 allelic types identified, 19 were isolated from samples collected from both processing plants. The same rpoB allelic types were frequently identified in paired raw milk and packaged product samples, indicating that Bacillus and Paenibacillus spp. can enter dairy processing systems through raw milk. Certain subtypes were found exclusively in pasteurized samples, including those that were temporally independent, suggesting the possibility of in-plant sources for these spoilage organisms, including through the persistence of selected subtypes in processing plants. Development of effective control strategies for the diverse array of psychrotolerant endospore-forming organisms that currently limit the shelf lives of high-temperature short-time fluid milk products will require comprehensive, integrated efforts along the entire milk processing continuum.
|
140. |
Liang X,
Jia S,
Sun Y,
Chen M,
Chen X,
Zhong J,
Huan L,
( 2007 ) Secretory expression of nattokinase from Bacillus subtilis YF38 in Escherichia coli. PMID : 17952663 : DOI : 10.1007/s12033-007-0060-y Abstract >>
Nattokinase producing bacterium, B. subtilis YF38, was isolated from douchi, using the fibrin plate method. The gene encoding this enzyme was cloned by polymerase chain reaction (PCR). Cytoplasmic expression of this enzyme in E. coli resulted in inactive inclusion bodies. But with the help of two different signal peptides, the native signal peptide of nattokinase and the signal peptide of PelB, active nattokinase was successfully expressed in E. coli with periplasmic secretion, and the nattokinase in culture medium displayed high fibrinolytic activity. The fibrinolytic activity of the expressed enzyme in the culture was determined to reach 260 urokinase units per micro-liter when the recombinant strain was induced by 0.7 mmol l(-1) isopropyl-beta-D- thiogalactopyranoside (IPTG) at 20 degrees C for 20 h, resulting 49.3 mg active enzyme per liter culture. The characteristic of this recombinant nattokinase is comparable to the native nattokinase from B. subtilis YF38. Secretory expression of nattokinase in E. coli would facilitate the development of this enzyme into a therapeutic product for the control and prevention of thrombosis diseases.
|
141. |
Banerjee S,
Hansen JN,
( 1988 ) Structure and expression of a gene encoding the precursor of subtilin, a small protein antibiotic. PMID : 2837490 : Abstract >>
A gene has been cloned from Bacillus subtilis ATCC 6633 that encodes a 56-residue peptide precursor for the 32-residue peptide antibiotic, subtilin. The precursor contains serines, threonines, and cysteines at positions that permit them to undergo a series of dehydration and cross-linking steps to give the mature antibiotic peptide which contains the unusual amino acids lanthionine, beta-methyllanthionine, D-alanine, dehydroalanine, and dehydrobutyrine. The precursor peptide contains a leader region that has an unusual hydropathic character for an exported protein. The subtilin gene is expressed from a monocistronic transcriptional unit as identified by S1 mapping of the gene transcript. The (-35) region of the promoter is not typical of Bacillus subtilis vegetatively-expressed genes. The subtilin transcript was present in very low amounts during exponential growth, but in large amounts during stationary phase; at which time mature subtilin peptide and antibiotic activity were also observed. The subtilin transcript contains a cleavage-sensitive region that overlaps the ribosome binding site. The primary transcript has an unusually long half-life of about 45 min. These observations confirm that subtilin is derived from a small protein that is synthesized on ribosomes.
|
142. |
Vosman B,
Kuiken G,
Kooistra J,
Venema G,
( 1988 ) Transformation in Bacillus subtilis: involvement of the 17-kilodalton DNA-entry nuclease and the competence-specific 18-kilodalton protein. PMID : 2841296 : DOI : 10.1128/jb.170.8.3703-3710.1988 PMC : PMC211348 Abstract >>
A protein complex, consisting of a 17-kilodalton (kDa) nuclease and an 18-kDa protein, is believed to be involved in the binding and entry of donor DNA during transformation of Bacillus subtilis (H. Smith, K. Wiersman, S. Bron, and G. Venema, J. Bacteriol. 156:101-108, 1983). In this paper, the nucleotide sequences of the genes encoding both the nuclease and the 18-kDa protein are presented. The genes are encoded by a 904-base-pair PstI-HindIII fragment. The open reading frames encoding both proteins are partly overlapping. A B. subtilis mutant was constructed by insertion of a Cmr marker into the gene encoding the nuclease. This mutant lacked the competence-specific nuclease activity and the 18-kDa protein but retained 5% residual transformation. The total DNA association of the mutant was higher than that of the wild-type cells, and DNA entry was reduced to 30% of the wild-type level. These results suggest that an alternative pathway exists for the internalization of transforming DNA. A mutant, exclusively deficient for the 18-kDa protein, previously suggested to be involved in the binding of transforming DNA, was constructed by insertion of a kanamycin resistance gene into the coding sequence of the gene. Since the mutant showed wild-type DNA-binding activity, the 18-kDa protein is probably not involved in the binding of donor DNA to competent cells. The transforming activity of the mutant was reduced to 25% of the wild-type level, indicating that the 18-kDa protein has a function in the transformation process. In vitro experiments showed that the 18-kDa protein is capable of inhibiting the activity of the competence-specific nuclease. Its possible role in transformation is discussed.
|
143. |
Okai M,
Lee WC,
Guan LJ,
Ohshiro T,
Izumi Y,
Tanokura M,
( 2017 ) Crystal structure of dibenzothiophene sulfone monooxygenase BdsA from Bacillus subtilis WU-S2B. PMID : 28205250 : DOI : 10.1002/prot.25267 Abstract >>
The dibenzothiophene (DBT) sulfone monooxygenase BdsA from Bacillus subtilis WU-S2B catalyzes the conversion of DBT sulfone to 2'-hydroxybiphenyl 2-sulfinate. We report the crystal structures of BdsA at a resolution of 2.80 ?. BdsA exists as a homotetramer with a dimer-of-dimers configuration in the crystal, and the interaction between E288 and R296 in BdsA is important for tetramer formation. A structural comparison with homologous proteins shows that the orientation and location of the �\9-�\12 helices in BdsA are closer to those of the closed form than those of the open form in the EDTA monooxygenase EmoA. Proteins 2017; 85:1171-1177. ? 2017 Wiley Periodicals, Inc.
|
144. |
Luo Z,
Miao J,
Li G,
Du Y,
Yu X,
( 2017 ) A Recombinant Highly Thermostable �]-Mannanase (ReTMan26) from Thermophilic Bacillus subtilis (TBS2) Expressed in Pichia pastoris and Its pH and Temperature Stability. PMID : 28101787 : DOI : 10.1007/s12010-017-2397-4 Abstract >>
A gene encoding a highly thermostable �]-mannanase from a thermophilic Bacillus subtilis (TBS2) was successfully expressed in Pichia pastoris. The maximum activity of the recombinant thermostable �]-mannanase (ReTMan26) was 5435 U/mL, which was obtained by high-density, fed-batch cultivation after 168-h induction with methanol in a 50-L bioreactor. The protein yield reached 3.29 mg/mL, and the protein had a molecular weight of ~42 kDa. After fermentation, ReTMan26 was purified using a 10-kDa cut-off membrane and Sephadex G-75 column. The pH and temperature optima of purified ReTMan26 were pH 6.0 and 60 �XC, respectively, and the enzyme was stable at pH 2.0-8.0 and was active at 20-100 �XC. HPLC analysis of the products of locust bean gum hydrolysis showed that the mannan-oligosaccharide content was 62.5%. ReTMan26 retained 58.6% of its maximum activity after treatment at 100 �XC for 10 min, which was higher than any other �]-mannanase reported up to now, suggesting its potential for industrial applications.
|
145. |
Zalila-Kolsi I,
Ben Mahmoud A,
Ali H,
Sellami S,
Nasfi Z,
Tounsi S,
Jamoussi K,
( 2016 ) Antagonist effects of Bacillus spp. strains against Fusarium graminearum for protection of durum wheat (Triticum turgidum L. subsp. durum). PMID : 27664733 : DOI : 10.1016/j.micres.2016.06.012 Abstract >>
Bacillus species are attractive due to their potential use in the biological control of fungal diseases. Bacillus amyloliquefaciens strain BLB369, Bacillus subtilis strain BLB277, and Paenibacillus polymyxa strain BLB267 were isolated and identified using biochemical and molecular (16S rDNA, gyrA, and rpoB) approaches. They could produce, respectively, (iturin and surfactin), (surfactin and fengycin), and (fusaricidin and polymyxin) exhibiting broad spectrum against several phytopathogenic fungi. In vivo examination of wheat seed germination, plant height, phenolic compounds, chlorophyll, and carotenoid contents proved the efficiency of the bacterial cells and the secreted antagonist activities to protect Tunisian durum wheat (Triticum turgidum L. subsp. durum) cultivar Om Rabiia against F. graminearum fungus. Application of single bacterial culture medium, particularly that of B. amyloliquefaciens, showed better protection than combinations of various culture media. The tertiary combination of B. amyloliquefaciens, B. subtilis, and P. polymyxa bacterial cells led to the highest protection rate which could be due to strains synergistic or complementary effects. Hence, combination of compatible biocontrol agents could be a strategic approach to control plant diseases.
|
146. |
Menon BR,
Latham J,
Dunstan MS,
Brandenburger E,
Klemstein U,
Leys D,
Karthikeyan C,
Greaney MF,
Shepherd SA,
Micklefield J,
( 2016 ) Structure and biocatalytic scope of thermophilic flavin-dependent halogenase and flavin reductase enzymes. PMID : 27714222 : DOI : 10.1039/c6ob01861k Abstract >>
Flavin-dependent halogenase (Fl-Hal) enzymes have been shown to halogenate a range of synthetic as well as natural aromatic compounds. The exquisite regioselectively of Fl-Hal enzymes can provide halogenated building blocks which are inaccessible using standard halogenation chemistries. Consequently, Fl-Hal are potentially useful biocatalysts for the chemoenzymatic synthesis of pharmaceuticals and other valuable products, which are derived from haloaromatic precursors. However, the application of Fl-Hal enzymes, in vitro, has been hampered by their poor catalytic activity and lack of stability. To overcome these issues, we identified a thermophilic tryptophan halogenase (Th-Hal), which has significantly improved catalytic activity and stability, compared with other Fl-Hal characterised to date. When used in combination with a thermostable flavin reductase, Th-Hal can efficiently halogenate a number of aromatic substrates. X-ray crystal structures of Th-Hal, and the reductase partner (Th-Fre), provide insights into the factors that contribute to enzyme stability, which could guide the discovery and engineering of more robust and productive halogenase biocatalysts.
|
147. |
Bia?kowska AM,
J?drzejczak-Krzepkowska M,
Gromek E,
Krysiak J,
Sikora B,
Kalinowska H,
Kubik C,
Schütt F,
Turkiewicz M,
( 2016 ) Effects of genetic modifications and fermentation conditions on 2,3-butanediol production by alkaliphilic Bacillus subtilis. PMID : 26590588 : DOI : 10.1007/s00253-015-7164-2 Abstract >>
Two recombinants of alkaliphilic Bacillus subtilis LOCK 1086, constructed via different strategies such as cloning the gene encoding bacterial hemoglobin from Vitreoscilla stercoraria (vhb) and overexpression of the gene encoding acetoin reductase/2,3-butanediol dehydrogenase (bdhA) from B. subtilis LOCK 1086, did not produce more 2,3-butanediol (2,3-BD) than the parental strain. In batch fermentations, this strain synthesized 9.46 g/L in 24 h and 12.80 g/L 2,3-BD in 46 h from sugar beet molasses and an apple pomace hydrolysate, respectively. 2,3-BD production by B. subtilis LOCK 1086 was significantly enhanced in fed-batch fermentations. The highest 2,3-BD concentration (75.73 g/L in 114 h, productivity of 0.66 g/L �� h) was obtained in the sugar beet molasses-based medium with four feedings with glucose. In a medium based on the apple pomace hydrolysate with three feedings with sucrose, B. subtilis LOCK 1086 produced up to 51.53 g/L 2,3-BD (in 120 h, productivity of 0.43 g/L �� h).
|
148. |
Meng D,
Dai M,
Xu BL,
Zhao ZS,
Liang X,
Wang M,
Tang XF,
Tang B,
( 2016 ) Maturation of Fibrinolytic Bacillopeptidase F Involves both Hetero- and Autocatalytic Processes. PMID : 26497454 : DOI : 10.1128/AEM.02673-15 PMC : PMC4702618 Abstract >>
Bacillopeptidase F (Bpr) is a fibrinolytic serine protease produced by Bacillus subtilis. Its precursor is composed of a signal peptide, an N-terminal propeptide, a catalytic domain, and a long C-terminal extension (CTE). Several active forms of Bpr have been previously reported, but little is known about the maturation of this enzyme. Here, a gene encoding a Bpr (BprL) was cloned from B. subtilis LZW and expressed in B. subtilis WB700, and three fibrinolytic mature forms with apparent molecular masses of 45, 75, and 85 kDa were identified in the culture supernatant. After treatment with urea, the 75-kDa mature form had the same molecular mass as the 85-kDa mature form, from which we infer that they adopt different conformations. Mutational analysis revealed that while the 85-kDa mature form is generated via heterocatalytic processing of a BprL proform by an unidentified protease of B. subtilis, the production of the 75- and 45-kDa mature forms involves both hetero- and autocatalytic events. From in vitro analysis of BprL and its sequential C-terminal truncation variants, it appears that partial removal of the CTE is required for the initiation of autoprocessing of the N-terminal propeptide, which is composed of a core domain (N*) and a 15-residue linker peptide, thereby yielding the 45-kDa mature form. These data suggest that the differential processing of BprL, either heterocatalytically or autocatalytically, leads to the formation of multiple mature forms with different molecular masses or conformations.
|
149. |
Stefanic P,
Kraigher B,
Lyons NA,
Kolter R,
Mandic-Mulec I,
( 2015 ) Kin discrimination between sympatric Bacillus subtilis isolates. PMID : 26438858 : DOI : 10.1073/pnas.1512671112 PMC : PMC4653157 Abstract >>
Kin discrimination, broadly defined as differential treatment of conspecifics according to their relatedness, could help biological systems direct cooperative behavior toward their relatives. Here we investigated the ability of the soil bacterium Bacillus subtilis to discriminate kin from nonkin in the context of swarming, a cooperative multicellular behavior. We tested a collection of sympatric conspecifics from soil in pairwise combinations and found that despite their history of coexistence, the vast majority formed distinct boundaries when the swarms met. Some swarms did merge, and most interestingly, this behavior was only seen in the most highly related strain pairs. Overall the swarm interaction phenotype strongly correlated with phylogenetic relatedness, indicative of kin discrimination. Using a subset of strains, we examined cocolonization patterns on plant roots. Pairs of kin strains were able to cocolonize roots and formed a mixed-strain biofilm. In contrast, inoculating roots with pairs of nonkin strains resulted in biofilms consisting primarily of one strain, suggestive of an antagonistic interaction among nonkin strains. This study firmly establishes kin discrimination in a bacterial multicellular setting and suggests its potential effect on ecological interactions.
|
150. |
Bourbouli M,
Katsifas EA,
Papathanassiou E,
Karagouni AD,
( 2015 ) The Kolumbo submarine volcano of Santorini island is a large pool of bacterial strains with antimicrobial activity. PMID : 25627249 : DOI : 10.1007/s00203-015-1086-3 Abstract >>
Microbes in hydrothermal vents with their unique secondary metabolism may represent an untapped potential source of new natural products. In this study, samples were collected from the hydrothermal field of Kolumbo submarine volcano in the Aegean Sea, in order to isolate bacteria with antimicrobial activity. Eight hundred and thirty-two aerobic heterotrophic bacteria were isolated and then differentiated through BOX-PCR analysis at the strain level into 230 genomic fingerprints, which were screened against 13 different type strains (pathogenic and nonpathogenic) of Gram-positive, Gram-negative bacteria and fungi. Forty-two out of 176 bioactive-producing genotypes (76 %) exhibited antimicrobial activity against at least four different type strains and were selected for 16S rDNA sequencing and screening for nonribosomal peptide (NRPS) and polyketide (PKS) synthases genes. The isolates were assigned to genus Bacillus and Proteobacteria, and 20 strains harbored either NRPS, PKS type I or both genes. This is the first report on the diversity of culturable mesophilic bacteria associated with antimicrobial activity from Kolumbo area; the extremely high proportion of antimicrobial-producing strains suggested that this unique environment may represent a potential reservoir of novel bioactive compounds.
|
151. |
Harry EJ,
Wake RG,
( 1989 ) Cloning and expression of a Bacillus subtilis division initiation gene for which a homolog has not been identified in another organism. PMID : 2556376 : DOI : 10.1128/jb.171.12.6835-6839.1989 PMC : PMC210583 Abstract >>
The Bacillus subtilis 168 division initiation genes defined by the temperature-sensitive mutations ts-1 and ts-12 were cloned into a 10.5-kilobase EcoRI fragment of DNA in the lambda EMBL4 vector. The two genes were separated by approximately 3 kilobases. The gene in which the ts-1 mutation resides was shown to be the same as the B. subtilis homolog of the Escherichia coli ftsZ gene. The other gene was named divIB. It showed no homology to any previously identified gene and coded for a protein of 30.1 kilodaltons which was probably membrane bound.
|
152. |
Liu C,
Sheng J,
Chen L,
Zheng Y,
Lee DY,
Yang Y,
Xu M,
Shen L,
( 2015 ) Biocontrol Activity of Bacillus subtilis Isolated from Agaricus bisporus Mushroom Compost Against Pathogenic Fungi. PMID : 26050784 : DOI : 10.1021/acs.jafc.5b02218 Abstract >>
Bacillus subtilis strain B154, isolated from Agaricus bisporus mushroom compost infected by red bread mold, exhibited antagonistic activities against Neurospora sitophila. Antifungal activity against phytopathogenic fungi was also observed. The maximum antifungal activity was reached during the stationary phase. This antifungal activity was stable over a wide pH and temperature range and was not affected by proteases. Assay of antifungal activity in vitro indicated that a purified antifungal substance could strongly inhibit mycelia growth and spore germination of N. sitophila. In addition, treatment with strain B154 in A. bisporus mushroom compost infected with N. sitophila significantly increased the yield of bisporus mushrooms. Ultraviolet scan spectroscopy, tricine sodium dodecyl sulfate-polyacrylamide gel electrophoresis, matrix-associated laser desorption ionization time-of-flight mass spectrometry, and electrospray ionization tandem mass spectrometry analyses revealed a molecular weight consistent with 1498.7633 Da. The antifungal compound might belong to a new type of lipopeptide fengycin.
|
153. |
Chen NY,
Zhang JJ,
Paulus H,
( 1989 ) Chromosomal location of the Bacillus subtilis aspartokinase II gene and nucleotide sequence of the adjacent genes homologous to uvrC and trx of Escherichia coli. PMID : 2559145 : DOI : 10.1099/00221287-135-11-2931 Abstract >>
The aspartokinase II (ask) operon of Bacillus subtilis consists of two in-phase overlapping genes that encode the two subunits of the lysine-sensitive isoenzyme of aspartokinase (ATP:L-aspartate 4-phosphotransferase, EC 2.7.2.4). Transduction mapping of the ask operon, inactivated by recombinational insertion of a cat marker, indicates a chromosomal location (about 253 degrees) between leuA and aroG. ask is thus remote from aecB, eliminating aecB as a possible locus for the structural gene of aspartokinase II, but close to aecA and uvrB. The nucleotide sequence of a 2 kb DNA fragment just upstream of the ask operon was determined and found to contain two open reading frames. The deduced amino acid sequence of the distal reading frame exhibits extensive homology with Escherichia coli thioredoxin and that of the proximal one, which overlaps with the ask promoter, is homologous to the deduced product of the E. coli uvrC gene. Insertional mutagenesis of the proximal open reading frame led to a mitomycin-sensitive phenotype, consistent with a role in DNA repair. In conjunction with the data of M. Petricek, L. Rutberg & L. Hederstedt [FEMS Microbiology Letters 61, 85-88] our results define the nucleotide sequence of an 8.8 kb segment of the B. subtilis chromosome near 253 degrees and the following order of genes: trx-uvrB-ask-orfX-sdhC-sdhA-sdhB-orfY++ +-gerE.
|
154. |
Browne HP,
Anvar SY,
Frank J,
Lawley TD,
Roberts AP,
Smits WK,
( 2015 ) Complete genome sequence of BS49 and draft genome sequence of BS34A, Bacillus subtilis strains carrying Tn916. PMID : 25673660 : DOI : 10.1093/femsle/fnu050 Abstract >>
Bacillus subtilis strains BS49 and BS34A, both derived from a common ancestor, carry one or more copies of Tn916, an extremely common mobile genetic element capable of transfer to and from a broad range of microorganisms. Here, we report the complete genome sequence of BS49 and the draft genome sequence of BS34A, which have repeatedly been used as donors to transfer Tn916, Tn916 derivatives or oriTTn916-containing plasmids to clinically important pathogens.
|
155. |
Loiseau C,
Schlusselhuber M,
Bigot R,
Bertaux J,
Berjeaud JM,
Verdon J,
( 2015 ) Surfactin from Bacillus subtilis displays an unexpected anti-Legionella activity. PMID : 25573468 : DOI : 10.1007/s00253-014-6317-z Abstract >>
A contaminant bacterial strain was found to exhibit an antagonistic activity against Legionella pneumophila, the causative agent of Legionnaires' disease. The bacterial strain was identified as a Bacillus subtilis and named B. subtilis AM1. PCR analysis revealed the presence of the sfp gene, involved in the biosynthesis of surfactin, a lipopeptide with versatile bioactive properties. The bioactive substances were extracted from AM1 cell-free supernatant with ethyl acetate and purified using reversed phase HPLC (RP-HPLC). Subsequent ESI-MS analyses indicated the presence of two active substances with protonated molecular ions at m/z 1008 and 1036 Da, corresponding to surfactin isoforms. Structures of lipopeptides were further determined by tandem mass spectrometry and compared to the spectra of a commercially available surfactin mixture. Surfactin displays an antibacterial spectrum almost restricted to the Legionella genus (MICs range 1-4 �gg/mL) and also exhibits a weak activity toward the amoeba Acanthamoeba castellanii, known to be the natural reservoir of L. pneumophila. Anti-biofilm assays demonstrated that 66 �gg/mL of surfactin successfully eliminated 90 % of a 6-day-old biofilm. In conclusion, this study reveals for the first time the potent activity of surfactin against Legionella sp. and preformed biofilms thus providing new directions toward the use and the development of lipopeptides for the control of Legionella spread in the environment.
|
156. |
Takenaka S,
Miyatake A,
Tanaka K,
Kuntiya A,
Techapun C,
Leksawasdi N,
Seesuriyachan P,
Chaiyaso T,
Watanabe M,
Yoshida K,
( 2015 ) Characterization of the native form and the carboxy-terminally truncated halotolerant form of �\-amylases from Bacillus subtilis strain FP-133. PMID : 25689045 : DOI : 10.1002/jobm.201400813 Abstract >>
Two amylases, amylase I and amylase II from Bacillus subtilis strain FP-133, were purified to homogeneity and characterized. Their stabilities toward temperature, pH, and organic solvents, and their substrate specificities toward polysaccharides and oligosaccharides were similar. Under moderately high salt conditions, both amylases were more stable than commercial B. licheniformis amylase, and amylase I retained higher amylase activity than amylase II. The N-terminal amino acid sequence, genomic southern blot analysis, and MALDI-TOFF-MS analysis indicated that the halotolerant amylase I was produced by limited carboxy-terminal truncation of the amylase II peptide. The deduced amino acid sequence of amylase II was >95% identical to that of previously reported B. subtilis �\-amylases, but their carboxy-terminal truncation points differed. Three recombinant amylases--full-length amylase corresponding to amylase II, an artificially truncated amylase corresponding to amylase I, and an amylase with a larger artificial C-terminal truncation--were expressed in B. subtilis. The artificially truncated recombinant amylases had the same high amylase activity as amylase I under moderately high salt conditions. Sequence comparisons indicated that an increased ratio of Asp/Glu residues in the enzyme may be one factor responsible for increasing halotolerance.
|
157. |
Luo C,
Liu X,
Zhou H,
Wang X,
Chen Z,
( 2015 ) Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions. PMID : 25362061 : DOI : 10.1128/AEM.02921-14 PMC : PMC4272749 Abstract >>
Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way.
|
158. |
Su P,
Wang DX,
Ding SX,
Zhao J,
( 2014 ) Isolation and diversity of natural product biosynthetic genes of cultivable bacteria associated with marine sponge Mycale sp. from the coast of Fujian, China. PMID : 24693980 : DOI : 10.1139/cjm-2013-0785 Abstract >>
The marine sponge Mycale sp., a potential source of natural bioactive products, is widely distributed along the coast of Fujian, China. The cultivable bacterial community associated with Mycale sp., the antibacterial activities, and the PKS (polyketide synthase) and NRPS (nonribosomal peptide synthetase) gene diversity of these bacteria were investigated. Phylogenetic analysis of the 16S rRNA gene showed that the 51 isolates from Mycale sp. belonged to Actinobacteria, Bacteroidetes, Gammaproteobacteria, Alphaproteobacteria, and Firmicutes. Among them, some bacteria were first isolated from marine sponge. The 20 isolates with antimicrobial activities were primarily clustered within the groups Actinobacteria, Gammaproteobacteria, and Bacillus. Strain HNS054, which showed 99% similarity to Streptomyces labedae, exhibited the strongest antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus MTCC 1430, Bacillus subtilis MTCC 441) and Vibrio species. The screening of natural product biosynthetic genes revealed that 8 Actinobacteria species with antimicrobial activities possessed PKS-KS (ketosynthase) or NRPS-A domains, and the Nocardiopsis species contained a hybrid or mixed PKS-NRPS system. The phylogenetic analysis of the amino acid sequences indicated that the identified KS domains clustered with those from diverse bacterial groups, including Actinobacteria, Alphaproteobacteria, Cyanobacteria, and Firmicutes. Most KS domain sequences had high homology (>80%) to type I KSs, but the KS domain of Nocardiopsis sp. strain HNS048 had 77% similarity to the type II KS domain of Burkholderia gladioli. The NRPS-A domains of the 8 isolates were grouped into the Gammaproteobacteria, Actinobacteria, and Firmicutes groups. The NRPS-A gene of strain HNS052, identified as Nocardiopsis cyriacigeorgica, showed only 54% similarity to Rhodococcus opacus. All results suggested that Mycale sp. harboured diverse bacteria that could contribute to the production of novel bioactive substances in the future.
|
159. |
Chakraborty K,
Thilakan B,
Raola VK,
( 2014 ) Polyketide family of novel antibacterial 7-O-methyl-5'-hydroxy-3'-heptenoate-macrolactin from seaweed-associated Bacillus subtilis MTCC 10403. PMID : 25420039 : DOI : 10.1021/jf504845m Abstract >>
Seaweed-associated heterotrophic bacterial communities were screened to isolate potentially useful antimicrobial strains, which were characterized by phylogenetic analysis. The bacteria were screened for the presence of metabolite genes involved in natural product biosynthetic pathway, and the structural properties of secondary metabolites were correlated with the genes. Bioactivity-guided isolation of polyene antibiotic 7-O-methyl-5'-hydroxy-3'-heptenoate-macrolactin from Bacillus subtilis MTCC10403 associated with seaweed Anthophycus longifolius using mass spectrometry and extensive 2D-NMR studies was carried out. The newly isolated macrolactin compound is a bactericidal antibiotic with broad spectrum activity against human opportunistic clinical pathogens. The biosynthetic pathway of 7-O-methyl-5'-hydroxy-3'-heptenoate-macrolactin by means of a stepwise, decarboxylative condensation pathway established the PKS-assisted biosynthesis of the parent macrolactin and the side-chain 5-hydroxyhept-3-enoate moiety attached to the macrolactin ring system at C-7. Antimicrobial activity analysis combined with the results of amplifying genes encoding for polyketide synthetase and nonribosomal peptide synthetase showed that seaweed-associated bacteria had broad-spectrum antimicrobial activity. The present work may have an impact on the exploitation of macrolactins for pharmaceutical and biotechnological applications.
|
160. |
Nakamura K,
Itoh Y,
Yamane K,
( 1988 ) Enhanced secretion of beta-lactamase on structural modification of the Bacillus subtilis alpha-amylase signal peptide. PMID : 2460441 : DOI : 10.1093/oxfordjournals.jbchem.a122455 Abstract >>
Prediction of the secondary structure, a sequence of 33 amino acids, for the Bacillus subtilis alpha-amylase signal peptide suggested the presence of a beta-turn structure in it. Through substitution of Gly27 and/or Pro28 with Ala residues by means of the site-directed mutagenesis method, the secondary structure was predicted to consist of an alpha-helix conformation throughout the signal peptide containing a small region of random coil. The effect of the structural modification upon the secretion of proteins was analyzed as to the production of beta-lactamase after the DNA regions encoding the parental and modified signal peptides had been fused in frame to the DNA fragment for the beta-lactamase using HindIII linker DNA. The production of beta-lactamase increased to 4 to 6 times in B. subtilis cells and to 1.5 to 2.0 times in Escherichia coli with the modified signal peptides. The modification of the signal peptide affected the transcription level of the fused genes.
|
161. |
Schüller F,
Benz R,
Sahl HG,
( 1989 ) The peptide antibiotic subtilin acts by formation of voltage-dependent multi-state pores in bacterial and artificial membranes. PMID : 2471644 : DOI : 10.1111/j.1432-1033.1989.tb14815.x Abstract >>
The peptide antibiotic subtilin was shown to induce a rapid efflux of amino acids from intact bacterial cells and cytoplasmic membrane vesicles, and to prevent amino acid uptake by cells preincubated with the peptide. Upon addition of subtilin the trans-membrane potential (delta psi) was greatly reduced. Starved bacterial cells were less sensitive to subtilin than energized cells. Depolarization of cells by carbonyl cyanide m-chlorophenylhydrazone prevented subtilin action, but its activity could be restored by a valinomycin-induced potassium diffusion potential. Using this technique, we deduced a threshold potential of about -90 to -100 mV to be essential for subtilin action on intact cells. A similar value was obtained in macroscopic conductance measurements with black lipid membranes. The current-voltage characteristic was symmetric, i.e. subtilin induced membrane currents with trans-negative and trans-positive voltages. Single-channel experiments revealed short-lived multi-state pores of the alamethicin type. The pores had lifetimes of several hundred milliseconds and pore diameters of up to approximately 2 nm.
|
162. |
Pandey S,
Kushwah J,
Tiwari R,
Kumar R,
Somvanshi VS,
Nain L,
Saxena AK,
( N/A ) Cloning and expression of �]-1, 4-endoglucanase gene from Bacillus subtilis isolated from soil long term irrigated with effluents of paper and pulp mill. PMID : 24636744 : DOI : 10.1016/j.micres.2014.02.006 Abstract >>
A strain of Bacillus subtilis IARI-SP-1 isolated from soil long term irrigated with effluents of paper and pulp mill showed high �]-1, 4-endoglucanase (2.5 IU/ml) but low activity of �]-1, 4-exoglucanase (0.8 IU/ml) and �]-glucosidase (0.084 IU/ml). The �]-1, 4-endoglucanase gene of IARI-SP-1 was amplified using degenerate primers designed based on sequences already available in NCBI GenBank. A full length gene of �]-1, 4-endonuclease consisting of 1499 nucleotides was identified through sequence analysis of the amplified product. The ORF encoded for a protein of 500 amino acids with a predicted molecular weight of 55 kDa. The gene was cloned in pET-28a and over expressed in Escherichia coli BL21 (DE3). In comparison to wild strain (B. subtilis), the transformed E. coli exhibited four times increase in cellulase production. Higher enzyme activity was observed in supernatant (8.2 IU/ml) than cell pellet (2.8 IU/ml) suggesting more extracellular production of �]-1, 4-endoglucanase. SDS-PAGE and CMC plate assay also confirmed the overproduction by the transformed E. coli. The pH and temperature optima of expressed �]-1, 4-endoglucanase enzyme was identical to that of wild strain and was 8 and 50-60 �XC, respectively.
|
163. |
Emori M,
Maruo B,
( 1988 ) Complete nucleotide sequence of an alpha-amylase gene from Bacillus subtilis 2633, an alpha-amylase extrahyperproducing strain. PMID : 2457205 : DOI : 10.1093/nar/16.14.7178 PMC : PMC338360 Abstract >>
N/A
|
164. |
Zhao Y,
Selvaraj JN,
Xing F,
Zhou L,
Wang Y,
Song H,
Tan X,
Sun L,
Sangare L,
Folly YM,
Liu Y,
( 2014 ) Antagonistic action of Bacillus subtilis strain SG6 on Fusarium graminearum. PMID : 24651513 : DOI : 10.1371/journal.pone.0092486 PMC : PMC3961383 Abstract >>
Fusarium graminearum causes Fusarium head blight (FHB), a devastating disease that leads to extensive yield and quality loss of wheat and barley. Bacteria isolated from wheat kernels and plant anthers were screened for antagonistic activity against F. graminearum. Based on its in vitro effectiveness, strain SG6 was selected for characterization and identified as Bacillus subtilis. B. subtilis SG6 exhibited a high antifungal effect on the mycelium growth, sporulation and DON production of F. graminearum with the inhibition rate of 87.9%, 95.6% and 100%, respectively. In order to gain insight into biological control effect in situ, we applied B. subtilis SG6 at anthesis through the soft dough stage of kernel development in field test. It was revealed that B. subtilis SG6 significantly reduced disease incidence (DI), FHB index and DON (P ? 0.05). Further, ultrastructural examination shows that B. subtilis SG6 strain induced stripping of F. graminearum hyphal surface by destroying the cellular structure. When hypha cell wall was damaged, the organelles and cytoplasm inside cell would exude, leading to cell death. The antifungal activity of SG6 could be associated with the coproduction of chitinase, fengycins and surfactins.
|
165. |
Um S,
Fraimout A,
Sapountzis P,
Oh DC,
Poulsen M,
( 2013 ) The fungus-growing termite Macrotermes natalensis harbors bacillaene-producing Bacillus sp. that inhibit potentially antagonistic fungi. PMID : 24248063 : DOI : 10.1038/srep03250 PMC : PMC3832938 Abstract >>
The ancient fungus-growing termite (Mactrotermitinae) symbiosis involves the obligate association between a lineage of higher termites and basidiomycete Termitomyces cultivar fungi. Our investigation of the fungus-growing termite Macrotermes natalensis shows that Bacillus strains from M. natalensis colonies produce a single major antibiotic, bacillaene A (1), which selectively inhibits known and putatively antagonistic fungi of Termitomyces. Comparative analyses of the genomes of symbiotic Bacillus strains revealed that they are phylogenetically closely related to Bacillus subtilis, their genomes have high homology with more than 90% of ORFs being 100% identical, and the sequence identities across the biosynthetic gene cluster for bacillaene are higher between termite-associated strains than to the cluster previously reported in B. subtilis. Our findings suggest that this lineage of antibiotic-producing Bacillus may be a defensive symbiont involved in the protection of the fungus-growing termite cultivar.
|
166. |
Rozeboom HJ,
Godinho LF,
Nardini M,
Quax WJ,
Dijkstra BW,
( 2014 ) Crystal structures of two Bacillus carboxylesterases with different enantioselectivities. PMID : 24418394 : DOI : 10.1016/j.bbapap.2014.01.003 Abstract >>
Naproxen esterase (NP) from Bacillus subtilis Thai I-8 is a carboxylesterase that catalyzes the enantioselective hydrolysis of naproxenmethylester to produce S-naproxen (E>200). It is a homolog of CesA (98% sequence identity) and CesB (64% identity), both produced by B. subtilis strain 168. CesB can be used for the enantioselective hydrolysis of 1,2-O-isopropylideneglycerol (solketal) esters (E>200 for IPG-caprylate). Crystal structures of NP and CesB, determined to a resolution of 1.75? and 2.04?, respectively, showed that both proteins have a canonical �\/�] hydrolase fold with an extra N-terminal helix stabilizing the cap subdomain. The active site in both enzymes is located in a deep hydrophobic groove and includes the catalytic triad residues Ser130, His274, and Glu245. A product analog, presumably 2-(2-hydroxyethoxy)acetic acid, was bound in the NP active site. The enzymes have different enantioselectivities, which previously were shown to result from only a few amino acid substitutions in the cap domain. Modeling of a substrate in the active site of NP allowed explaining the different enantioselectivities. In addition, Ala156 may be a determinant of enantioselectivity as well, since its side chain appears to interfere with the binding of certain R-enantiomers in the active site of NP. However, the exchange route for substrate and product between the active site and the solvent is not obvious from the structures. Flexibility of the cap domain might facilitate such exchange. Interestingly, both carboxylesterases show higher structural similarity to meta-cleavage compound (MCP) hydrolases than to other �\/�] hydrolase fold esterases.
|
167. |
Gonzy-Tréboul G,
Zagorec M,
Rain-Guion MC,
Steinmetz M,
( 1989 ) Phosphoenolpyruvate:sugar phosphotransferase system of Bacillus subtilis: nucleotide sequence of ptsX, ptsH and the 5'-end of ptsI and evidence for a ptsHI operon. PMID : 2497294 : DOI : 10.1111/j.1365-2958.1989.tb00109.x Abstract >>
The nucleotide sequence of a 1689bp fragment of the Bacillus subtilis locus containing ptsX (a crr-like gene), ptsH (coding for HPr), and the 5'-end of ptsI (coding for Enzyme I) was determined. The deduced amino acid sequences of ptsH and the N-terminal part of ptsI were compared to those of Streptococcus faecalis and Escherichia coli. Transcription fusion demonstrated that ptsHI constitutes an operon. An open reading frame overlapping the main part of ptsH in the opposite sense was shown to be expressed in vivo, using protein fusions with beta-galactosidase. The deduced amino acid sequence of ptsX showed significant homology with that of Salmonella typhimurium glucose-specific Enzyme III. ptsX was preceded by an open reading frame whose amino acid sequence showed strong homology with the C-terminal part of E. coli Enzyme IIGlc.
|
168. |
Guan ZB,
Zhang N,
Song CM,
Zhou W,
Zhou LX,
Zhao H,
Xu CW,
Cai YJ,
Liao XR,
( 2014 ) Molecular cloning, characterization, and dye-decolorizing ability of a temperature- and pH-stable laccase from Bacillus subtilis X1. PMID : 24218183 : DOI : 10.1007/s12010-013-0614-3 Abstract >>
Laccases from fungal origin are typically unstable at high temperatures and alkaline conditions. This characteristic limits their practical applications. In this study, a new bacterial strain exhibiting laccase activity was isolated from raw fennel honey samples and identified as Bacillus subtilis X1. The CotA-laccase gene was cloned from strain X1 and efficiently expressed in Escherichia coli in a biologically active form. The purified recombinant laccase demonstrated an extensive pH range for catalyzing substrates and high stability toward alkaline pH and high temperatures. No loss of laccase activity was observed at pH 9.0 after 10 days of incubation, and approximately 21 % of the initial activity was detected after 10 h at 80 �XC. Two anthraquinonic dyes (reactive blue 4 and reactive yellow brown) and two azo dyes (reactive red 11 and reactive brilliant orange) could be partially decolorized by purified laccase in the absence of a mediator. The decolorization process was efficiently promoted when methylsyringate was present, with more than 90 % of color removal occurring in 3 h at pH 7.0 or 9.0. These unusual properties indicated a high potential of the novel CotA-laccase for industrial applications.
|
169. |
Liu P,
Gao Y,
Huang W,
Shao Z,
Shi J,
Liu Z,
( 2012 ) A novel bioassay for high-throughput screening microorganisms with N-acyl homoserine lactone degrading activity. PMID : 22528649 : DOI : 10.1007/s12010-012-9653-4 Abstract >>
A novel biosensor strain (Escherichia coli ALM403) that responded to N-acyl homoserine lactone (AHL) was constructed using a luxR-Plux cassette as a regulatory sequence and �]-mannanase as a reporter gene. Dinitrosalicylic acid method was used to detect the response of the sensor strain to N-acyl homoserine lactone. By investigating the response to a range of concentrations of N-�]-oxooctanoyl-L-homoserine lactone (OOHL), it was demonstrated that the expression of mannanase in E. coli ALM403 could be greatly enhanced by OOHL and resulted in an assayable phenotype. A high-throughput screening approach was developed to isolate AHL-degrading microorganisms, and a marine Halomonas sp. S66-4 showing a marked AHL-degrading ability was successfully isolated. In conclusion, the bioassay system provided a simple and efficient approach to isolate AHL-degrading bacteria.
|
170. |
Phelan RW,
Barret M,
Cotter PD,
O'Connor PM,
Chen R,
Morrissey JP,
Dobson AD,
O'Gara F,
Barbosa TM,
( 2013 ) Subtilomycin: a new lantibiotic from Bacillus subtilis strain MMA7 isolated from the marine sponge Haliclona simulans. PMID : 23736764 : DOI : 10.3390/md11061878 PMC : PMC3721211 Abstract >>
Bacteriocins are attracting increased attention as an alternative to classic antibiotics in the fight against infectious disease and multidrug resistant pathogens. Bacillus subtilis strain MMA7 isolated from the marine sponge Haliclona simulans displays a broad spectrum antimicrobial activity, which includes Gram-positive and Gram-negative pathogens, as well as several pathogenic Candida species. This activity is in part associated with a newly identified lantibiotic, herein named as subtilomycin. The proposed biosynthetic cluster is composed of six genes, including protein-coding genes for LanB-like dehydratase and LanC-like cyclase modification enzymes, characteristic of the class I lantibiotics. The subtilomycin biosynthetic cluster in B. subtilis strain MMA7 is found in place of the sporulation killing factor (skf) operon, reported in many B. subtilis isolates and involved in a bacterial cannibalistic behaviour intended to delay sporulation. The presence of the subtilomycin biosynthetic cluster appears to be widespread amongst B. subtilis strains isolated from different shallow and deep water marine sponges. Subtilomycin possesses several desirable industrial and pharmaceutical physicochemical properties, including activity over a wide pH range, thermal resistance and water solubility. Additionally, the production of the lantibiotic subtilomycin could be a desirable property should B. subtilis strain MMA7 be employed as a probiotic in aquaculture applications.
|
171. |
Ko KC,
Han Y,
Shin BS,
Choi JH,
Song JJ,
( 2012 ) A rapid and simple method for preparing an insoluble substrate for screening of microbial xylanase. PMID : 22585365 : DOI : 10.1007/s12010-012-9722-8 Abstract >>
Several types of enzymes, including cellulases and xylanases, are required to degrade hemicelluloses and cellulose, which are major components of lignocellulosic biomass. Such degradative processes can be used to produce various useful industrial biomaterials. Screening methods for detecting polysaccharide-degrading microorganisms include the use of dye-labeled substrates in growth medium and culture plate staining techniques. However, the preparation of screening plates, which typically involves chemical cross-linking to synthesize a dye-labeled substrate, is a complicated and time-consuming process. Moreover, such commercial substrates are very expensive, costing tenfold more than the natural xylan. Staining methods are also problematic because they may damage relevant microorganisms and are associated with contamination of colonies of desirable organisms with adjacent unwanted bacteria. In the present study, we describe a sonication method for the simple and rapid preparation of an insoluble substrate that can be used to screen for xylanase-expressing bacteria in microbial populations. Using this new method, we have successfully isolated a novel xylanase gene from a xylolytic microorganism termed Xyl02-KBRB and Xyl14-KBRB in the bovine rumen.
|
172. |
Tuzlakoglu Ozturk M,
Akbulut N,
Issever Ozturk S,
Gumusel F,
( 2013 ) Ligase-independent cloning of amylase gene from a local Bacillus subtilis isolate and biochemical characterization of the purified enzyme. PMID : 23832859 : DOI : 10.1007/s12010-013-0331-y Abstract >>
Five hundred ninety-seven bacterial isolates from Turkish hot spring water sources were screened for their ability to produce extracellular �\-amylase. Among them, a high enzyme-producing Bacillus subtilis isolate, A28, was selected, and its �\-amylase gene was cloned and expressed in Escherichia coli by a ligase-independent method. �\-Amylase from the recombinant strain was purified to homogeneity by Q-Sepharose anion exchange and Sephacryl S-100 gel filtration chromatographies. The final yield of the enzyme was about 22.5 % of the initial activity, with a 16.4-fold increase in specific activity compared with the culture lysate. The optimum temperature and pH of the enzyme were 70 �XC and 6.0, respectively. The enzyme was highly active at acidic-neutral pH range of 4.5-7.0. The amy28 �\-amylase retained 100 % of its activity after incubation at 50 �XC for 90 min. Co(+2), Cu(2+), Fe(2+), Fe(3+), Ni(+2), and Zn(+2) caused significant inhibition in enzyme activity, which was not affected by Na(+), Mg(2+), Li(+), and Ba(2+). The activity was inhibited about 70 % upon treatment of the enzyme with 10 mM ethylenediaminetetraacetic acid. However, Ca(2+) ions known as high temperature stabilizer for other amylases did not stimulate the activity of the enzyme. Due to pH stability and thermostability of the recombinant amylase, this enzyme may be suitable in starch processing, brewing, and food industries.
|
173. |
Tian Q,
Song P,
Jiang L,
Li S,
Huang H,
( 2014 ) A novel cephalosporin deacetylating acetyl xylan esterase from Bacillus subtilis with high activity toward cephalosporin C and 7-aminocephalosporanic acid. PMID : 23828600 : DOI : 10.1007/s00253-013-5056-x Abstract >>
A cephalosporin deacetylating acetyl xylan esterase was cloned from the genomic DNA of Bacillus subtilis CICC 20034 and functionally expressed in Escherichia coli. Its gene contained an open reading frame of 957 bp encoding 318 amino acids with a calculated mass of 35,607 Da, and it displayed significant identity to acetyl xylan esterases from Bacillus sp. 916, B. subtilis 168, and Bacillus pumilus Cect5072. The enzyme was a native homohexamer but a trimer under the condition of 1% sodium dodecyl sulfate (SDS); both forms were active and could transit to each other by incubating in or removing SDS. The enzyme belongs to carbohydrate esterase family 7 and had a double specificity on both the acetylated oligosaccharide and cephalosporin C (CPC) and 7-aminocephalosporanic acid (7-ACA). The activity of this purified enzyme toward CPC and 7-ACA was highest among all the acetyl xylan esterase from CE family 7, which were 484 and 888 U/mg, respectively, and endowed itself with great industrial interest on semi-synthetic �]-lactam antibiotics. The optimum pH of the purified enzyme was 8.0, and the optimum temperature was 50 �XC, and the enzyme had high thermal stability, broad range of pH tolerance, and extremely organic solvent tolerance.
|
174. |
Tarayre C,
Brognaux A,
Brasseur C,
Bauwens J,
Millet C,
Mattéotti C,
Destain J,
Vandenbol M,
Portetelle D,
De Pauw E,
Haubruge E,
Francis F,
Thonart P,
( 2013 ) Isolation and cultivation of a xylanolytic Bacillus subtilis extracted from the gut of the termite Reticulitermes santonensis. PMID : 23828225 : DOI : 10.1007/s12010-013-0337-5 Abstract >>
The aim of this work was the isolation of xylanolytic microorganisms from the digestive tract of the termite Reticulitermes santonensis. The reducing sugars released after the hydrolysis of xylans can be further fermented to provide bioethanol. A xylanolytic strain of Bacillus subtilis was isolated from the hindgut of the termite and displayed amylase and xylanase activities. The bacterium was grown on media containing agricultural residues: wheat bran, wheat distiller's grains, and rapeseed oil cake. Wheat bran led to the highest induction of xylanase activity, although the development of the strain was less fast than in the other media. It was possible to reach maximal xylanase activities of 44.3, 33.5, and 29.1 I.U./ml in the media containing wheat bran, wheat distiller's grains, and rapeseed oil cake, respectively. Mass spectrometry identified a wide range of xylose oligomers, highlighting an endoxylanase activity. The enzyme was stable up to 45 �XC and displayed an optimal pH close to 8.
|
175. |
Vu TT,
Quyen DT,
Dao TT,
Nguyen Sle T,
( 2012 ) Cloning, high-level expression, purification, and properties of a novel endo-beta-1,4-mannanase from Bacillus subtilis G1 in Pichia pastoris. PMID : 22450788 : Abstract >>
A novel gene coding for an endo-beta-1,4-mannanase (manA) from Bacillus subtilis strain G1 was cloned and overexpressed in P. pastoris GS115, and the enzyme was purified and characterized. The manA gene consisted of an open reading frame of 1,092 nucleotides, encoding a 364-aa protein, with a predicted molecular mass of 41 kDa. The beta-mannanase showed an identity of 90.2-92.9% (< or =95%) with the corresponding amino acid sequences from B. subtilis strains deposited in GenBank. The purified beta- mannanase was a monomeric protein on SDS-PAGE with a specific activity of 2,718 U/mg and identified by MALDITOF mass spectrometry. The recombinant beta-mannanase had an optimum temperature of 45 degrees C and optimum pH of 6.5. The enzyme was stable at temperatures up to 50 degrees C (for 8 h) and in the pH range of 5-9. EDTA and most tested metal ions showed a slightly to an obviously inhibitory effect on enzyme activity, whereas metal ions (Hg2+, Pb2+, and Co2+) substantially inhibited the recombinant beta-mannanase. The chemical additives including detergents (Triton X- 100, Tween 20, and SDS) and organic solvents (methanol, ethanol, n-butanol, and acetone) decreased the enzyme activity, and especially no enzyme activity was observed by addition of SDS at the concentrations of 0.25-1.0% (w/v) or n-butanol at the concentrations of 20-30% (v/v). These results suggested that the beta-mannanase expressed in P. pastoris could potentially be used as an additive in the feed for monogastric animals.
|
176. |
Stefanic P,
Decorosi F,
Viti C,
Petito J,
Cohan FM,
Mandic-Mulec I,
( 2012 ) The quorum sensing diversity within and between ecotypes of Bacillus subtilis. PMID : 22390407 : DOI : 10.1111/j.1462-2920.2012.02717.x Abstract >>
Ecological sociobiology is an emerging field that aims to frame social evolution in terms of ecological adaptation. Here we explore the ecological context for evolution of quorum sensing diversity in bacteria, where social communication is limited to members of the same quorum sensing type (pherotype). We sampled isolates of Bacillus subtilis from soil on a microgeographical scale and identified three ecologically distinct phylogenetic groups (ecotypes) and three pherotypes. Each pherotype was strongly associated with a different ecotype, suggesting that it is usually not adaptive for one ecotype to 'listen' to the signalling of another. Each ecotype, however, contained one or more minority pherotypes shared with the other B. subtilis ecotypes and with more distantly related species taxa. The pherotype diversity within ecotypes is consistent with two models: first, a pherotype cycling model, whereby minority pherotypes enter a population through horizontal genetic transfer and increase in frequency through cheating the social interaction; and second, an occasional advantage model, such that when two ecotypes are each below their quorum densities, they may benefit from listening to one another. This is the first survey of pherotype diversity in relation to ecotypes and it will be interesting to further test the hypotheses raised and supported here, and to explore other bacterial systems for the role of ecological divergence in fostering pherotype diversity.
|
177. |
Lima LJ,
van der Velpen V,
Wolkers-Rooijackers J,
Kamphuis HJ,
Zwietering MH,
Nout MJ,
( 2012 ) Microbiota dynamics and diversity at different stages of industrial processing of cocoa beans into cocoa powder. PMID : 22327588 : DOI : 10.1128/AEM.07691-11 PMC : PMC3318835 Abstract >>
We sampled a cocoa powder production line to investigate the impact of processing on the microbial community size and diversity at different stages. Classical microbiological methods were combined with 16S rRNA gene PCR-denaturing gradient gel electrophoresis, coupled with clone library construction, to analyze the samples. Aerobic thermoresistant spores (ThrS) (100�XC; 10 min) were also isolated and characterized (identity, genetic diversity, and spore heat resistance), in view of their relevance to the quality of downstream heat-treated cocoa-flavored drinks. In the nibs (broken, shelled cocoa beans), average levels of total aerobic microorganisms (TAM) (4.4 to 5.6 log CFU/g) and aerobic total spores (TS) (80�XC; 10 min; 4.3 to 5.5 log CFU/g) were significantly reduced (P < 0.05) as a result of alkalizing, while fungi (4.2 to 4.4 log CFU/g) and Enterobacteriaceae (1.7 to 2.8 log CFU/g) were inactivated to levels below the detection limit, remaining undetectable throughout processing. Roasting further decreased the levels of TAM and TS, but they increased slightly during subsequent processing. Molecular characterization of bacterial communities based on enriched cocoa samples revealed a predominance of members of the Bacillaceae, Pseudomonadaceae, and Enterococcaceae. Eleven species of ThrS were found, but Bacillus licheniformis and the Bacillus subtilis complex were prominent and revealed great genetic heterogeneity. We concluded that the microbiota of cocoa powder resulted from microorganisms that could have been initially present in the nibs, as well as microorganisms that originated during processing. B. subtilis complex members, particularly B. subtilis subsp. subtilis, formed the most heat-resistant spores. Their occurrence in cocoa powder needs to be considered to ensure the stability of derived products, such as ultrahigh-temperature-treated chocolate drinks.
|
178. |
Yang SS,
Liu ZW,
Yi XP,
Zhang AL,
Zhang TY,
Luo JX,
Zhang ZH,
Shen JC,
Yin HX,
Chen LP,
( 2012 ) Isolation of laccase gene from Bacillus subtilis and analysis of its physicochemical properties. PMID : 21983598 : DOI : 10.1016/j.gene.2011.09.006 Abstract >>
The present study reports the cloning and sequencing of lac2 from Bacillus subtilis. The gene is composed of 1542 bp and encodes a 514-amino acid protein. The gene has 86% homology with a published laccase with GeneID 936023. The lac2 gene was deposited in GenBank as a new nucleotide sequence. This new sequence was cloned into the multiple cloning site of pPIC9K to generate pPIC9K-lac2, which was then transformed into Pichia pastoris GS115 via electroporation. The recombinant GS115 (pPIC9K-lac2) was grown initially in BMGY medium and transferred to BMMY to induce gene expression for 48 h. The recombinant Lac2 protein shows laccase activity with �\-naphthol and guaiacol as substrates. The optimal pH is between 3.2 and 4.7, and the optimal temperature is 25�XC for enzyme reaction.
|
179. |
Ghasemi Y,
Dabbagh F,
Ghasemian A,
( 2012 ) Cloning of a fibrinolytic enzyme (subtilisin) gene from Bacillus subtilis in Escherichia coli. PMID : 22069026 : DOI : 10.1007/s12033-011-9467-6 Abstract >>
Several investigations are being pursued to enhance the efficacy and specificity of fibrinolytic therapy. In this regard, microbial fibrinolytic enzymes attracted much more medical interests during these decades. Subtilisin, a member of subtilases (the superfamily of subtilisin-like serine proteases) and also a fibrinolytic enzyme is quite common in Gram-positive bacteria, and Bacillus species stand out in particular, as many extracellular and even intracellular variants have been identified. In the present work, the subtilisin gene from Bacillus subtilis PTCC 1023 was cloned into the vector pET-15b and expressed in Escherichia coli strain BL21 (DE3). Total genomic DNA were isolated and used for PCR amplification of the subtilisin gene by means of the specific primers. SDS-PAGE and enzyme assay were done for characterizing the expressed protein. A ~1,100 bp of the structural subtilisin gene was amplified. The DNA and amino acid sequence alignments resulting from the BLAST search of subtilisin showed high sequence identity with the other strains of B. subtilis, whereas significantly lower identity was observed with other bacterial subtilisins. The recombinant enzyme had the same molecular weight as other reported subtilisins and the E. coli transformants showed high subtilisin activity. This study provides evidence that subtilisin can be actively expressed in E. coli. The commercial availability of subtilisin is of great importance for industrial applications and also pharmaceutical purposes as thrombolytic agent. Thus, the characterization of new recombinant subtilisin and the development of rapid, simple, and effective production methods are not only of academic interest, but also of practical importance.
|
180. |
Kaboré D,
Thorsen L,
Nielsen DS,
Berner TS,
Sawadogo-Lingani H,
Diawara B,
Dicko MH,
Jakobsen M,
( 2012 ) Bacteriocin formation by dominant aerobic sporeformers isolated from traditional maari. PMID : 22240061 : DOI : 10.1016/j.ijfoodmicro.2011.12.003 Abstract >>
The antimicrobial activity of 8 Bacillus spp. and 2 Lysinibacillus spp. representing the predominant aerobic sporeformers during traditional maari fermentations, a traditional fermented baobab seeds product from Burkina Faso, was investigated. The antimicrobial activity was assessed against a total of 31 indicator organisms representing various Gram-negative and positive pathogens. The screening showed that 3 Bacillus subtilis strains (B3, B122 and B222) in particular had antimicrobial activity against some Gram-positive organisms and were selected for further studies. It was found that the antimicrobial substances produced were heat stable, in-sensitive to catalase, sensitive to protease and trypsin but resistant to the proteolytic action of papain and proteinase K and equally active at pH values ranging from 3 to 11. Bacteriocin secretion started in late exponential growth phase and maximum activity was detected during the stationary growth phase. The production of bacteriocin by B. subtilis B3, B122 and B222 was dependent on the aeration conditions. Maximum production of bacteriocin was observed under reduced aeration. Specific primers were used to screen isolates B3, B122 and B222 for genes involved in the synthesis of the bacteriocins subtilosin A, subtilin, sublancin and ericin. Amplicons of the expected sizes were detected for iywB, sboA, sboX, albA and spaS involved in the biosynthesis of subtilosin and subtilin, respectively. The translated nucleotide sequences had 100% identity to the YiwB, SboX and SboA amino acid sequences of the subtilosin A producing B. subtilis subsp. subtilis strain 168. Interestingly there was a 3 amino acid deletion at the N-terminal part of AlbA in B3, B122 and B222 that probably alters the activity of this enzyme. Analysis of the spaS gene sequences of B3, B122 and B222, encoding a subtilin precursor peptide, showed that the translated nucleotide sequence had 98% identity with the corresponding SpaS amino acid sequence of subtilin producing B. subtilis subsp. spizizenii strain ATCC6633.
|
181. |
Phelan RW,
O'Halloran JA,
Kennedy J,
Morrissey JP,
Dobson AD,
O'Gara F,
Barbosa TM,
( 2012 ) Diversity and bioactive potential of endospore-forming bacteria cultured from the marine sponge Haliclona simulans. PMID : 21985154 : DOI : 10.1111/j.1365-2672.2011.05173.x Abstract >>
Despite the frequent isolation of endospore-formers from marine sponges, little is known about the diversity and characterization of individual isolates. The main aims of this study were to isolate and characterize the spore-forming bacteria from the marine sponge Haliclona simulans and to examine their potential as a source for bioactive compounds. A bank of presumptive aerobic spore-forming bacteria was isolated from the marine sponge H. simulans. These represented c. 1% of the total culturable bacterial population. A subgroup of thirty isolates was characterized using morphological, phenotypical and phylogenetic analysis. A large diversity of endospore-forming bacteria was present, with the thirty isolates being distributed through a variety of Bacillus and Paenibacillus species. These included ubiquitous species, such as B. subtilis, B. pumilus, B. licheniformis and B. cereus group, as well as species that are typically associated with marine habitats, such as B. aquimaris, B. algicola and B. hwajinpoensis. Two strains carried the aiiA gene that encodes a lactonase known to be able to disrupt quorum-sensing mechanisms, and various isolates demonstrated protease activity and antimicrobial activity against different pathogenic indicator strains, including Clostridium perfringens, Bacillus cereus and Listeria monocytogenes. The marine sponge H. simulans harbours a diverse collection of endospore-forming bacteria, which produce proteases and antibiotics. This diversity appears to be overlooked by culture-dependent and culture-independent methods that do not specifically target sporeformers. Marine sponges are an as yet largely untapped and poorly understood source of endospore-forming bacterial diversity with potential biotechnological, biopharmaceutical and probiotic applications. These results also indicate the importance of combining different methodologies for the comprehensive characterization of complex microbial populations such as those found in marine sponges.
|
182. |
Zhang X,
Huang Y,
Harvey PR,
Ren Y,
Zhang G,
Zhou H,
Yang H,
( 2012 ) Enhancing plant disease suppression by Burkholderia vietnamiensis through chromosomal integration of Bacillus subtilis chitinase gene chi113. PMID : 21972146 : DOI : 10.1007/s10529-011-0760-z Abstract >>
Burkholderia vietnamiensis P418 is a plant growth-promoting rhizobacteria. A chitinase gene from Bacillus subtilis was cloned and stably integrated into the chromosome of using the transposon delivery vector, pUTkm1. Chitinase activity was detected in recombinant P418-37 but not in wild type P418. Recombinant P418-37 retained the in vitro growth rate, N(2)-fixation and phosphate and potassium-solubilizing characteristics of the wild type. P418-37 significantly (P < 0.05) increased in vitro inhibition of the plant pathogenic fungi Rhizoctonia solani, Fusarium oxysporum f.sp. vasinfectum, Rhizoctonia cerealis, Bipolaris sorokiniana, Verticillium dahliae and Gaeumannomyces graminis var. tritici compared with P418. In planta disease suppression assays indicated that P418-37 significantly (P < 0.05) enhanced suppression of wheat sheath blight (R. cerealis), cotton Fusarium wilt (F. oxysporium f.sp. vasinfectum) and tomato gray mould (Botrytis cinerea), relative to the wild type.
|
183. |
( 1997 ) First steps from a two-dimensional protein index towards a response-regulation map for Bacillus subtilis. PMID : 9298659 : DOI : 10.1002/elps.1150180820 Abstract >>
Data on the identification of proteins of Bacillus subtilis on two-dimensional (2-D) gels as well as their regulation are summarized and the identification of 56 protein spots is included. The pattern of proteins synthesized in Bacillus subtilis during exponential growth, during starvation for glucose or phosphate, or after the imposition of stresses like heat shock, salt- and ethanol stress as well as oxidative stress was analyzed. N-terminal sequencing of protein spots allowed the identification of 93 proteins on 2-D gels, which are required for the synthesis of amino acids and nucleotides, the generation of ATP, for glycolyses, the pentose phosphate cycle, the citric acid cycle as well as for adaptation to a variety of stress conditions. A computer-aided analysis of the 2-D gels was used to monitor the synthesis profile of more than 130 protein spots. Proteins performing housekeeping functions during exponential growth displayed a reduced synthesis rate during stress and starvation, whereas spots induced during stress and starvation were classified as specific stress proteins induced by a single stimulus or a group of related stimuli, or as general stress proteins induced by a variety of entirely different stimuli. The analysis of mutants in global regulators was initiated in order to establish a response regulation map for B. subtilis. These investigations demonstrated that the alternative sigma factor sigma B is involved in the regulation of almost all of the general stress proteins and that the phoPR two-component system is required for the induction of a large part but not all of the proteins induced by phosphate starvation.
|
184. |
( 1997 ) The signal peptidase II (Isp) gene of Bacillus subtilis. PMID : 9141696 : DOI : 10.1099/00221287-143-4-1327 Abstract >>
The gene encoding the type II signal peptidase (SPase II) of Bacillus subtilis was isolated by screening a genomic DNA library of this bacterium for the ability to increase the levels of globomycin resistance in Escherichia coli, and to complement the growth deficiency at the non-permissive temperature of E. coli strain Y815 carrying a temperature-sensitive mutation in its Isp gene for SPase II. The deduced amino acid sequence of the B. subtilis SPase II showed significant similarity with those of other known SPase II enzymes. Activity of the B. subtilis SPase II was demonstrated by a pulse-labelling experiment in E. coli. In B. subtilis, the Isp gene is flanked by the isoleucyl-tRNA synthetase (ileS) gene and the pyrimidine biosynthetic (pyr) gene cluster, which is known to map at 139 degrees of the chromosome. In the Gram-positive bacteria studied thus far, Isp appears to be the first gene in an operon. The promoter-distal gene ("orf4') of this operon specifies a hypothetical protein in bacteria and yeast.
|
185. |
( 1997 ) An internal FK506-binding domain is the catalytic core of the prolyl isomerase activity associated with the Bacillus subtilis trigger factor. PMID : 9063446 : DOI : 10.1111/j.1432-1033.1997.00059.x Abstract >>
Two major families of peptidylprolyl cis-trans-isomerases, the cyclophilins and the structurally unrelated FK506-binding proteins (FKBPs), have been identified as cellular factors involved in protein folding in vitro. Here we report on the biochemical characterization of a second prolyl isomerase of Bacillus subtilis that was purified from a cyclophilin-negative (ppiB null) mutant and was shown to be the trigger factor (TigBS). N-terminal sequencing of 27 amino acid residues of the purified protein revealed 100% identity to the deduced sequence encoded by the tig gene, sequenced as a part of the B. subtilis genome project. The tigBS gene, located at 246 degrees on the genetic map upstream of the clpX and lonA,B genes, encodes an acidic protein (pI 4.3) of 47.5 kDa. Purified and recombinant TigBS-His proteins share the same substrate specificity and catalytic activity (Kcat/K(m) of 1.5 microM-1 s-1); both are inhibited by the macrolide FK506 with IC50 the range of 500 nM. We also demonstrate that the prolyl isomerase activity of TigBS is mediated by an internal domain of about 13 kDa (homologous to FKPB12) that represents the catalytic core of the trigger factor.
|
186. |
( 1997 ) A family of cold shock proteins in Bacillus subtilis is essential for cellular growth and for efficient protein synthesis at optimal and low temperatures. PMID : 9379903 : DOI : 10.1046/j.1365-2958.1997.5121878.x Abstract >>
Like other bacteria, Bacillus subtilis possesses a family of homologous small acidic proteins (CspB, CspC and CspD, identity >70%) that are strongly induced in response to cold shock. We show that deletion of cspC or cspD genes did not result in a detectable phenotype; in contrast, csp double mutants exhibited severe reduction in cellular growth at 15 degrees C as well as at 37 degrees C, including impairment of survival during the stationary phase. Two-dimensional gel analysis showed that protein synthesis was deregulated in csp double mutants and that the loss of one or two CSPs led to an increase in the synthesis of the remaining CSP(s) at 37 degrees C and after cold shock, suggesting that CSPs down-regulate production of members from this protein family. A cspB/C/D triple mutant (64BCDbt) could only be generated in the presence of cspB in trans on a plasmid that was not lost, in spite of lack of antibiotic pressure, indicating that a minimum of one csp gene is essential for viability of B. subtilis. After cold shock, synthesis of CspB in 64BCDbt was drastically lower than in wild-type cells accompanied by cessation in growth and strong reduction in general protein synthesis. As CspB, CspC and CspD are shown to bind to RNA in a co-operative and interactive manner, CSPs are suggested to function as RNA chaperones facilitating the initiation of translation under optimal and low temperatures.
|
187. |
( 1997 ) Identification of vegetative proteins for a two-dimensional protein index of Bacillus subtilis. PMID : 9084183 : DOI : 10.1099/00221287-143-3-991 Abstract >>
Twenty-three of the most prominent spots which are visible on two-dimensional (2-D) protein gels of Bacillus subtilis crude extracts were selected as marker spots for the construction of a 2-D protein index. N-terminal sequencing of the corresponding proteins resulted in the identification of enzymes involved in glycolysis, TCA cycle, pentose phosphate cycle, amino acid metabolism, nucleotide biosynthesis and translation. Using computer analysis of the 2-D protein gels, most of these metabolic enzymes were found to be synthesized at a reduced rate after different stresses and glucose starvation. Such an approach permits a rapid and global evaluation of the regulation of different branches of metabolism in response to various physiological conditions.
|
188. |
( 1997 ) A 23911 bp region of the Bacillus subtilis genome comprising genes located upstream and downstream of the lev operon. PMID : 9141695 : DOI : 10.1099/00221287-143-4-1321 Abstract >>
Within the framework of the European project to sequence the whole Bacillus subtilis 168 genome, a 23911 bp long chromosomal DNA fragment located around 233 degrees on the B. subtilis genetic map was cloned and sequenced. From the generated sequencing data and the results of the homology search, the primary structure of this region was determined. In addition to the whole lev operon, the region contains putative genes for an amino acid permease, two different alcohol dehydrogenases, a chitosanase, a protein belonging to the LysR family of transcriptional regulators, a protein related to the MerR transcriptional regulator, up to four proteins related to the product of the spoF gene, and genes coding for nine more inferred proteins of unknown function.
|
189. |
( 1997 ) A 23.4 kb segment at the 69 degrees-70 degrees region of the Bacillus subtilis genome. PMID : 9141694 : DOI : 10.1099/00221287-143-4-1317 Abstract >>
Within the framework of the international project aimed at the sequencing of the Bacillus subtilis genome, a 23.4 kb chromosome segment has been cloned and sequenced. This region (23 433 bp; 69 degrees-70 degrees of the genetic map) contains 17 complete ORFs and a partial one. A homology search for the products deduced from the 18 ORFs revealed that twelve of them had significant similarity to known proteins, including the quinolone-resistance protein, ABC transporter, aldehyde dehydrogenase, amino acid transporter, fosmidomycin-resistance protein, CDP-glucose 4,6-dehydratase, glucose-1-phosphate cytidyltransferase and cytochrome P450/NADPH-cytochrome P450 reductase.
|
190. |
( 1997 ) Analysis of the Bacillus subtilis genome: cloning and nucleotide sequence of a 62 kb region between 275 degrees (rrnB) and 284 degrees (pai). PMID : 9274030 : DOI : 10.1099/00221287-143-8-2769 Abstract >>
In the framework of the international project aimed at the sequencing of the Bacillus subtilis genome, five DNA fragments in the region between rrnB (275 degrees) and pai (284 degrees) were cloned by inverse and combinatorial long-range PCR and their nucleotide sequences were determined and analysed. Together these sequences constituted a contig of 62229 bp. On the basis of the position of Not1 and Stil restriction sites, the orientation and order of known genetic markers was determined to be pai (284 degrees)-degQ comQ comP comAA comAB-pbpD-kapB kinB patB-mcpB tipA mcpA tipB-rrnB (275 degrees). Fifty-four ORFs were detected. Thirteen of these coincided with known B. subtilis genes, and 41 new ORFs were found. Of the predicted new gene products, 12 showed no significant similarity to other known proteins, whereas ten showed strong similarity to proteins of other organisms with unknown function. Nineteen predicted proteins showed strong similarity to known proteins of other organisms, for instance a Na+/H+ antiporter system of Bacillus alcalophilus, a sugar transport system found in Mycoplasma genitalium, NADH-dependent butanol dehydrogenase of Clostridium acetobutylicum, glucose-6-phosphate isomerase A of B, subtilis, exo-1,4-alpha-glucosidase activity of Bacillus stearothermophilus and L-rhamnose isomerase of Escherichia coli.
|
191. |
( 1997 ) A 12 kb nucleotide sequence containing the alanine dehydrogenase gene at 279 degrees on the Bacillus subtilis chromosome. PMID : 9168598 : DOI : 10.1099/00221287-143-5-1489 Abstract >>
In the framework of the European project aimed at the sequencing of the Bacillus subtilis genome, a DNA fragment of 12315 bp was cloned and sequenced. The DNA fragment is located between rrnB (275 degrees) and pai (284 degrees). Twelve ORFs were predicted to encode putative proteins. Two of these (ald and yukl) coincided with known B. subtilis genes. The products of two other genes (yukK and yukL) showed significant similarity to known proteins present in databases, e.g. pyoverdin synthase of Pseudomonas aeruginosa and pristinamycin synthase D of Streptomyces pristinaespiralis.
|
192. |
( 1997 ) A new Bacillus subtilis gene, med, encodes a positive regulator of comK. PMID : 9335269 : DOI : 10.1128/jb.179.20.6244-6253.1997 PMC : PMC179536 Abstract >>
Bacillus subtilis degR, a positive regulator of the production of degradative enzymes, is negatively regulated by the competence transcription factor ComK which is overproduced in mecA null mutants. We used transposon Tn10 to search for a mutation that reduced the repression level of degR caused by a mecA mutation. A new gene exerting positive regulation on comK was obtained and designated med (suppressor of mecA effect on degR). Sequence determination, Northern analysis, and primer extension analyses revealed that the med gene contained an open reading frame (ORF) composed of 317 codons and was transcribed into an approximately 1,250-nucleotide mRNA together with its short downstream gene. The expression of comK is positively regulated by factors such as ComK itself, ComS (SrfA)-MecA, DegU, SinR, and AbrB. Quantitative analyses using comK'-'lacZ, srfA-lacZ, degU'-'lacZ, and sinR'-'lacZ fusions showed that disruption of med caused a significant decrease in comK expression in both mecA+ and mecA strains, while expression of srfA, sinR, and degU was not affected by the mutation. An epistatic analysis revealed that overproduction of ComK resulted in alteration of med expression, suggesting a regulatory loop between comK and med. Several possible mechanisms for positive regulation of comK by Med are discussed.
|
193. |
( 1997 ) The Bacillus subtilis 168 chromosome from sspE to katA. PMID : 9202460 : DOI : 10.1099/00221287-143-6-1855 Abstract >>
We have cloned and sequenced a 24.5 kb region of the Bacillus subtilis 168 chromosome spanning the sspE and katA genes. The region contains a ribosomal RNA operon, rrnD, a tRNA gene set, trnD and 17 ORFs, 16 with putative ribosome-binding sites. Four of the ORFs (ORF2, ORF14, ORF16 and ORF17) match to known B. subtilis genes (sspE, thiA, senS and katA). Eight of the remaining ORF products show similarities with proteins present in the databases, including an ATP-binding transport protein, a glutamate-1-semialdehyde aminotransferase, a thiol-specific antioxidant protein, a mitomycin radical oxidase and a ferric uptake regulation protein.
|
194. |
( 1997 ) Sequence and analysis of a 31 kb segment of the Bacillus subtilis chromosome in the area of the rrnH and rrnG operons. PMID : 9274029 : DOI : 10.1099/00221287-143-8-2763 Abstract >>
A 31141 bp continuous nucleotide sequence in the region from trnl to pNEXT52 in the Bacillus subtilis 168 genome was determined. In the region, there were 22 ORFs, two complete rRNA operons, and five tRNA genes. It was deduced that the function of one of the ORFs was similar to that of a sigma factor belonging to the ECF (extra-cytoplasmic functions) subfamily. The gene cluster feuA, B, C reported previously for other strains of B. subtilis was also found in strain 168 and located in this region.
|
195. |
( 1997 ) The Bacillus subtilis DivIVA protein targets to the division septum and controls the site specificity of cell division. PMID : 9219999 : DOI : 10.1046/j.1365-2958.1997.3811764.x Abstract >>
The Bacillus subtilis divIVA gene, first defined by a mutation giving rise to anucleate minicells, has been cloned and characterized. Depletion of DivIVA leads to inhibition of the initiation of cell division. The residual divisions that do occur are abnormally placed and sometimes misorientated relative to the long axis of the cell. The DivIVA phenotype can be suppressed by disruption of the MinCD division inhibitor, suggesting that DivIVA controls the topological specificity of MinCD action and thus septum positioning. A DivIVA-GFP fusion targets to new and used sites of cell division, consistent with it having a direct role in topological specification.
|
196. |
( 1997 ) Over-expression of the Saccharomyces cerevisiae exo-beta-1,3-glucanase gene together with the Bacillus subtilis endo-beta-1,3-1,4-glucanase gene and the Butyrivibrio fibrisolvens endo-beta-1,4-glucanase gene in yeast. PMID : 9226961 : Abstract >>
The EXG1 gene encoding the main Saccharomyces cerevisiae exo-beta-1,3-glucanase was cloned and over-expressed in yeast. The Bacillus subtilis endo-1,3-1,4-beta-glucanase gene (beg1) and the Butyrivibrio fibrisolvens endo-beta-1,4-glucanase gene (end1) were fused to the secretion signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1S) and inserted between the yeast alcohol dehydrogenase II gene promoter (ADH2P) and terminator (ADH2T). Constructs ADH2P-MF alpha 1S-beg1-ADH2T and ADH2P-MF alpha 1S-end 1-ADH2T designated BEG1 and END1, respectively, were expressed separately and jointly with EXG1 in S. cerevisiae. The construction of fur 1 ura3 S. cerevisiae strains allowed for the autoselection of these multicopy URA3-based plasmids in rich medium. Enzyme assays confirmed that co-expression of EXG1, BEG1 and END1 enhanced glucan degradation by S. cerevisiae.
|
197. |
( 1997 ) A Bacillus subtilis locus encoding several gene products affecting transport of cations. PMID : 9099864 : DOI : 10.1016/s0378-1119(96)00784-6 Abstract >>
A 3.6-kb DNA fragment from Bacillus subtilis was found to complement the K+ uptake-deficient Escherichia coli strain TK2420. Transformation with a pKLO61 plasmid harboring this fragment conferred the capacity to grow on a minimal medium containing only 10 mM K+. Insertional mutagenesis and subcloning identified a single gene responsible for the complementation. This gene coded for an apparent homolog of E. coli TrkA. Sequence analysis of the cloned region also revealed three additional open reading frames. These included: a gene encoding a homolog to the czcD gene product of Alcaligenes eutrophus, a lysR-type regulatory gene which was found to enhance Na+ resistance in E. coli NM81 (delta nhaA) in a separate complementation test, and an orfD with no significant similarity to sequences deposited in Genbank.
|
198. |
( 1997 ) Functional and genetic characterization of mcpC, which encodes a third methyl-accepting chemotaxis protein in Bacillus subtilis. PMID : 9353924 : DOI : 10.1099/00221287-143-10-3231 Abstract >>
A 3135 bp DNA segment downstream of the spl gene on the Bacillus subtilis chromosome was cloned and its nucleotide sequence determined. An open reading frame capable of encoding a putative protein of 654 amino acids with a calculated molecular mass of 72.1 kDa was identified. The deduced amino acid sequence was similar to the McpA and McpB proteins of B. subtilis. McpA and McpB encode different methyl-accepting chemotaxis proteins (MCPs). A mutant strain containing an antibiotic resistance DNA cassette inserted into the region containing the MCP-like reading frame suffered a complete loss of taxis to the amino acids cysteine, proline, threonine, glycine, serine, lysine, valine and arginine. The open reading frame was designated mcpC. The wild-type and an mcpC mutant strain were analysed for their content of methylated proteins and it was found that mcpC encodes a methylated membrane protein that has previously been designated H3. These results show that mcpC encodes a third MCP in B. subtilis. The transcription start site upstream of the mcpC gene was determined by primer extension analysis and it was found to be preceded by a potential promoter sequence that is recognized by the sigma D form of RNA polymerase. The level of beta-galactosidase expressed from a transcriptional mcpC-lacZ fusion was increased threefold when cells entered the stationary phase. No beta-galactosidase could be detected in a sigD genetic background.
|
199. |
( 1997 ) Sequencing of regions downstream of addA (98 degrees) and citG (289 degrees) in Bacillus subtilis. PMID : 9353931 : DOI : 10.1099/00221287-143-10-3305 Abstract >>
The nucleotide sequence of 17.3 kbp downstream of addA (98 degrees) on the Bacillus subtilis chromosome was determined. Twenty putative ORFs were identified. Three of them coincided with known B. subtilis genes, addA, sbcD and wprA. The product of four other ORFs showed similarity to SbcC of Clostridium perfringens, CotH of B. subtilis, 2-hydroxyhepta-2,4-diene-1,7-diodate isomerase of Methanococcus jannaschi and a putative ORF of Pseudomonas syringae. In addition, a sequence of 7.6 kbp downstream of citG (189 degrees) was analysed. Among 10 putative ORFs identified, two coincided with known genes, citG and mrgA, whilst three showed homology with X86780, a sensory protein kinase of Streptomyces hygroscopicus, an alkaline phosphatase regulatory protein and a hypothetical protease, YyxA, of B. subtilis.
|
200. |
( 1997 ) Cloning and characterization of the Bg/II restriction-modification system reveals a possible evolutionary footprint. PMID : 9073062 : DOI : 10.1016/s0378-1119(96)00638-5 Abstract >>
Bg/II, a type II restriction-modification (R-M) system from Bacillus globigii, recognizes the sequence 5'-AGATCT-3'. The system has been cloned into E. coli in multiple steps: first the methyltransferase (MTase) gene, bglIIM, was cloned from B. globigii RUB561, a variant containing an inactivated endonuclease (ENase) gene (bglIIR). Next the ENase protein (R.BglII) was purified to homogeneity from RUB562, a strain expressing the complete R-M system. Oligonucleotide probes specific for the 5' end of the gene were then synthesized and used to locate bglIIR, and the gene was isolated and cloned in a subsequent step. The nucleotide sequence of the system has been determined, and several interesting features have been found. The genes are tandemly arranged, with bglIIR preceding bglIIM. The amino acid sequence of M.BglII is compared to those of other known MTases. A third gene encoding a protein with sequence similarity to known C elements of other R-M systems is found upstream of bglIIR. This is the first instance of a C gene being associated with an R-M system where the R and M genes are collinear. In addition, open reading frames (ORFs) resembling genes involved with DNA mobility are found in close association with BglII. These may shed light on the evolution of the R-M system.
|
201. |
( 1997 ) Molecular cloning and nucleotide sequence of an endo-1,5-alpha-L-arabinase gene from Bacillus subtilis. PMID : 9183009 : DOI : 10.1111/j.1432-1033.1997.t01-1-00708.x Abstract >>
The nucleotide sequence of the gene encoding an endo-1,5-alpha-L-arabinase (protopectinase C) of Bacillus subtilis was determined by sequencing fragments amplified by the cassette-ligation-mediated PCR (CLM-PCR). The gene covering the start and stop codon was amplified by PCR with two specific primers, which were designed from the sequence data determined by CLM-PCR. An approximately 1.5-kb amplification product was cloned into the vector pUC119, forming a plasmid termed pPPC. An ORF that encodes the arabinase composed of 324 amino acids including a 33-amino-acid signal peptide was assigned. Comparison of the deduced amino acid sequence of the enzyme with that of an Aspergillus niger endoarabinase showed 37% identity in a 207-amino-acid overlap. The optimal nucleotide sequence for catabolite repression of B. subtilis was found upstream of the structural gene. In a culture of Escherichia coli DH5alpha cells harboring pPPC, no arabinase activity was detected, either intracellularly or extracellularly, suggesting that the B. subtilis promotor is not functional in this transformant. In B. subtilis IFO 3134 strain, production of protopectinase C was repressed by readily metabolizable carbohydrates. In contrast, productivity (total enzyme activity/bacterial growth) of the enzyme was increased about fourfold in the presence of 0.75 M potassium phosphate in the culture medium. The phosphate anion seemed to be involved in the stimulation of protopectinase C production in this stain.
|
202. |
( 1997 ) Sequence of the Bacillus subtilis genome region in the vicinity of the lev operon reveals two new extracytoplasmic function RNA polymerase sigma factors SigV and SigZ. PMID : 9308178 : DOI : 10.1099/00221287-143-9-2939 Abstract >>
Two regions with sizes 18,900 and 25,400 bp, which join previously known contigs containing levRDEFG, aadK and blt genes near 235 degrees of the Bacillus subtilis chromosome, were sequenced. Among others, two genes, which encode proteins homologous to RNA polymerase sigma-factors, were identified within this region. The gene products designated SigV and SigZ, show the highest homology with sigma-factors encoded by the gene carQ of Myxococcus xanthus and sigX (formerly orfX20) of B. subtilis, correspondingly. All sigma-factors which show statistically significant homology to SigV and SigZ, belong to the ECF (extracytoplasmic functions) subfamily. SigV and SigZ do not have N-terminal sequence which prevents such proteins from binding to DNA without RNA polymerase core enzyme.
|
203. |
( 1996 ) Sequence analysis of the Bacillus subtilis chromosome region between the serA and kdg loci cloned in a yeast artificial chromosome. PMID : 8760912 : DOI : 10.1099/13500872-142-8-2005 Abstract >>
The standard strategies of genome sequencing based on lambda-vector or cosmid libraries are only partially applicable to AT-rich Gram-positive bacteria because of the problem of instability of their chromosomal DNA in heterologous hosts like Escherichia coli. One complete collection of ordered clones known for such bacteria is that of Bacillus subtilis, established by using yeast artificial chromosomes (YACs). This paper reports the results of the direct use of one of the YAC clones from the above collection for the sequencing of the region cloned in it. The strategy applied consisted of the following: (i) construction of M13 banks of the partially purified YAC DNA and sequencing of 800 M13 clones chosen at random; (ii) directed selection of M13 clones to sequence by using marginal contig fragments as hybridization probes; (iii) direct sequencing of joining PCR fragments obtained by combinations of primers corresponding to the ends of representative contigs. The complete 104,109 bp insert sequence of this YAC clone was thus established. The strategy used allowed us to avoid resequencing the two largest, previously sequenced, contigs (13,695 and 20,303 bp) of the YAC insert. We propose that the strategy used can be applied to the sequencing of the whole bacterial genome without intermediate cloning, as well as for larger inserts of eukaryotic origin cloned in YACs. Sequencing of the insert of the YAC clone 15-6B allowed us to establish the contiguous sequence of 127 kb from spollA to kdg. The organization of the newly determined region is presented. Of the 138 ORFs identified in the spollA-kdg region, 57 have no clear putative function from their homology to proteins in the databases.
|
204. |
( 1993 ) The antimicrobial effect of a structural variant of subtilin against outgrowing Bacillus cereus T spores and vegetative cells occurs by different mechanisms. PMID : 8434932 : PMC : PMC202163 Abstract >>
Subtilin is a ribosomally synthesized antimicrobial peptide that contains several unusual amino acids as a result of posttranslational modifications. Site-directed mutagenesis was employed to construct a structural variant of subtilin in which the unusual dehydroalanine (Dha) residue at position 5 was changed to alanine. Proton nuclear magnetic resonance spectroscopy, amino acid composition, and N-terminal sequence analysis established that the mutation did not disrupt posttranslational processing of the precursor peptide. This mutant subtilin was devoid of antimicrobial activity as assessed by its lack of inhibitory effects on outgrowth of Bacillus cereus T spores. However, this same mutant subtilin was fully active with respect to its ability to induce lysis of vegetative B. cereus T cells. Because an intact Dha-5 residue is required in the one instance but not in the other, it was concluded that the molecular mechanism by which subtilin inhibits (without lysis) spore outgrowth is not the same as the mechanism by which it inhibits (with lysis) vegetative cells.
|
205. |
( 1996 ) New genes in the 170 degrees region of the Bacillus subtilis genome encode DNA gyrase subunits, a thioredoxin, a xylanase and an amino acid transporter. PMID : 8969507 : DOI : 10.1099/13500872-142-11-3097 Abstract >>
A DNA contig of 26.2 kb covering the 170 degrees region of the Bacillus subtilis strain 168 genome was isolated and sequenced. For DNA isolation, suitable restriction sites at the end of previously known genes were chosen to amplify adjacent unknown DNA regions by inverse PCR. On the basis of the DNA sequence, 26 ORFs were identified of which eglS and ccdA, as well as part of citB and tkt have been described previously. Here we report the complete sequences of the aconitase (citB) and transketolase (tkt) genes. Of the other proteins encoded on the 26.2 kb fragment, eight revealed similarities to previously described proteins. These included a pair of newly identified DNA gyrase subunits A (grlA) and B (grlB), a sodium/proton-dependent alanine carrier (alsT), a member of the thioredoxin family (TlpA), an endo-1,4-beta-xylanase (xynD) and a response regulator protein. Comparison of the physical and the genetic maps revealed several differences. According to its flanking sequences the lexA (dinR) gene which was previously mapped at 162 degrees was found to be adjacent to yneA localized at 170 degrees. Genes citB and eglS were located the opposite way round and closer together than expected from the genetic map (citB at 173 degrees and eglS at 170 degrees). The prkA gene, which was mapped at 169 degrees, was not present on the respective fragment. Sequence comparison actually showed that prkA is located close to 70 degrees on the B. subtilis genome.
|
206. |
( 1996 ) A new enzyme superfamily - the phosphopantetheinyl transferases. PMID : 8939709 : Abstract >>
All polyketide synthases, fatty acid synthases, and non-ribosomal peptide synthetases require posttranslational modification of their constituent acyl carrier protein domain(s) to become catalytically active. The inactive apoproteins are converted to their active holo-forms by posttranslational transfer of the 4'-phosphopantetheinyl (P-pant) moiety of coenzyme A to the sidechain hydroxyl of a conserved serine residue in each acyl carrier protein domain. The first P-pant transferase to be cloned and characterized was the recently reported Escherichia coli enzyme ACPS, responsible for apo to holo conversion of fatty acid synthase. Surprisingly, initial searches of sequence databases did not reveal any proteins with significant peptide sequence similarity with ACPS. Through refinement of sequence alignments that indicated low level similarity with the ACPS peptide sequence, we identified two consensus motifs shared among several potential ACPS homologs. This has led to the identification of a large family of proteins having 12-22 % similarity with ACPS, which are putative P-pant transferases. Three of these proteins, E. coli EntD and o195, and B. subtilis Sfp, have been overproduced, purified and found to have P-pant transferase activity, confirming that the observed low level of sequence homology correctly predicted catalytic function. Three P-pant transferases are now known to be present in E. coli (ACPS, EntD and o195); ACPS and EntD are specific for the activation of fatty acid synthase and enterobactin synthetase, respectively. The apo-protein substrate for o195 has not yet been identified. Sfp is responsible for the activation of the surfactin synthetase. The specificity of ACPS and EntD for distinct P-pant-requiring enzymes suggests that each P-pant-requiring synthase has its own partner enzyme responsible for apo to holo activation of its acyl carrier domains. This is the first direct evidence that in organisms containing multiple P-pant-requiring pathways, each pathway has its own posttranslational modifying activity.
|
207. |
( 1996 ) Sequence analysis of a 50 kb region between spo0H and rrnH on the Bacillus subtilis chromosome. PMID : 8969501 : DOI : 10.1099/13500872-142-11-3039 Abstract >>
The 49630 bp spo0H-rrnH region of the Bacillus subtilis genome has been fully sequenced. The sequence contains one partial and 62 complete ORFs, one partial and three complete rRNA genes and a cluster of six tRNA genes. The direction of the transcription and translation of 61 ORFs is the same as that of the movement of the replication fork. A homology search of 40 ORFs in newly determined sequence revealed that 27 of them had significant similarity to known proteins such as elongation factor G, elongation factor Tu, pseudouridine synthase I and ribsosomal proteins. Two adjacent genes, ybaD and ybaE, appeared to encode proteins belonging to the ATP-binding cassette (ABC) family.
|
208. |
( 1996 ) Molecular cloning and nucleotide sequence of the gene encoding phosphate-inducible pectin lyase of Bacillus subtilis. PMID : 8977121 : DOI : 10.1016/s0014-5793(96)01257-4 Abstract >>
The gene encoding the pectin lyase (PNL; EC 4.2.2.10) of Bacillus subtilis has been cloned, sequenced, and characterized. A coding sequence for the PNL composed of 345 amino acids including a 24-amino-acid signal peptide was assigned. No sequence resembling a LexA binding site was found upstream of the structural gene. Furthermore, PNL activity of the gene product expressed in Escherichia coli DH5alpha was detected intracellularly, which might suggest that expression of the gene was not controlled by RecA. Regulation of the gene expression seemed to be quite different from that of other bacterial PNL genes previously reported.
|
209. |
( 1993 ) Metalloregulation in Bacillus subtilis: isolation and characterization of two genes differentially repressed by metal ions. PMID : 8396117 : DOI : 10.1128/jb.175.17.5428-5437.1993 PMC : PMC206598 Abstract >>
We have cloned two metal-regulated genes (mrgA and mrgC) from Bacillus subtilis by using transposon Tn917-lacZ. Both were isolated as iron-repressible gene fusions, but the metal specificity and sensitivity of gene repression are distinct. Transcription of mrgA-lacZ is induced at the end of logarithmic-phase growth in minimal medium, and this induction is prevented by excess manganese, iron, cobalt, or copper. Limitation for metal ions is sufficient for mrgA-lacZ induction, since resuspension in medium lacking both manganese and iron rapidly induces transcription. Transcription of mrgC-lacZ is also induced by iron deprivation but is not repressed by added manganese or other metal ions. Expression of mrgC-lacZ and a 2,3-dihydroxybenzoic acid-based siderophore is repressed in parallel by iron, and in both cases, only iron effects repression. We have cloned and sequenced the promoter and regulatory regions of both mrgA and mrgC. Both genes are preceded by a predicted sigma A-dependent promoter element with overlapping sequences similar to the iron box consensus element for recognition by the Escherichia coli ferric uptake regulator protein (Fur). Mutation of the putative iron box for gene mrgC leads to partial derepression in iron-replete medium.
|
210. |
( 1995 ) The endogenous Bacillus subtilis (natto) plasmids pTA1015 and pTA1040 contain signal peptidase-encoding genes: identification of a new structural module on cryptic plasmids. PMID : 8801417 : DOI : 10.1111/j.1365-2958.1995.mmi_17040621.x Abstract >>
Various strains of Bacillus subtilis (natto) contain small cryptic plasmids that replicate via the rolling-circle mechanism. Like plasmids from other Gram-positive bacteria, these plasmids are composed of several distinct structural modules. A new structural module was identified on the B. subtilis plasmids pTA1015 and pTA1040. It is composed of two genes: one specifies an unidentified protein with a putative signal peptide; and the other (sipP) specifies a functional type 1 signal peptidase (SPase). The homologous, but non-identical, sipP genes of the two plasmids are the first identified plasmid-specific SPase-encoding genes. With respect to structure and activity, the corresponding enzymes (denoted SipP) are highly similar to the chromosomally encoded SPase, SipP, of B. subtillis and several newly identified SPases of other bacilli. Our findings suggest that plasmid-encoded SPases have evolved because, of under certain conditions, SPase can be a limiting factor for protein secretion in B. subtilis.
|
211. |
( 1997 ) A 10.3 kbp segment from nprB to argJ at the 102 degrees region of the Bacillus subtilis chromosome. PMID : 9025291 : DOI : 10.1099/00221287-143-1-175 Abstract >>
The approximately 10 kbp region encompassing nprB and argJ at 102 degrees on the Bacillus subtilis chromosome was sequenced, revealing 12 ORFs, four known genes (argJ, argC, ipi and nprB) and two genes, yitY and yitS, whose products respectively display significant homology with L-gulono-gamma-lactone oxidase of rat and dihydrofolate reductase of Staphylococcus aureus. The data also indicated that nprB mapped to a different position than previously published.
|
212. |
( 1995 ) Determination of a 17,484 bp nucleotide sequence around the 39 degrees region of the Bacillus subtilis chromosome and similarity analysis of the products of putative ORFs. PMID : 8574415 : DOI : 10.1099/13500872-141-12-3241 Abstract >>
We have determined a 17,484 bp nucleotide sequence around the 39 degrees region, located about 480 kb downstream from the zero position of the Bacillus subtilis chromosome physical map. Among the 17 putative ORFs identified, orf1 and orf2 seem to correspond to mtlA and mtlB, encoding mannitol-specific phosphotransferase enzyme II and mannitol-1-phosphate dehydrogenase, respectively. orf4 seems to be another signal peptidase I gene (sipS) of B. subtilis. The putative products of six ORFs were similar to known proteins in data banks, namely a hypothetical 29.7 kDa protein of Escherichia coli (Orf7), a lactam utilization protein (Orf8), the urea amidolyase of yeast (Orf12), the IcIR regulatory protein for aceAB of Salmonella typhimurium (Orf13), penicillin-binding protein 2 (Orf16) and aryl-alcohol dehydrogenase (Orf17). The amino acid sequence of Orf3 showed 34% identity with that of LeuC of B. subtilis, though they seem to be functionally different. The remaining seven ORFs did not show similarity to any known proteins.
|
213. |
( 1996 ) Cold shock stress-induced proteins in Bacillus subtilis. PMID : 8755892 : DOI : 10.1128/jb.178.15.4611-4619.1996 PMC : PMC178231 Abstract >>
Bacteria respond to a decrease in temperature with the induction of proteins that are classified as cold-induced proteins (CIPs). Using two-dimensional gel electrophoresis, we analyzed the cold shock response in Bacillus subtilis. After a shift from 37 to 15 degrees C the synthesis of a majority of proteins was repressed; in contrast, 37 proteins were synthesized at rates higher than preshift rates. One hour after cold shock, the induction of CIPs decreased, and after 2 h, general protein synthesis resumed. The identified main CIPs were excised from two-dimensional gels and were subjected to microsequencing. Three small acidic proteins that showed the highest relative induction after cold shock were highly homologous and belonged to a protein family of which one member, the major cold shock protein, CspB, has previously been characterized. Two-dimensional gel analyses of a cspB null mutant revealed that CspB affects the level of induction of several CIPs. Other identified CIPs function at various levels of cellular physiology, such as chemotaxis (CheY), sugar uptake (Hpr), translation (ribosomal proteins S6 and L7/L12), protein folding (PPiB), and general metabolism (CysK, Ilvc, Gap, and triosephosphate isomerase).
|
214. |
( 1994 ) Role of the D-alanyl carrier protein in the biosynthesis of D-alanyl-lipoteichoic acid. PMID : 8300523 : DOI : 10.1128/jb.176.3.681-690.1994 PMC : PMC205105 Abstract >>
D-Alanyl-lipoteichoic acid (D-alanyl-LTA) is a widespread macroamphiphile which plays a vital role in the growth and development of gram-positive organisms. The biosynthesis of this polymer requires the enzymic activation of D-alanine for its transfer to the membrane-associated LTA (mLTA). A small, heat-stable, and acidic protein that is required for this transfer was purified to greater than 98% homogeneity from Lactobacillus casei ATCC 7469. This protein, previously named the D-alanine-membrane acceptor ligase (V. M. Reusch, Jr., and F. C. Neuhaus, J. Biol. Chem. 246:6136-6143, 1971), functions as the D-alanyl carrier protein (Dcp). The amino acid composition, beta-alanine content, and N-terminal sequence of this protein are similar to those of the acyl carrier proteins (ACPs) of fatty acid biosynthesis. The isolation of Dcp and its derivative, D-alanyl approximately Dcp, has allowed the characterization of two novel reactions in the pathway for D-alanyl-mLTA biosynthesis: (i) the ligation of Dcp with D-alanine and (ii) the transfer of D-alanine from D-alanyl approximately Dcp to a membrane acceptor. It has not been established whether the membrane acceptor is mLTA or another intermediate in the pathway for D-alanyl-mLTA biosynthesis. Since the D-alanine-activating enzyme (EC 6.1.1.13) catalyzes the ligation reaction, this enzyme functions as the D-alanine-Dcp ligase (Dcl). Dcl also ligated the ACPs from Escherichia coli, Vibrio harveyi, and Saccharopolyspora erythraea with D-alanine. In contrast to the relaxed specificity of Dcl in the ligation reaction, the transfer of D-alanine to the membrane acceptor was highly specific for Dcp and did not occur with other ACPs. This transfer was observed by using only D-[14C]alanyl approximately Dcp and purified L. casei membranes. Thus, D-alanyl approximately Dcp is an essential intermediate in the transfer of D-alanine from Dcl to the membrane acceptor. The formation of D-alanine esters of mLTA provides a mechanism for modulating the net anionic charge in the cell wall.
|
215. |
( 1994 ) The Bacillus subtilis nucleoid-associated protein HPB12 strongly compacts DNA. PMID : 8282710 : DOI : 10.1128/jb.176.1.50-60.1994 PMC : PMC205013 Abstract >>
The HPB12 protein from the nucleoid of Bacillus subtilis was previously described, and its DNA binding properties have been reported previously (V. Salti, F. Le H?garat, and L. Hirschbein, Biochim. Biophys. Acta 1009:161-167, 1989). The DNA-HPB12 complexes were examined by electron microscopy. They appeared as short, slightly curved rods whereas naked DNA showed no compaction. Since only a small number of complexes with an intermediate degree of folding were observed, it appears that the nucleoid-associated protein HPB12 binds cooperatively to DNA, confirming Salti et al. (V. Salti, F. Le H?garat, and L. Hirschbein, Biochim. Biophys. Acta 1009:161-167, 1989), and gives rise to a tightly compacted DNA-protein complex. N-terminal sequencing of purified HPB12 showed that all but one of the first 26 amino acids were identical to those of the L24 ribosomal protein.
|
216. |
( 1993 ) Characterization of the gene encoding an intracellular proteinase inhibitor of Bacillus subtilis and its role in regulation of the major intracellular proteinase. PMID : 8226659 : DOI : 10.1128/jb.175.22.7130-7137.1993 PMC : PMC206853 Abstract >>
The gene (ipi) for an intracellular proteinase inhibitor (BsuPI) from Bacillus subtilis was cloned and found to encode a polypeptide consisting of 119 amino acids with no cysteine residues. The deduced amino acid sequence contained the N-terminal amino acid sequence of the inhibitor, which was chemically determined previously, and showed no significant homology to any other proteinase inhibitors. Analysis of the transcription initiation site and mRNA showed that the ipi gene formed an operon with an upstream open reading frame with an unknown function. The transcriptional control of ipi gene expression was demonstrated by Northern (RNA) blot analysis, and the time course of transcriptional enhancement roughly corresponded to the results observed at the protein level. Strains in which the ipi gene was disrupted or in which BsuPI was overexpressed constitutively sporulated normally. Analysis of the time course of production of the intracellular proteinase and proteinase inhibitor in these strains suggested that BsuPI directly regulated the major intracellular proteinase (ISP-1) activity in vivo.
|
217. |
( 1993 ) The menaquinol oxidase of Bacillus subtilis W23. PMID : 8394685 : Abstract >>
The quinol oxidase appears to be mainly responsible for the oxidation of the bacterial MKH2 in Bacillus subtilis W23 growing with either glucose or succinate. The activity of the enzyme was maximum with dimethylnaphthoquinol, a water-soluble analogue of the bacterial menaquinol. Menadiol or duroquinol were less actively respired, and naphthoquinol was not oxidized at all. After fourtyfold purification the isolated enzyme contained 5.3 mumol cytochrome aa3 per gram of protein and negligible amounts of cytochrome b and c. The turnover number based on cytochrome aa3 was about 10(3) electrons.s-1 at pH 7 and 37 degrees C. The preparation consisted mainly of a M(r) 57,000 and a M(r) 36,000 polypeptide. The N-terminal amino acid sequence of the latter polypeptide differed from that predicted by the qoxA gene of B. subtilis strain 168 (Santana et al. 1992), in that asp-14 predicted by qoxA was missing in the M(r) 36,000 polypeptide.
|
218. |
( 1996 ) Molecular analysis of an operon in Bacillus subtilis encoding a novel ABC transporter with a role in exoprotein production, sporulation and competence. PMID : 8581172 : DOI : 10.1099/13500872-142-1-71 Abstract >>
The levels of exoamylase and other exoenzymes of Bacillus subtilis are pleiotropically decreased by the ecs-26 (prs-26) and ecs-13 (prs-13) mutations. These mutations also cause a competence- and sporulation-deficient phenotype. In the present work, the ecs locus, which has been defined by the ecs-26 and ecs-13 mutations, was cloned and sequenced. Sequence analysis revealed a putative operon of three ORFs (ecsA, ecsB and ecsC). ecsA can encode a putative polypeptide of 248 amino acid residues containing an ATP-binding site. The polypeptide shows about 30% sequence similarity with the ATP-binding components of numerous membrane transporters of the ABC-type (ATP-binding cassette transporters or traffic ATPases). The ecs-26 mutation was found to result from a transition of one base pair chaning the glycine164 of EcsA to a glutamic acid residue in the vicinity of the putative ATP-binding pocket. ecsB was predicted to encode a hydrophobic protein with six membrane-spanning helices in a pattern found in other hydrophobic components of ABC transporters. The properties deduced for the ecsA and ecsB gene products are consistent with the interpretation that ecs encodes a novel ABC-type membrane transporter of B. subtilis. The third ORF, ecsC, can encode a putative polypeptide of 237 amino acid residues. The polypeptide does not resemble components of ABC transporters.
|
219. |
( 1994 ) Expression of the Bacillus subtilis spoIVCA gene, which encodes a site-specific recombinase, depends on the spoIIGB product. PMID : 8300549 : DOI : 10.1128/jb.176.3.935-937.1994 PMC : PMC205134 Abstract >>
The Bacillus subtilis spoIVCA gene encodes a site-specific recombinase which creates a sigK gene by DNA rearrangement. We have determined the transcription initiation point of the spoIVCA gene and found that (i) the spoIVCA promoter contains sequences which are similar to -10 and -35 regions of promoters recognized by sigma E and (ii) mutation of spoIIGB, which encodes pro-sigma E, blocked the expression of spoIVCA.
|
220. |
( 1994 ) Genes involved in self-protection against the lantibiotic subtilin produced by Bacillus subtilis ATCC 6633. PMID : 8085823 : PMC : PMC201725 Abstract >>
Subtilin is a ribosomally synthesized peptide antibiotic produced by Bacillus subtilis ATCC 6633. Recently, we reported regarding genes spaB, spaT, and spaC (C. Klein, C. Kaletta, N. Schnell, and K.-D. Entian, Appl. Environ. Microbiol. 58:132-142, 1992) which are involved in the biosynthesis of subtilin, and genes spaR and spaK (C. Klein, C. Kaletta, and K.-D. Entian, Appl. Environ. Microbiol. 59:296-303, 1993), which regulate subtilin biosynthesis via a histidine kinase/response regulator system. Further sequence analysis revealed the presence of three additional open reading frames, spaI, spaF, and spaG, downstream of the structural gene spaS. The spaI gene encodes a hydrophilic 19.3-kDa lipoprotein containing a consensus signal sequence, indicating that this protein might be membrane anchored. A similar gene, nisI, has been identified in the nisin producer. SpaF shows strong homology to members of the family of ABC transporters. spaG encodes a hydrophobic protein which might form the active transporter together with SpaF. Gene disruption mutants in all three genes were still able to produce subtilin; however, these mutants were more sensitive to subtilin than the wild-type strain. These results show that these genes are involved in the immunity mechanism of the producer strain. A similar involvement of an ABC transporter in the self-protection mechanism has been described for the McbE and McbF transporter, which confers immunity against microcin B17 in Escherichia coli. Mutants containing mutations in the genes spaR and spaK, which are responsible for regulation of subtilin biosynthesis, also became more sensitive to subtilin.(ABSTRACT TRUNCATED AT 250 WORDS)
|
221. |
( 1994 ) Molecular characterization and cloning of an esterase which inactivates the macrolide toxin brefeldin A. PMID : 8106385 : Abstract >>
The macrolide antibiotic brefeldin A (BFA) was described as a phytotoxin and pathogenicity factor from Alternaria carthami Chowdhury, the causal agent of a devastating blight disease in safflower (Carthamus tinctorius L.). The toxin is known to inhibit the endoplasmic reticulum-Golgi flux and processing. Conventional breeding of safflower for resistance to the Alternaria blight disease has failed, and in situ detoxification of brefeldin A is a novel approach for the protection of field-grown safflower plants from the blight disease. As a first step towards this goal, a strain of Bacillus subtilis has been isolated which is capable of hydrolyzing brefeldin A to a non-toxic metabolite, brefeldin A acid. The BFA esterase was purified to homogeneity from B. subtilis extracts and shown to consist of a monomeric peptide of approximately 40 kDa. Besides brefeldin A, the esterase hydrolyzed ethyl valerate, which structurally resembles the lactone portion in the brefeldin A molecule, but failed to accept other macrolides such as erythromycin or zearalenone. Roughly 12% of the esterase sequence was identified by microsequencing tryptic peptides and the N terminus, which lacked a methionine leader residue. Corresponding oligonucleotide probes were employed to clone the esterase gene in pUC18. One of seven clones was sequenced and shown to code for the full size esterase protein of 372 amino acid residues. The esterase gene was subcloned in pT7-7 and expressed in Escherichia coli yielding a fusion protein with a specific esterase activity 3-fold over that of the enzyme purified from B. subtilis. The cloned esterase provides the basis for the generation of transgenic safflower plants as a valuable asset in the research on nonspecific phytotoxins and in supporting breeding for Alternaria blight resistance.
|
222. |
( 1993 ) Biosynthesis of the lantibiotic subtilin is regulated by a histidine kinase/response regulator system. PMID : 8439156 : PMC : PMC202094 Abstract >>
Subtilin is a lanthionine-containing peptide antibiotic (lantibiotic) which is produced by Bacillus subtilis ATCC 6633. Upstream from the structural gene of subtilin, spaS, three genes (spaB, spaT, and spaC) which are involved in the biosynthesis of subtilin have been identified (C. Klein, C. Kaletta, N. Schnell, and K.-D. Entian, Appl. Environ. Microbiol. 58:132-142, 1992). By using a hybridization probe specific for these genes, the DNA region downstream from spaS was isolated. Further subcloning revealed a 5.2-kb KpnI-HindIII fragment on which two open reading frames, spaR and spaK, were identified approximately 3 kb downstream from spaS. The spaR gene encodes an open reading frame of 220 amino acids with a predicted molecular mass of 25.6 kDa. SpaR shows 35% similarity to positive regulatory factors OmpR and PhoB. The spaK gene encodes an open reading frame of 387 amino acids with a predicted molecular mass of 44.6 kDa and was highly similar to histidine kinases previously described (PhoM, PhoR, and NtrB). Hydrophobicity blots suggested two membrane-spanning regions. Thus, spaR and spaK belong to a recently identified family of environmentally responsive regulators. These results indicated a regulatory function of spaR and spaK in subtilin biosynthesis. Indeed, batch culture experiments confirmed the regulation of subtilin biosynthesis starting in the mid-logarithmic growth phase and reaching its maximum in the early stationary growth phase. Gene deletions within spaR and spaK yielded subtilin-negative mutants, which confirms that subtilin biosynthesis is under the control of a two-component regulatory system.(ABSTRACT TRUNCATED AT 250 WORDS)
|
223. |
( 1994 ) A Bacillus subtilis bglA gene encoding phospho-beta-glucosidase is inducible and closely linked to a NADH dehydrogenase-encoding gene. PMID : 8125345 : DOI : 10.1016/0378-1119(94)90735-8 Abstract >>
A 2.7-kb HindIII fragment from Bacillus subtilis contains an open reading frame (ORF) encoding a protein with homology to an Escherichia coli phospho-beta-glucosidase B (PBG B). The B. subtilis gene was induced by aromatic beta-glucosides, as judged by Northern hybridization and could complement an E. coli bglB mutant. Immediately down-stream from this B. subtilis bglA gene, there was a partial ORF on the opposite strand which encoded a polypeptide with extensive homology to NADH dehydrogenase from an alkalophilic Bacillus. These genes were mapped to 340 degrees between hut and gnt on the B. subtilis chromosome. Disruption of these genes by insertion of a neomycin-resistance-encoding gene (neo) did not result in any phenotypic changes comparable to those found in E. coli mutants.
|
224. |
( 1994 ) Human immunoglobulin VH and D segments on chromosomes 15q11.2 and 16p11.2. PMID : 7951227 : DOI : 10.1093/hmg/3.6.853 Abstract >>
In addition to the major human immunoglobulin heavy-chain locus on chromosome 14q32.3, VH and D segments are known to be present on chromosomes 15 and 16. We have now amplified and sequenced 24 such VH segments from somatic cell hybrids and have assigned them to 15q11.2 and 16p11.2 using cosmid and yeast artificial chromosome clones. In addition, we have located a cluster of D segments on 15q11.2, previously thought to be located on 14q32.3. We propose that the segments on chromosome 16 arose by an interchromosomal duplication and identify the corresponding region on chromosome 14. Taken together with the completion of a map of the human VH locus on 14q32.3, the total number of VH segments now identified is 117. We can now account for most, if not all human germ-line VH segments.
|
225. |
( 1993 ) Missense mutations in the Bacillus subtilis gnt repressor that diminish operator binding ability. PMID : 8510140 : DOI : 10.1006/jmbi.1993.1270 Abstract >>
The Bacillus subtilis gnt operon is negatively regulated by the gnt repressor (GntR, 243 amino acids), which is antagonized by gluconate. The GntR protein belongs to a new family of bacterial regulatory proteins (GntR family). To locate the DNA-binding domain of the GntR protein, we obtained mutations of this protein, by hydroxylamine mutagenesis, which diminish its operator binding ability. Sequence analysis of these mutations indicated that the mutant GntR proteins (GntR43L, GntR66T, GntR74K and GntR75Q) had amino acid substitutions (Ser43 to Leu, Ala66 to Thr, Glu74 to Lys and Arg75 to Gln), respectively. They were all located within the N-terminal conserved region of the GntR family. In vivo and in vitro analysis of these GntR proteins indicated that their relative operator binding abilities became weaker in the order of GntR (wild type), GntR66T, GntR75Q, GntR74K and GntR43L. The equilibrium dissociation constants of GntR (wild type), GntR66T, GntR75Q and GntR74K as to operator binding were determined by gel retardation assays to be 0.43, 2.6, 4.2 and 8.8 M x 10(-10), respectively.
|
226. |
( 1994 ) Isolation and characterization of a hydrogen peroxide resistant mutant of Bacillus subtilis. PMID : 8180695 : DOI : 10.1099/13500872-140-2-297 Abstract >>
A mutant of Bacillus subtilis has been isolated by continuous selection in increasing concentrations of H2O2. It grew with a doubling time of 85 min in minimal medium containing 150 mM H2O2, whereas the wild-type parent lysed in 100 mM H2O2. The mutant was also more resistant to organic peroxides than the wild-type. Further resistance to H2O2 could not be induced by pretreatment with low concentrations of the oxidant. The mutant synthesized a number of proteins at a much higher rate than the wild-type, including constitutive synthesis of all of the proteins which were induced by H2O2 in the wild-type. Four of these proteins were sequenced; three were identified as catalase and two subunits of alkyl hydroperoxide reductase. Two proteins whose synthesis was repressed in the mutant were sequenced, and one was identified as flagellin. The mutant grew as non-flagellated, partially septate, filaments of cells, and fragments of flagella were seen in the surrounding medium.
|
227. |
( 1994 ) RocR, a novel regulatory protein controlling arginine utilization in Bacillus subtilis, belongs to the NtrC/NifA family of transcriptional activators. PMID : 8113162 : DOI : 10.1128/jb.176.5.1234-1241.1994 PMC : PMC205184 Abstract >>
Bacillus subtilis can use ammonium and various amino acids as sole nitrogen sources. The utilization of arginine or ornithine is abolished in a sigma L-deficient strain of B. subtilis, indicating that one or several genes involved in this pathway are transcribed by a sigma L-RNA polymerase holoenzyme. Three B. subtilis genes, called rocA, rocB, and rocC, which seem to form an operon, were found near the sacTPA locus (P. Glaser, F. Kunst, M. Arnaud, M.-P. Coudart, W. Gonzales, M.-F. Hullo, M. Ionescu, B. Lubochinsky, L. Marcelino, I. Moszer, E. Presecan, M. Santana, E. Schneider, J. Schweizer, A. Vertes, G. Rapport, and A. Danchin, Mol. Microbiol. 10:371-384, 1993). The expression of this putative operon is induced by arginine and is sigma L dependent. Mutants impaired in the transcription of rocA were obtained. One of these mutants was used as recipient to clone and sequence a new regulatory gene, called rocR. This gene encodes a polypeptide of 52 kDa which belongs to the NtrC/NifA family of transcriptional activators. Upstream activating sequences highly similar to those of NtrC in Escherichia coli were also identified upstream from the rocABC genes. A B. subtilis strain containing a rocR null mutation is unable to use arginine as the sole nitrogen source, indicating that RocR is a positive regulator of arginine catabolism. After LevR, RocR is the second example of an activator stimulating sigma 54-dependent promoters in gram-positive bacteria.
|
228. |
( 1993 ) Multisensory activation of the phosphorelay initiating sporulation in Bacillus subtilis: identification and sequence of the protein kinase of the alternate pathway. PMID : 8497199 : DOI : 10.1111/j.1365-2958.1993.tb01204.x Abstract >>
The phosphorelay is the signal-transduction system recognizing and integrating environmental signals to initiate sporulation. The major signal input to the phosphorelay is an ATP-dependent kinase, KinA, responsible for phosphorylating the SpoOF protein. Mutants lacking KinA, however, still sporulate, suggesting that other kinases can fulfil its role. In order to identify these kinases, genes for kinases were isolated by hybridization using a degenerate oligonucleotide probe designed for common regions of this class of kinases. A gene for a second kinase, KinB, was isolated which gave a sporulation negative phenotype when inactivated in a kinA background. The kinB locus was sequenced and found to be a small operon consisting of the kinB gene and another gene, kapB, transcribed from a single.sigma A.-dependent promoter. Inactivation of either kinB or kapB in a kinA strain led to severe sporulation deficiency. The kinB gene coded for a 47774 M(r) protein with the carboxyl half of this protein highly homologous to the same domain of KinA. The amino-terminal domain of KinB was hydrophobic with six recognizable membrane-spanning regions. The kapB gene coded for a moderately charged, probably soluble, protein of 14,668 M(r) with no homology to any known protein. Genetic evidence suggests that KapB is required either for the function of KinB or for its expression. Although double mutants kinA kinB cannot sporulate and assume a stage 0 phenotype, the SpoA approximately P-dependent regulation of the abrB gene is normal in these strains, suggesting that low levels of SpoA approximately P accumulate even in the absence of both kinases. This accumulation is dependent on functional spo0F and spo0B genes and its source is unknown. The KinA and KinB pathways are the only pathways capable of producing sufficient Spo0A approximately P to allow initiation and completion of sporulation under laboratory conditions.
|
229. |
( 1993 ) Cloning and characterization of a cluster of genes encoding polypeptides present in the insoluble fraction of the spore coat of Bacillus subtilis. PMID : 8509331 : DOI : 10.1128/jb.175.12.3757-3766.1993 PMC : PMC204792 Abstract >>
The Bacillus subtilis spore coat is composed of at least 15 polypeptides plus an insoluble protein fraction arranged in three morphological layers. The insoluble fraction accounts for about 30% of the coat protein and is resistant to solubilization by a variety of reagents, implying extensive cross-linking. A dodecapeptide was purified from this fraction by formic acid hydrolysis and reverse-phase high-performance liquid chromatography. This peptide was sequenced, and a gene designated cotX was cloned by reverse genetics. The cotX gene encoding the dodecapeptide at its amino end was clustered with four other genes designated cotV, cotW, cotY, and cotZ. These genes were mapped to 107 degrees between thiB and metA on the B. subtilis chromosome. The deduced amino acid sequences of the cotY and cotZ genes are very similar. Both proteins are cysteine rich, and CotY antigen was present in spore coat extracts as disulfide cross-linked multimers. There was little CotX antigen in the spore coat soluble fraction, and deletion of this gene resulted in a 30% reduction in the spore coat insoluble fraction. Spores produced by strains with deletions of the cotX, cotYZ, or cotXYZ genes were heat and lysozyme resistant but readily clumped and responded more rapidly to germinants than did spores from the wild type. In electron micrographs, there was a less densely staining outer coat in spores produced by the cotX null mutant, and those produced by a strain with a deletion of the cotXYZ genes had an incomplete outer coat. These proteins, as part of the coat insoluble fraction, appear to be localized to the outer coat and influence spore hydrophobicity as well as the accessibility of germinants.
|
230. |
( 1993 ) Bacillus subtilis transcription regulator, Spo0A, decreases alkaline phosphatase levels induced by phosphate starvation. PMID : 8509330 : DOI : 10.1128/jb.175.12.3749-3756.1993 PMC : PMC204791 Abstract >>
Alkaline phosphatase (APase) is induced as a culture enters stationary phase because of limiting phosphate. The results presented here show that expression of APase is regulated both negatively and positively. PhoP, a homolog of a family of bacterial transcription factors, and PhoR, a homolog of bacterial histidine protein kinases, are required for induction of APases when phosphate becomes limiting. The induction period lasts 2 to 3 h, after which the rate of APase accumulation is decreased. Mutant strains defective in the Spo0A transcription factor failed to decrease APase production. The consequent hyperinduction of APase in a spo0A strain was dependent on phoP and phoR. spo0B and spo0F strains also overexpressed APase, suggesting that phosphorylated Spo0A is required for repression of APase. An abrB mutant allele in the presence of the mutant spo0A allele in these strains did not significantly change the APase hyperinduction phenotype, demonstrating that Spo0A repression of abrB expression is not the mechanism by which Spo0A-P regulates APase expression. Our previous report that spo0A mutants do not express APases is in conflict with the present data. We show here that the previously used mutants and a number of commonly used spo0 strains, all of which have an APase deficiency phenotype, contain a previously unrecognized mutation in phoR.
|
231. |
( 1993 ) A novel post-translational modification of the peptide antibiotic subtilin: isolation and characterization of a natural variant from Bacillus subtilis A.T.C.C. 6633. PMID : 8471040 : DOI : 10.1042/bj2910023 PMC : PMC1132475 Abstract >>
A variant of the peptide antibiotic subtilin has been isolated from Bacillus subtilis A.T.C.C. 6633, and its structure has been shown to be [N alpha-succinyl-Trp1]subtilin. The chemical structure of a fragment derived by tryptic hydrolysis of the variant is shown to be N alpha-succinyl-Trp-Lys by 1H and 13C n.m.r., fast-atom-bombardment m.s. and total chemical synthesis [N alpha-Succinyl-Trp1]-subtilin is produced later in the growth of the bacterium than is subtilin; reverse-phase h.p.l.c. analysis shows that after 24 h growth the ratio subtilin/[N alpha-succinyl-Trp1]subtilin is approx. 1:2. Although [N alpha-succinyl-Trp1]subtilin retains significant antibacterial activity, it is 10-20 times less active than subtilin.
|
232. |
( 1993 ) Molecular cloning and characterization of the Bacillus subtilis spore photoproduct lyase (spl) gene, which is involved in repair of UV radiation-induced DNA damage during spore germination. PMID : 8449881 : DOI : 10.1128/jb.175.6.1735-1744.1993 PMC : PMC203968 Abstract >>
Upon UV irradiation, Bacillus subtilis spore DNA accumulates the novel thymine dimer 5-thyminyl-5,6-dihydrothymine. Spores can repair this "spore photoproduct" (SP) upon germination either by the uvr-mediated general excision repair pathway or by the SP-specific spl pathway, which involves in situ monomerization of SP to two thymines by an enzyme named SP lyase. Mutants lacking both repair pathways produce spores that are extremely sensitive to UV. For cloning DNA that can repair a mutation in the spl pathway called spl-1, a library of EcoRI fragments of chromosomal DNA from B. subtilis 168 was constructed in integrative plasmid pJH101 and introduced by transformation into a mutant B. subtilis strain that carries both the uvrA42 and spl-1 mutations, and transformants whose spores exhibited UV resistance were selected by UV irradiation. With a combination of genetic and physical mapping techniques, the DNA responsible for the restoration of UV resistance was shown to be present on a 2.3-kb EcoRI-HindIII fragment that was mapped to a new locus in the metC-pyrD region of the B. subtilis chromosome immediately downstream from the pstI gene. The spl coding sequence was localized on the cloned fragment by analysis of in vitro-generated deletions and by nucleotide sequencing. The spl nucleotide sequence contains an open reading frame capable of encoding a 40-kDa polypeptide that shows regional amino acid sequence homology to DNA photolyases from a number of bacteria and fungi.
|
233. |
( 1993 ) Nucleotide sequence of 5' portion of srfA that contains the region required for competence establishment in Bacillus subtilus. PMID : 8441623 : DOI : 10.1093/nar/21.1.93 PMC : PMC309069 Abstract >>
The nucleotide sequence of the 20,535 base pairs of the 5' end of the srfA operon, containing the region required for competence development, was determined. This included the srfA promoter region, the first open reading frame, srfAA, encoding surfactin synthetase I and part of the second open reading frame, srfAB, encoding surfactin synthetase II. Three amino acid-activating domains characteristic of those found in peptide synthetases could be discerned in both srfAA (activating Glu, Leu and D-Leu) and srfAB (activating Val, Asp, and D-Leu). The presence of a conserved spacer motif in the amino-terminal end of srfAA suggests that the srfAA product may not initiate surfactin synthesis. The portion of srfA that contains the region required for competence is composed of srfAA and the first amino acid-activating domain of srfAB.
|
234. |
( 1994 ) Cloning and nucleotide sequencing of a 15 kb region of the Bacillus subtilis genome containing the iol operon. PMID : 7952181 : DOI : 10.1099/13500872-140-9-2289 Abstract >>
Within the framework of an international project on the sequencing of the whole Bacillus subtilis genome, a 15 kb chromosome segment, which contains the iol operon involved in inositol utilization, has been cloned and sequenced. This region (14,974 bp) contains 12 complete open reading frames (ORFs; genes) and two partial ones; the seventh gene (E83G) is the idh gene encoding inositol dehydrogenase. All the genes identified are transcribed in the same direction as that of the movement of the replication fork. A homology search for their products deduced from the 12 complete ORFs revealed that eight of them exhibit significant homology to known proteins such as fructokinase, acetolactate synthase, fructose-1,6-bisphosphate aldolase (B. subtilis), and PhoB and FtsE proteins (Escherichia coli). It also implied that two genes (B65D and B65E) might encode a set of two-component regulatory proteins and that the B65F gene might encode a protein belonging to the ATP-binding cassette (ABC) family. Based on the features of the nucleotide sequence determined and the results of the homology search, the primary structure of the iol operon is predicted.
|
235. |
( 1995 ) Molecular cloning and nucleotide sequence of the 90k serine protease gene, hspK, from Bacillus subtilis (natto) No. 16. PMID : 8528006 : Abstract >>
We previously reported purification and characterization of a 90k serine protease with pI 3.9 from Bacillus subtilis (natto) No. 16 [Kato et al. 1992 Biosci Biotechnol Biochem 56:1166]. The enzyme showed different and unique substrate specificity towards the oxidized B-chain of insulin from those of well-known bacterial serine proteases from Bacillus subtilisins. The structural gene, hspK, for the 90k serine protease was cloned and sequenced. The cloned DNA fragment contained a single open reading frame of 4302 bp coding a protein of 1433 amino acid residues. The deduced amino acid sequence of the 90k-protease indicated the presence of a typical signal sequence of the first 30 amino acids region and that there was a pro-sequence of 164 amino acid residues after the signal sequence. The mature region of the 90k-protease started from position 195 of amino acid residue, and the following peptide consisted of 1239 amino acid residues with a molecular weight of 133k. It might be a precursor protein of the 90k-protease, and the C-terminal region of 43k might be degraded to a mature protein from the precursor protein. The catalytic triad was thought to consist of Asp33, His81, and Ser259 from comparison of the amino acid sequence of the 90k-protease with those of the other bacterial serine proteases. The high-molecular-weight serine protease, the 90k-protease, may be an ancient form of bacterial serine proteases.
|
236. |
( 1995 ) Two-dimensional gel electrophoresis of ribosomal proteins as a novel approach to bacterial taxonomy: application to the genus Arthrobacter. PMID : 8520111 : DOI : 10.1271/bbb.59.1679 Abstract >>
Ribosomal proteins from 22 strains of 15 different species belong to the genus Arthrobacter were analyzed by an improved two-dimensional gel electrophoresis. Electrophoretograms of ribosomal proteins from 15 type strains had species-specific patterns. Similarity coefficients (SAB values) of ribosomal proteins with mol. wt. of greater than about 20,000, among strains of the same species (DNA relatedness values of more than 61%) were greater than 0.85, but the SAB values among strains of different species were less than 0.60. The N-terminal amino acid sequences of the AL2 proteins, which migrated into similar positions in this method, from 5 type strains were shown to be highly homologous. Our results indicated that ribosomal proteins have been conserved within species during evolution and that the members of the genus Arthrobacter are phylogenetically homogeneous. Thus, ribosomal protein profiles by this method are a potential tool for strain identification.
|
237. |
( 1975 ) Plasmid deoxyribonucleic acid in Bacillus subtilis and Bacillus pumilus. PMID : 809424 : PMC : PMC235917 Abstract >>
Two of eighteen strains of Bacillus subtilis examined contained covalently closed circular duplex deoxyribonucleic acid (DNA) of homogeneous size and buoyant density. Strain ATCC 15841 contained about 16 copies per chromosome of plasmid pPL1, a circular DNA element having a molecular weight of about 4.7 times 10(6) and a buoyant density of 1.700. Strain ATCC 7003 contained about one to two copies per chromosome of plasmid pPL2. pPL2 had a molecular weight of about 46 times 10(6) and a buoyant density of 1.696. Strain ATCC 7003 appeared to be closely related to B. subtilis 168 by genetic, physiological, and biochemical criteria. Strain ATCC 15841 appeared to be much less closely related. B. pumilus ATCC 12140 contained two size classes of covalently closed circular duplex DNA. The plasmids pMB1 and pMB2 had molecular weights of about 6.8 times 10(6) and 5.3 times 10(6), respectively, and were present in several copies per chromosome.
|
238. |
( 1994 ) Growth phase-dependent regulation and membrane localization of SpaB, a protein involved in biosynthesis of the lantibiotic subtilin. PMID : 8117069 : PMC : PMC201261 Abstract >>
The information responsible for biosynthesis of the lantibiotic subtilin is organized in an operon-like structure that starts with the spaB gene. The spaB gene encodes an open reading frame consisting of 1,030 amino acid residues, and it was calculated that a protein having a theoretical molecular mass of 120.5 kDa could be produced from this gene. This is consistent with the apparent molecular weight for SpaB of 115,000 which was estimated after sodium dodecyl sulfate-gel electrophoresis and identification with SpaB-specific antibodies. The SpaB protein is very similar to proteins EpiB and NisB, which were identified previously as being involved in epidermin and nisin biosynthesis. Upstream from SpaB a characteristic sigma A promoter sequence was identified. An immunoblot analysis revealed that SpaB expression was strongly regulated. No SpaB protein was detected in the early logarithmic growth phase, and maximum SpaB expression was observed in the early stationary growth phase. The expression of SpaB was strongly correlated with subtilin biosynthesis. Deletion mutations in either of two recently identified regulatory genes, spaR and spaK, which act as a "two-component" regulatory system necessary for growth phase-dependent induction of subtilin biosynthesis (C. Klein, C. Kaletta, and K. D. Entian, Appl. Environ. Microbiol. 59:296-303, 1993), also resulted in failure of SpaB expression. To investigate the intracellular localization of SpaB, vesicles of Bacillus subtilis were prepared. The SpaB protein cosedimented with the vesicle fraction and was released only after vigorous resuspension of the vesicles. Our results suggest that SpaB is membrane associated and that subtilin biosynthesis occurs at the cytoplasmic membrane of B. subtilis.
|
239. |
( 1994 ) Cloning, nucleotide sequence, mutagenesis, and mapping of the Bacillus subtilis pbpD gene, which codes for penicillin-binding protein 4. PMID : 7961491 : DOI : 10.1128/jb.176.23.7197-7205.1994 PMC : PMC197107 Abstract >>
The gene encoding penicillin-binding protein 4 (PBP 4) of Bacillus subtilis, pbpD, was cloned by two independent methods. PBP 4 was purified, and the amino acid sequence of a cyanogen bromide digestion product was used to design an oligonucleotide probe for identification of the gene. An oligonucleotide probe designed to hybridize to genes encoding class A high-molecular-weight PBPs also identified this gene. DNA sequence analysis of the cloned DNA revealed that (i) the amino acid sequence of PBP 4 was similar to those of other class A high-molecular-weight PBPs and (ii) pbpD appeared to be cotranscribed with a downstream gene (termed orf2) of unknown function. The orf2 gene is followed by an apparent non-protein-coding region which exhibits nucleotide sequence similarity with at least two other regions of the chromosome and which has a high potential for secondary structure formation. Mutations in pbpD resulted in the disappearance of PBP 4 but had no obvious effect on growth, cell division, sporulation, spore heat resistance, or spore germination. Expression of a transcriptional fusion of pbpD to lacZ increased throughout growth, decreased during sporulation, and was induced approximately 45 min into spore germination. A single transcription start site was detected just upstream of pbpD. The pbpD locus was mapped to the 275 to 280 degrees region of the chromosomal genetic map.
|
240. |
( 1993 ) The organization of the Bacillus subtilis 168 chromosome region between the spoVA and serA genetic loci, based on sequence data. PMID : 7934829 : DOI : 10.1111/j.1365-2958.1993.tb02670.x Abstract >>
Three different lambda phage clones with overlapping inserts of Bacillus subtilis DNA, which cover the region from spoIIAA to serA, have been isolated. The nucleotide sequence of their inserts, starting after spoVAF and ending at serA, has been determined. A contiguous sequence of 35,354 bp was established, including previously analysed overlapping adjacent regions. Within the newly determined sequence 31 open reading frames (ORFs) with putative ribosome-binding sites have been found. Nine of them correspond to previously sequenced and characterized genes: spo-VAF, lysA, sipS, ribG, ribB, ribA, ribH, ribTD and dacB. Comparison of the amino acid sequences of the products encoded by the other ORFs to known proteins allowed putative functions to be assigned to seven of these ORFs. Among these are the following: (i) the ppiB gene, encoding a cytoplasmic peptidylprolyl isomerase; (ii) two pairs of signal-transducers, one homologous to phoR-phoP of B. subtilis, encoding regulators of phosphatase biosynthesis, and the second to the fecI-fecR of Escherichia coli, which is responsible for the regulation of the citrate-dependent iron (III) transport system; (iii) aroC and serA genes, involved in the biosynthesis of aromatic amino acids and serine, respectively, the function of which has been confirmed by constructing corresponding mutants with disrupted ORFs. The organization of putative operons has been postulated on the basis of the sequences of their transcription terminators, promoters and regulatory elements.
|
241. |
( 1994 ) Nucleotide sequence and features of the Bacillus licheniformis gnt operon. PMID : 8535972 : DOI : 10.1093/dnares/1.4.157 Abstract >>
Bacillus licheniformis was able to utilize gluconate as the sole carbon source as efficiently as Bacillus subtilis did. Southern analysis indicated that B. licheniformis likely possesses only one gnt determinant. The nucleotide sequence (6278 bp) of the B. licheniformis DNA containing the gnt operon was determined, revealing the five complete open reading frames (ORF; genes). The putative product of the first gene, oug, did not show any significant homology to known proteins, but those of the second to fifth genes exhibited striking homology to the gntRKPZ genes of B. subtilis, respectively, indicating that they are the corresponding gnt genes of B. licheniformis. Not only is the organization of the gnt genes of these two Bacilli highly conserved, but so are the cis regulatory elements of their gnt operon. Sequence analysis of the upstream regions of these two gnt operons implied that a chromosome rearrangement in B. subtilis might have occurred immediately upstream of the gnt operon during evolution, causing it to diverge from a common ancestor into B. licheniformis and B. subtilis.
|
242. |
Mitsushima K,
Takimoto A,
Sonoyama T,
Yagi S,
( 1995 ) Gene cloning, nucleotide sequence, and expression of a cephalosporin-C deacetylase from Bacillus subtilis. PMID : 7793942 : PMC : PMC167493 Abstract >>
The gene encoding a cephalosporin-C deacetylase (CAH) from Bacillus subtilis SHS 0133 was cloned and sequenced. The nucleotide sequence contained an open reading frame encoding a polypeptide consisting of 318 amino acids, the molecular weight of which was in good agreement with the value obtained by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The deduced amino acid sequence contained the common sequence Gly-X-Ser-X-Gly found in many esterases, lipases, and serine proteases. This indicates that CAH is a serine enzyme. A possible promoter sequence which is very similar to the consensus sequences of -35 and -10 regions recognized by B. subtilis RNA polymerase utilizing sigma factor H was found in the 5'-flanking region of the CAH structural gene. Two repeated A+T-rich blocks consisting of 24 bp were also found in the upstream region of the initiation codon. We constructed a series of expression plasmids by inserting the CAH gene into Escherichia coli ATG vectors. The degree of CAH gene expression depended on promoters and vector plasmids, which have different replication origins. The expressed CAH protein was an active form in the soluble fraction obtained after cell disruption. The highest expression level was accomplished with an expression plasmid, pCAH400, which has the trp promoter and the replication origin derived from pAT153. In the fermentation using a 30-liter jar fermentor, the transformant E. coli JM103(pCAH400) produced 440 U of CAH per ml of culture during a 24-h incubation. This value corresponded to 2.1 g of CAH protein in 1 liter of culture broth.
|
243. |
Chen CL,
Chang LK,
Chang YS,
Liu ST,
Tschen JS,
( 1995 ) Transposon mutagenesis and cloning of the genes encoding the enzymes of fengycin biosynthesis in Bacillus subtilis. PMID : 7651334 : DOI : 10.1007/bf02190792 Abstract >>
A total of 20 Bacillus subtilis F29-3 mutants defective in fengycin biosynthesis was obtained by Tn917 mutagenesis. Cloning and mapping results showed that the transposon in these mutants was inserted in eleven different locations on the chromosome. We were able to use the chromosomal sequence adjacent to the transposon as a probe to screen for cosmid clones containing the fengycin biosynthesis genes. One of the clones obtained, pFC660, was 46 kb long. Eight transposon insertion sites were mapped within this plasmid. Among the eleven different mutants analyzed, four mutants had Tn917 inserted in regions which encoded peptide sequences similar to part of gramicidin S synthetase, surfactin synthetase, and tyrocidine synthetase. Our results suggest that fengycin is synthesized nonribosomally by the multienzyme thiotemplate mechanism.
|
244. |
( 1994 ) Cloning, nucleotide sequence, and expression of the Bacillus subtilis lon gene. PMID : 7961402 : DOI : 10.1128/jb.176.21.6518-6527.1994 PMC : PMC197005 Abstract >>
The lon gene of Escherichia coli encodes the ATP-dependent serine protease La and belongs to the family of sigma 32-dependent heat shock genes. In this paper, we report the cloning and characterization of the lon gene from the gram-positive bacterium Bacillus subtilis. The nucleotide sequence of the lon locus, which is localized upstream of the hemAXCDBL operon, was determined. The lon gene codes for an 87-kDa protein consisting of 774 amino acid residues. A comparison of the deduced amino acid sequence with previously described lon gene products from E. coli, Bacillus brevis, and Myxococcus xanthus revealed strong homologies among all known bacterial Lon proteins. Like the E. coli lon gene, the B. subtilis lon gene is induced by heat shock. Furthermore, the amount of lon-specific mRNA is increased after salt, ethanol, and oxidative stress as well as after treatment with puromycin. The potential promoter region does not show similarities to promoters recognized by sigma 32 of E. coli but contains sequences which resemble promoters recognized by the vegetative RNA polymerase E sigma A of B. subtilis. A second gene designated orfX is suggested to be transcribed together with lon and encodes a protein with 195 amino acid residues and a calculated molecular weight of 22,000.
|
245. |
Krohn BM,
Lindsay JA,
( 1993 ) Cloning of the cyclomaltodextrinase gene from Bacillus subtilis high-temperature growth transformant H-17. PMID : 7763500 : Abstract >>
The cyclomaltodextrinase gene from Bacillus subtilis high-temperature growth transformant H-17 was cloned on separate PstI, BamHI, and EcoRI fragments into the plasmid vector pUC18, but was expressed in an inactive form in the host, Escherichia coli DH5 alpha. High level constitutive expression of the gene product was also detrimental to the E. coli host, which led to structural instability of the recombinant plasmid. The cyclomaltodextrinase gene was cloned on a 3-kb EcoRI fragment into the plasmid vector pPL708, and the fragment was structurally maintained in the host B. subtilis YB886. The cloned gene product was synthesized in an enzymatically active form in the B. subtilis host; however, expression was at a low level. Subcloning of the 3-kb EcoRI fragment into pUC18 and transformation into E. coli XL1-Blue (F' lacIq) indicated that the cyclomaltodextrinase gene was cloned with its own promoter, since expression of the gene occurred in the absence of IPTG. Subcloning of the cyclomaltodextrinase gene downstream from the Bacillus temperature phage SPO2 promoter of pPL708 may increase expression of this gene.
|
246. |
Fabret C,
Quentin Y,
Guiseppi A,
Busuttil J,
Haiech J,
Denizot F,
( 1995 ) Analysis of errors in finished DNA sequences: the surfactin operon of Bacillus subtilis as an example. PMID : 7704264 : DOI : 10.1099/13500872-141-2-345 Abstract >>
Increased productivity in DNA sequencing would not be valid without a straightforward detection and estimation of errors in finished sequences. The sequence of the surfactin operon from Bacillus subtilis was obtained by two different groups and by chance we were also working on the same chromosome region. Taking advantage of this situation we report in this paper, the number and nature of errors found in the overlapping part of the DNA sequences obtained by the three laboratories. The coincidence of some of the errors with compression in sequence ladders and with secondary DNA structures as well as the detection of frameshift errors using computer programs, are demonstrated. Finally we discuss the definition of a new sequencing strategy that might minimize both the error rate and the cost of sequencing.
|
247. |
Takemaru K,
Mizuno M,
Sato T,
Takeuchi M,
Kobayashi Y,
( 1995 ) Complete nucleotide sequence of a skin element excised by DNA rearrangement during sporulation in Bacillus subtilis. PMID : 7704261 : DOI : 10.1099/13500872-141-2-323 Abstract >>
As part of the Bacillus subtilis genome sequencing project, we have determined the complete nucleotide sequence of a skin element which is located between spoIVCB and spoIIIC. The entire sequence of this element is 48,032 bp in length, and contains 57 ORFs with putative ribosome-binding sites. Two of them correspond to previously sequenced and characterized genes, cwIA and spoIVCA. Furthermore, seven ORF products identified in this element show interesting similarities with known proteins present in data banks, including the phi 105 immunity repressor, the phi 105 Cro-like protein and the SPP1 terminase. These results indicate the possibility that the skin element is a cryptic remnant of an ancestral temperate phage.
|
248. |
Mendoza NS,
Arai M,
Sugimoto K,
Ueda M,
Kawaguchi T,
Joson LM,
( 1995 ) Cloning and sequencing of beta-mannanase gene from Bacillus subtilis NM-39. PMID : 7727534 : DOI : 10.1016/0304-4165(95)00011-y Abstract >>
A gene encoding beta-mannanase from Bacillus subtilis NM-39 was cloned into Escherichia coli DH5 alpha by using pUC 18 and its nucleotide sequence was determined. The beta-mannanase gene was 1080 base pairs long and encoded a mature protein of 336 amino acids and a signal peptide of 24 amino acids. The deduced amino acid sequence of the cloned mannanase showed sequence homology with mannanase from alkalophilic Bacillus sp. strain AM-001 (about 50%).
|
249. |
Reizer J,
Hoischen C,
Reizer A,
Pham TN,
Saier MH,
( 1993 ) Sequence analyses and evolutionary relationships among the energy-coupling proteins Enzyme I and HPr of the bacterial phosphoenolpyruvate: sugar phosphotransferase system. PMID : 7686067 : DOI : 10.1002/pro.5560020403 PMC : PMC2142364 Abstract >>
We have previously reported the overexpression, purification, and biochemical properties of the Bacillus subtilis Enzyme I of the phosphoenolpyruvate: sugar phosphotransferase system (PTS) (Reizer, J., et al., 1992, J. Biol. Chem. 267, 9158-9169). We now report the sequencing of the ptsI gene of B. subtilis encoding Enzyme I (570 amino acids and 63,076 Da). Putative transcriptional regulatory signals are identified, and the pts operon is shown to be subject to carbon source-dependent regulation. Multiple alignments of the B. subtilis Enzyme I with (1) six other sequenced Enzymes I of the PTS from various bacterial species, (2) phosphoenolpyruvate synthase of Escherichia coli, and (3) bacterial and plant pyruvate: phosphate dikinases (PPDKs) revealed regions of sequence similarity as well as divergence. Statistical analyses revealed that these three types of proteins comprise a homologous family, and the phylogenetic tree of the 11 sequenced protein members of this family was constructed. This tree was compared with that of the 12 sequence HPr proteins or protein domains. Antibodies raised against the B. subtilis and E. coli Enzymes I exhibited immunological cross-reactivity with each other as well as with PPDK of Bacteroides symbiosus, providing support for the evolutionary relationships of these proteins suggested from the sequence comparisons. Putative flexible linkers tethering the N-terminal and the C-terminal domains of protein members of the Enzyme I family were identified, and their potential significance with regard to Enzyme I function is discussed. The codon choice pattern of the B. subtilis and E. coli ptsI and ptsH genes was found to exhibit a bias toward optimal codons in these organisms.(ABSTRACT TRUNCATED AT 250 WORDS)
|
250. |
Kurahashi O,
Kawashima H,
Nakamori S,
Yamane K,
( 1993 ) Cloning and nucleotide sequence of the Bacillus subtilis K trpB gene encoding tryptophan synthase beta-subunit. PMID : 7763866 : DOI : 10.1271/bbb.57.1006 Abstract >>
N/A
|
251. |
( 1995 ) Characterization of single strand origins of cryptic rolling-circle plasmids from Bacillus subtilis. PMID : 7899081 : DOI : 10.1093/nar/23.4.612 PMC : PMC306728 Abstract >>
In this paper we describe the isolation and characterization of single strand origins (SSOs) of several cryptic Bacillus subtilis plasmids which use the rolling-circle mechanism of replication. The plasmids used in this study involved pTA1015, pTA1020, pTA1030, pTA1040, pTA1050 and pTA1060. The SSO of pTA1015 was isolated by shotgun cloning in a specially designed vector, pWM100, which has no SSO of its own. Sequence analysis revealed that the SSO of pTA1015 is almost identical to formerly described palT type SSOs. Also pTA1020 and pTA1060 were shown to contain SSOs highly homologous to palT. Using Southern hybridization with the palT of pTA1015 as a probe, the SSO of pTA1040 was cloned. Sequence analysis revealed a region of 200 bp which is 77% identical to the palT of pTA1015. The plasmids pTA1030 and pTA1050 contain an SSO which is highly homologous to the SSO of pTA1040. The majority of the SSOs of rolling-circle plasmids from B.subtilis seem to belong to two related families which we denote as palT1 (present on pTA1015, pTA1020 and pTA1060) and palT2 (present on pTA1030, pTA1040 and pTA1050). Both families of SSOs are highly efficient single-strand-conversion signals in B.subtilis.
|
252. |
Slack FJ,
Serror P,
Joyce E,
Sonenshein AL,
( 1995 ) A gene required for nutritional repression of the Bacillus subtilis dipeptide permease operon. PMID : 7783641 : DOI : 10.1111/j.1365-2958.1995.tb02378.x Abstract >>
An insertion mutation was isolated that resulted in derepressed expression of the Bacillus subtillis dipeptide transport operon (dpp) during the exponential growth phase in rich medium. DNA flanking the site of insertion was found to encode an operon (codVWXY) of four potential open reading frames (ORFs). The deduced product of the codV ORF is similar to members of the lambda Int family; CodW and CodX are homologous to HsIV and HsIU, two putative heat-shock proteins from Escherichia coli, and to LapC and LapA, two gene products of unknown function from Pasteurella haemolytica. CodX also shares homology with a family of ATPases, including ClpX, a regulatory subunit of the E. coli ClpP protease. CodY does not have any homologues in the data-bases. The insertion mutation and all previously isolated spontaneous cod mutations were found to map in codY. In-frame deletion mutations in each of the other cod genes revealed that only codY is required for repression of dpp in nutrient-rich medium. The codY mutations partially relieved amino acid repression of the histidine utilization (hut) operon but had no effect on regulation of certain other early stationary phase-induced genes, such as spoVG and gsiA.
|
253. |
Glaser P,
Danchin A,
Kunst F,
Zuber P,
Nakano MM,
( 1995 ) Identification and isolation of a gene required for nitrate assimilation and anaerobic growth of Bacillus subtilis. PMID : 7860592 : DOI : 10.1128/jb.177.4.1112-1115.1995 PMC : PMC176711 Abstract >>
The Bacillus subtilis narA locus was shown to include narQ and narA. The putative product of narQ is similar to FdhD, which is required for formate dehydrogenase activity in Escherichia coli. NarA showed homology to MoaA, a protein involved in biosynthesis of the molybdenum cofactor for nitrate reductase and formate dehydrogenase. Analysis of mutants showed that narA but not narQ is required for both nitrate assimilation and respiration.
|
254. |
Tognoni A,
Franchi E,
Magistrelli C,
Colombo E,
Cosmina P,
Grandi G,
( 1995 ) A putative new peptide synthase operon in Bacillus subtilis: partial characterization. PMID : 7711903 : DOI : 10.1099/13500872-141-3-645 Abstract >>
A large operon-type structure has been located between the gltA and citB loci on the Bacillus subtilis chromosome. On the basis of the analysis of the 25 kb sequenced so far, it potentially encodes at least three large proteins which contain structural motifs associated with the subunits of all characterized peptide synthases. The amino acid recognition specificity of this new peptide synthase is discussed in the light of sequence homology with other synthases.
|
255. |
( 1994 ) Analysis of the induction of general stress proteins of Bacillus subtilis. PMID : 8012595 : DOI : 10.1099/00221287-140-4-741 Abstract >>
In Bacillus subtilis stress proteins are induced in response to different environmental conditions such as heat shock, salt stress, glucose and oxygen limitation or oxidative stress. These stress proteins have been previously grouped into general stress proteins (Gsps) and heat-specific stress proteins (Hsps). In this investigation the N-terminal sequences of 13 stress proteins of B. subtilis were determined. The quantification of the mRNA and the analysis of the protein synthesis pattern support the initial hypothesis that the chaperones DnaK and GroEL are Hsps in B. subtilis. In contrast, the recently described proteins GsiB, Ctc and RsbW belong to a class of Gsps that are induced by various stresses including heat shock. The main part of the Gsps described in this study failed to be induced in the sigB deletion mutant ML6 in response to heat shock. However, all the five Hsps were induced in this mutant in response to heat shock. These data indicate that SigB plays a crucial role in the induction of general stress genes, but is dispensable for the induction of Hsps.
|
256. |
( 1994 ) The glpT and glpQ genes of the glycerol regulon in Bacillus subtilis. PMID : 8012593 : DOI : 10.1099/00221287-140-4-723 Abstract >>
The cloning of the Bacillus subtilis glpT and glpQ genes and their nucleotide sequences are reported. Analysis of mRNA indicates that glpT and glpQ constitute one operon which is transcribed from a sigma A type promoter. The steady state amount of glpTQ mRNA is increased in cells grown in the presence of glycerol 3-phosphate. The 5' untranslated leader sequence of glpTQ mRNA contains an inverted repeat which shows sequence similarity to repeats present in the leader sequences of glpFK and glpD transcripts. These repeats seem therefore to be essential control elements for all B. subtilis glp genes.
|
257. |
( 1994 ) Cloning and characterization of ppiB, a Bacillus subtilis gene which encodes a cyclosporin A-sensitive peptidyl-prolyl cis-trans isomerase. PMID : 8022278 : DOI : 10.1111/j.1365-2958.1994.tb00384.x Abstract >>
Sequencing of N-terminal and internal peptide fragments of the purified 17 kDa Bacillus subtilis peptidyl-prolyl cis-trans isomerase (PPIase) revealed sequence identity to conserved regions of a number of eukaryotic and prokaryotic cyclophilins. Using two oligonucleotide primers corresponding to the N-terminus and a highly conserved internal amino acid sequence, polymerase chain reactions (PCR) with B. subtilis genomic DNA were carried out. The resultant PCR fragment of 335 bp was cloned, sequenced and subsequently used as a probe for screening a lambda Zap II gene library of B. subtilis. Two overlapping positive clones of 5 and 7 kb containing the B. subtilis PPIase gene (ppiB), which is 432 bp in length and encodes a protein of 144 amino acid residues, were identified and two distinct transcriptional initiation sites at the 5' end of ppiB were mapped. The entire region (35 kb) between spoVA and serA was recently sequenced in B. subtilis, and an open reading frame (ORF) that encodes a putative peptidyl-prolyl cis-trans isomerase at about 210 degrees on the B. subtilis genetic map was located. This putative PPIase is identical to PPiB. We have overexpressed the ppiB gene in Escherichia coli, purified the encoded protein to apparent homology and shown that it exhibits PPIase activity. In addition, the recombinant PPiB shows a significant inhibition of PPIase activity by cyclosporin A (CsA) at a level comparable to that observed for the B. subtilis enzyme. Interestingly the B. subtilis PPIase shows about 40% identity to eukaryotic PPIases and less similarity to those of Gram-negative bacteria (27-32% identity). Like other interruption mutants of yeast and Neurospora, which lack a functional cyclophilin gene, a B. subtilis mutant containing ppiB::cat, a cat-interrupted copy of ppiB in the chromosome, is viable.
|
258. |
( 1994 ) Isolation of a Bacillus subtilis spoIIGA allele that suppresses processing-negative mutations in the Pro-sigma E gene (sigE). PMID : 8002606 : DOI : 10.1128/jb.176.24.7763-7766.1994 PMC : PMC197240 Abstract >>
sigma E, a sporulation-essential sigma factor of Bacillus subtilis, is formed by a developmentally regulated proteolysis which removes 27 to 29 amino acids from the amino terminus of an inactive precursor protein (Pro-sigma E). A mutation which facilitates the conversion of inefficiently processed Pro-sigma E variants into mature sigma E was identified and mapped to spoIIGA. The isolation of such a mutation argues that SpoIIGA is directly involved in the Pro-sigma E processing reaction.
|
259. |
Sakamoto T,
Hours RA,
Sakai T,
( 1994 ) Purification, characterization, and production of two pectic transeliminases with protopectinase activity from Bacillus subtilis. PMID : 7764545 : Abstract >>
We found two enzymes that solubilize pectin from protopectin, tentatively named protopectinase-N (PPase-N) and protopectinase-R (PPase-R), in a culture filtrate of Bacillus subtilis IFO 3134. These enzymes were purified to homogeneity by hydrophobic, cation exchange and size exclusion chromatographies. The molecular weights of PPase-N and PPase-R were estimated to be 43,000 and 35,000, respectively, by SDS-PAGE. Their pIs were 9.4 and 8.2, respectively. These enzymes were stable in a wide range of pH and temperature. PPase-N and -R released water-soluble pectin by transeliminative cleavage of protopectin. According to their substrate specificities and modes of action, PPase-N and PPase-R could be classified as endo-pectate transeliminase (pectate lyase; EC 4.2.2.2) and endo-pectin transeliminase (pectin lyase; EC 4.2.2.10), respectively. Both enzymes were produced in a simple medium containing defatted soybean flour and phosphates. Production of PPase-N was repressed by addition of glucose while that of PPase-R was enhanced by phosphate.
|
260. |
( 1994 ) Bacillus subtilis lon protease prevents inappropriate transcription of genes under the control of the sporulation transcription factor sigma G. PMID : 7961403 : DOI : 10.1128/jb.176.21.6528-6537.1994 PMC : PMC197006 Abstract >>
The Bacillus subtilis RNA polymerase sigma factor sigma G is a cell-type-specific regulatory protein that governs the transcription of genes that are expressed at an intermediate to late stage of sporulation in the forespore compartment of the sporangium. Here we report the identification of a mutation (lon-1) that causes inappropriate transcription of genes under the control of sigma G under nutritional and genetic conditions in which sporulation is prevented. The mutation is located at 245 degrees on the genetic map and lies within a newly identified open reading frame that is predicted to encode a homolog to Lon protease. Inappropriate transcription of sigma G-controlled genes in the lon-1 mutant is not prevented by mutations in genes that are normally required for the appearance of sigma G during sporulation but is prevented by a mutation in the structural gene (spoIIIG) for sigma G itself. In light of previous work showing that spoIIIG is subject to positive autoregulation, we propose that Lon protease is responsible (possibly by causing degradation of sigma G) for preventing sigma G-directed transcription of spoIIIG and hence the accumulation of sigma G in cells that are not undergoing sporulation. An integrated physical and genetic map is presented that encompasses 36 kb of uninterrupted DNA sequence from the lon pheA region of the chromosome, corresponding to 245 degrees to 239 degrees on the genetic map.
|
261. |
Quax WJ,
Broekhuizen CP,
( 1994 ) Development of a new Bacillus carboxyl esterase for use in the resolution of chiral drugs. PMID : 7765103 : DOI : 10.1007/BF01982531 Abstract >>
We have screened a new enzyme for the resolution of R, S-naproxen enantiomers. The enzyme is free of lipase activity, and possesses a very high sterospecificity on S-naproxen [2-(6-methoxy-2-naphthyl)-propionic acid] esters and esters of related drugs. The primary structure of the enzyme, determined from the nucleotide sequence, shows limited homology with the catalytic site of lipases. The gene coding for the steroselective carboxylesterase has been cloned and expressed in Bacillus subtilis. Using a multicopy vector and an additional strong promoter an efficient production process was developed. The enzyme was shown to be sensitive to very high concentrations of the products formed during the reaction it catalyses. To increase the resistance of the enzyme, lysine residues thought to be responsible for this phenomnon were replaced through site-directed mutagenesis. Enzymes with improved stability were obtained. An explanation is given in terms of a model in which a reaction of the acid moiety of naproxen with free lysine NH2 groups is a major cause of inactivation.
|
262. |
Murphy N,
McConnell DJ,
Cantwell BA,
( 1984 ) The DNA sequence of the gene and genetic control sites for the excreted B. subtilis enzyme beta-glucanase. PMID : 6087283 : DOI : 10.1093/nar/12.13.5355 PMC : PMC318924 Abstract >>
The sequence of a 1409 base pair restriction fragment containing the B. subtilis gene for (1-3), (1-4)-beta-D-glucan endoglucanase is reported. The gene is encoded in a 726 base pair segment. The deduced amino acid sequence of the protein has a hydrophobic signal peptide at the NH2-terminus similar to those found in five other secreted proteins from Bacillus. The gene is preceded by a sequence resembling promoters for the vegetative B. subtilis RNA polymerase. This is followed by a sequence resembling a B. subtilis ribosome binding site nine nucleotides before the first codon of the gene. Two sequences, one before and one after the gene, can be arranged in secondary structures similar to transcriptional terminators. There is also a short open reading frame coding for a hydrophobic protein on the minus strand just upstream from the beta-glucanase gene. A possible role for this gene in the control of expression of beta-glucanase is suggested.
|
263. |
Gardan R,
Rapoport G,
Débarbouillé M,
( 1995 ) Expression of the rocDEF operon involved in arginine catabolism in Bacillus subtilis. PMID : 7540694 : DOI : 10.1006/jmbi.1995.0342 Abstract >>
Three genes called rocD, rocE and rocF were found near the rocR gene in B. subtilis. The product of rocD is similar to eukaryotic ornithine aminotransferases. The product of rocE shares similarity with the product of B. subtilis rocC and with the product of E. coli lysP. The rocE gene may encode an arginine permease. The rocF gene encodes a polypeptide similar to several arginases. Heterologous expression in E. coli indicated that rocD encodes an ornithine aminotransferase and that rocF encodes an arginase. Arginine utilization was abolished in both rocD and rocF mutants of B. subtilis confirming the role of these genes in arginine catabolism. The rocDEF genes form an operon transcribed from a -12, -24 promoter almost identical to the -12, -24 promoter of the rocABC operon. The expression of the rocDEF operon was induced by the presence of arginine, ornithine or proline in the growth medium and depended on the presence of the sigma factor SigL. Transcription of this operon was also abolished in a B. subtilis strain containing a null mutation in the regulatory gene rocR. Two tandemly repeated upstream activating sequences very similar to those previously identified in the rocABC system were found centered at positions -120 and -70, respectively, upstream from the transcription start site of rocDEF. Deletion analysis showed that at least one upstream activating sequence is involved in the expression of the rocDEF operon. These sequences are probably the target of RocR. Analysis of a rocR'-'lacZ fusion strain showed that the expression of rocR is not induced by arginine and is negatively autoregulated.
|
264. |
Luo J,
Li W,
Zhang T,
Chai S,
Wang H,
( 1994 ) [Cloning and sequencing of promoter and signal sequence coding regions from Bacillus subtilis]. PMID : 7545933 : Abstract >>
Promoter and signal sequence coding regions from B. subtilis were cloned in E. coli using a bifunctional and signal sequence selection plasmid pGPB14 as a vector. The Sau3A digested chromosome DNA was ligated with BamHI digested pGPB14. The ligated mixture was used to transform E. coli C600. Ampicillin and erythromycin resistant clones were selected. Recombinant plasmids were isolated from double resistant transformants. Restriction analysis showed that inserts of various length had been cloned and these inserts rendered the E. coli cells resistant to different concentrations of ampicillin. The recombinant plasmids were transformed and showed the same secretion function in B. subtilis. The amount and localization of beta-lactamase were determined in transformed E. coli and B. subtilis. The results indicate that the beta-lactamase activities of E. coli mainly in periplasm while the enzyme produced by B. subtilis secreted extracellularly. 10 of the cloned fragments were sequenced by Sanger's dideoxy chain termination method. The sequencing data show that all fragments contain promoter, ribosome binding site and signal sequence coding region.
|
265. |
Wolf M,
Geczi A,
Simon O,
Borriss R,
( 1995 ) Genes encoding xylan and beta-glucan hydrolysing enzymes in Bacillus subtilis: characterization, mapping and construction of strains deficient in lichenase, cellulase and xylanase. PMID : 7704256 : DOI : 10.1099/13500872-141-2-281 Abstract >>
The gene encoding extracellular xylanase (xynA) was amplified as a 770 bp DNA fragment from Bacillus subtilis 168 chromosomal DNA by PCR. The genes encoding endo-beta-1,4-glucanase (eglS) and endo-beta-1,3-1,4-glucanase (bglS) were isolated from a genomic library of B. subtilis 168. The sequences of xynA and eglS were identical to those of the xylanase and cellulase genes from B. subtilis PAP115. Integrative plasmids containing DNA fragments with deletions in the coding region of the genes were constructed and used to replace the chromosomal eglS, bglS and xynA genes of B. subtilis 168. Strains without any detectable activity against xylan (Xyn-), carboxymethylcellulose (Egl-) or mixed linked beta-1,3-1,4-glucan (Egl- Bgl-) were obtained. The genes were mapped at 170 degrees (eglS), 175 degrees (xynA) and 340 degrees (bglS) on the B. subtilis chromosome.
|
266. |
Ogasawara N,
Fujita Y,
Kobayashi Y,
Sadaie Y,
Tanaka T,
Takahashi H,
Yamane K,
Yoshikawa H,
( 1995 ) Systematic sequencing of the Bacillus subtilis genome: progress report of the Japanese group. PMID : 7704252 : DOI : 10.1099/13500872-141-2-257 Abstract >>
N/A
|
267. |
Zhong P,
Pratt SD,
Edalji RP,
Walter KA,
Holzman TF,
Shivakumar AG,
Katz L,
( 1995 ) Substrate requirements for ErmC' methyltransferase activity. PMID : 7543473 : DOI : 10.1128/jb.177.15.4327-4332.1995 PMC : PMC177180 Abstract >>
ErmC' is a methyltransferase that confers resistance to the macrolide-lincosamide-streptogramin B group of antibiotics by catalyzing the methylation of 23S rRNA at a specific adenine residue (A-2085 in Bacillus subtilis; A-2058 in Escherichia coli). The gene for ErmC' was cloned and expressed to a high level in E. coli, and the protein was purified to virtual homogeneity. Studies of substrate requirements of ErmC' have shown that a 262-nucleotide RNA fragment within domain V of B. subtilis 23S rRNA can be utilized efficiently as a substrate for methylation at A-2085. Kinetic studies of the monomethylation reaction showed that the apparent Km of this 262-nucleotide RNA oligonucleotide was 26-fold greater than the value determined for full-size and domain V 23S rRNA. In addition, the Vmax for this fragment also rose sevenfold. A model of RNA-ErmC' interaction involving multiple binding sites is proposed from the kinetic data presented.
|
268. |
Ogasawara N,
Nakai S,
Yoshikawa H,
( 1994 ) Systematic sequencing of the 180 kilobase region of the Bacillus subtilis chromosome containing the replication origin. PMID : 7584024 : DOI : 10.1093/dnares/1.1.1 Abstract >>
We have determined a 180 kb contiguous sequence in the replication origin region of the Bacillus subtilis chromosome. Open reading frames (ORF) in this region were unambiguously identified from the determined sequence, using criteria characteristic for the B. subtilis gene structure, i.e., starting with an ATG, GTG or TTG codon preceded by sequences complementary to the 3' end of the 16S rRNA. Four rRNA gene sets, 7 individual tRNA genes and 1 scRNA gene were identified, occupying 20 kb in total. In the remaining 160 kb region, 158 ORFs were identified, suggesting that 1 ORF is coded on average by 1 kb of DNA of the B. subtilis genome. Among the 158 ORFs, the functions of 48 ORFs were assigned and those of 11 ORFs are suggested through significant similarities to known proteins present in data banks. However, the functions of more than half of the ORFs (63%) remain to be determined.
|
269. |
Morhoshi F,
Munakata N,
( 1995 ) Diverse capacities for the adaptive response to DNA alkylation in Bacillus species and strains. PMID : 7565865 : DOI : 10.1016/0921-8777(95)00013-a Abstract >>
Our previous studies of Bacillus subtilis showed that the genes responsible for the adaptive response to DNA alkylation were organized as a divergent regulon, in contrast to scattered operons in Escherichia coli ada regulon. To study the generality and diversity of gene organization, several species and strains of Bacillus were examined for the responsiveness to DNA alkylation. B. cereus cells exhibited the highest resistance to MNNG treatment. When the cells were grown in the presence of MNNG, 3-methyladenine DNA glycosylase and two species of DNA methyltransferase were induced as in B. subtilis 168 cells. B. licheniformis 749 and B. amyloliquefaciens H cells exhibited a partial response that manifested itself as the induction of one species of DNA methyltransferase. On the other hand, B. thuringiensis var. Tohokuensis, B. megaterium KMT, and B. subtilis W23 cells were totally deficient in this response, and were hypersensitive to alkylating agents. To determine the cause of this deficiency in strain W23, we examined the genomic structure of the corresponding region where three genes (alkA, adaA, and adaB) were located in 168. No homologues for the three genes were detected in W23 DNA by Southern hybridization. Two genes (glmS and ndhF) flanking the adaptive response regulon in 168 were also present in W23. A sequence of about 2750 bp that carried the entire regulon in 168 was replaced with a sequence of about 250 bp that was unique to W23. At the ends of the conserved segments, palindromic sequences corresponding to the transcriptional termination sites of the adaB and glmS genes were observed. The regulon in 168 could be artificially replaced by the W23 sequence, and be regained through DNA-mediated transformation.
|
270. |
Gross E,
Kiltz HH,
Nebelin E,
( 1973 ) [Subtilin, VI: the structure of subtilin (author's transl)]. PMID : 4154277 : Abstract >>
N/A
|
271. |
Selzer G,
Som T,
Itoh T,
Tomizawa J,
( ) PMID : 6186390 : DOI : 10.1016/0092-8674(83)90502-0 Abstract >>
Replication of Escherichia coli plasmid p15A was examined by use of a cell extract or a mixture of three purified E. coli enzymes: RNA polymerase; RNAase H; and DNA polymerase I. In each system, replication initiates at any of three consecutive nucleotides located at a unique site. Primer transcription starts 508 bp upstream of the replication origin. The region between 294 and 524 bp upstream of the origin determines the incompatibility property. This region specifies an RNA (RNA I) of about 105 nucleotides that is involved in regulation of primer formation. We compare the nucleotide sequences around the origins of related plasmids p15A, ColE1, pBR322, RSF1030 and CloDF13, and discuss the significance of possible RNA secondary structures in primer formation.
|
272. |
Bolotin A,
Khazak V,
Stoynova N,
Ratmanova K,
Yomantas Y,
Kozlov Y,
( 1995 ) Identical amino acid sequence of the aroA(G) gene products of Bacillus subtilis 168 and B. subtilis Marburg strain. PMID : 7496534 : DOI : 10.1099/13500872-141-9-2219 Abstract >>
A DNA fragment containing the aroA(G) gene of Bacillus subtilis 168, encoding 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase-chorismate mutase, was cloned and sequenced. The N-terminus of the protein encoded by aroA(G) showed homology with chorismate mutase encoded by aroH of B. subtilis and with the chorismate mutase parts of proteins encoded by the pheA and tyrA genes of Escherichia coli. The C-terminus of the aroA(G) product has sequence similarity with 3-deoxy-D-manno-octulosonate 8-phosphate synthase of E. coli. It was shown that the proteins encoded by the aroA(G) gene of B. subtilis 168 and the aroA gene of B. subtilis ATCC 6051 Marburg strain are identical, so the observed differences in DAHP synthase activity from these two strains must result from other changes.
|
273. |
Wilhelm M,
Hollenberg CP,
( 1984 ) Selective cloning of Bacillus subtilis xylose isomerase and xylulokinase in Escherichia coli genes by IS5-mediated expression. PMID : 6096130 : PMC : PMC557729 Abstract >>
A fragment of Bacillus subtilis DNA coding for xylose isomerase and xylulokinase was isolated from a BamHI restriction pool by complementation of an isomerase-defective Escherichia coli strain. The spontaneous insertion of IS5, which occurred during the very slow growth of the E. coli xyl- cells on xylose, allowed the expression of the cloned Bacillus genes in E. coli. Without IS5 insertion, the xylose genes were inactive in E. coli. Deletion experiments indicated that the control of the expression resides within a 270-bp long region at the right end of IS5. Deletion of this region led to a loss of expression, which could be restored by insertion of the lacUV5 promoter fragment at the deletion site. Sequence analysis showed that the site of IS5 insertion is 195 bp upstream from the putative ATG initiation codon of the xylose isomerase structural gene. This ATG is preceded by a ribosome binding sequence and two hexamers also found in promoter regions of other Bacillus genes. Deletion and mutagenesis analysis led to a preliminary map of the Bacillus xylose operon.
|
274. |
Yoshida K,
Seki S,
Fujimura M,
Miwa Y,
Fujita Y,
( 1995 ) Cloning and sequencing of a 36-kb region of the Bacillus subtilis genome between the gnt and iol operons. PMID : 7584049 : DOI : 10.1093/dnares/2.2.61 Abstract >>
Within the framework of an international project for the sequencing of the entire Bacillus subtilis genome, a 36-kb chromosome segment, which covers the region between the gnt and iol operons, has been cloned and sequenced. This region (36447 bp) contains 33 complete open reading frames (ORFs; genes) including the four gnt genes and one partial gene. A homology search for the products of the 33 complete ORFs revealed significant homology to known proteins in 16 of them such as tetracycline resistance protein (Clostridium perfringens), asparagine synthetase (Arabidopsis thaliana), aldehyde dehydrogenase (Pseudomonas oleovorans), 2,5-dichloro-2,5-cyclohexadiene-1, 4-diol dehydrogenase (P. paucimobilis), heat shock protein HtpG (Escherichia coli), galactose-proton symporter (E. coli), auxin-induced protein (common tobacco), glucitol operon repressor (E. coli) and methylmalonate-semialdehyde dehydrogenase (P. aeruginosa). Unlike the regions we sequenced so far, this region contained two short sequence multiplications: one was a tandem sequence duplication (409 and 410 bp), and the other a triplication consisting of two highly conserved 118-bp tandem sequences preceded by a less conserved similar sequence (129 bp). The reasons for the presence of these sequence multiplications in the gnt to iol region were deduced.
|
275. |
Kanapina ASh,
Kanapin AA,
Prozorov AA,
( 1995 ) [Determination and comparative analysis of the nucleotide sequence for minireplicon fragments of the cryptic plasmid p1414 from the soil strain of Bacillus subtilis]. PMID : 7489884 : Abstract >>
Nucleotide sequences of two minireplicon fragments of the p1414 cryptic plasmid of Bacillus subtilis were determined. The fragments corresponded to the region containing ori(+) and the gene coding for Rep protein. Comparing sequences of the fragments with corresponding sequences of other ss+ plasmids suggested that ori(+) of p1414 belongs to the family of endogenous cryptic B. subtilis plasmids, which form an individual, closely related subgroup in the group of ori(+) sequences of the pC194 type. It was found that the amino acid sequence of a conservative FLTLTV motif located, together with its flanking sequences, at the N ends of Rep proteins encoded by different ss+ plasmids, is similar to those of several transmembrane proteins and signal peptides. These results, together with computer data on predicting the secondary and tertiary structure of the N-terminal domain of the p1414 Rep protein, suggest that the domain can serve as a "membrane anchor" during plasmid replication.
|
276. |
Imanaka T,
Ishikawa H,
Aiba S,
( 1986 ) Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein in Bacillus subtilis. PMID : 3025562 : DOI : 10.1007/bf02428036 Abstract >>
The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of the repA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted in trans on DNA. The part of the repA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of the Escherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy number Bacillus plasmid is discussed.
|
277. |
?zdemir F,
Arslan S,
( 2019 ) Molecular Characterization and Toxin Profiles of Bacillus spp. Isolated from Retail Fish and Ground Beef. PMID : 30690739 : DOI : 10.1111/1750-3841.14445 Abstract >>
Bacillus species are common in the environment due to their spore-forming ability and nutritional versatility and cause food contamination. Bacilli play a significant role in foodborne illnesses and food spoilage. In this study, 52 Bacillus isolates from retail fish and ground beef were identified and differentiated based on 16S rRNA, gyrB, and rpoB gene sequencing. The presence of genes encoding emetic toxin (ces), hemolytic enterotoxin hemolysin BL (hbl), nonhemolytic enterotoxin (nhe) and cytotoxin K (cytK1) was assessed in all Bacillus isolates. The ability of the Bacillus isolates to produce several extracellular enzymes that contribute to pathogenicity and food spoilage was investigated. The 16S rRNA, rpoB, and gyrB gene sequence similarities of the Bacillus isolates tested were 96.1%, 83.2%, and 77.5%, respectively. The gyrB gene demonstrated a higher degree of sequence variation than the 16S rRNA and rpoB genes. The prevalence of Bacillus isolates producing at least two of the genes of the HBL and NHE complexes was 23.1% and 15.4%, respectively. Of the B. cereus isolates, 10 (41.7%) possessed two or more enterotoxin genes. None of the isolates carried the ces and cytK1 genes. All isolates were positive for the production of enzymes such as protease, lipase, gelatinase, and DNase. However, only 92.3% of the tested isolates were positive for amylase. In conclusion, our results revealed that the presence of genes involved in toxin production and enzyme production in meat-originated B. cereus and other Bacillus isolates may cause spoilage of food and pose a health risk for consumers. PRACTICAL APPLICATION: Bacillus species can be found in various foods due to their ubiquitous nature. Bacillus spp., especially B. cereus, are associated with food poisoning and other infections in humans. Toxins and many extracellular enzymes produced by Bacillus spp. are the causative agents of foodborne outbreaks, food spoilage, and low-quality food with significantly reduced edibility. This study highlights the characterization of Bacillus spp. and presence of potentially pathogenic Bacillus species in meats.
|
278. |
Robson LM,
Chambliss GH,
( 1987 ) Endo-beta-1,4-glucanase gene of Bacillus subtilis DLG. PMID : 3106328 : DOI : 10.1128/jb.169.5.2017-2025.1987 PMC : PMC212076 Abstract >>
The DNA sequence of the Bacillus subtilis DLG endo-beta-1,4-glucanase gene was determined, and the in vivo site of transcription initiation was located. Immediately upstream from the transcription start site were sequences closely resembling those recognized by B. subtilis sigma 43-RNA polymerase. Two possible ribosome-binding sites were observed downstream from the transcription start site. These were followed by a long open reading frame capable of encoding a protein of ca. 55,000 daltons. A signal sequence, typical of those present in gram-positive organisms, was observed at the amino terminus of the open reading frame. Purification of the mature exocellular beta-1,4-glucanase and subsequent amino-terminal protein sequencing defined the site of signal sequence processing to be between two alanine residues following the hydrophobic portion of the signal sequence. The probability of additional carboxy-terminal processing of the beta-1,4-glucanase precursor is discussed. S1 nuclease protection studies showed that the amount of beta-1,4-glucanase mRNA in cells increased significantly as the culture entered the stationary phase. In addition, glucose was found to dramatically stimulate the amount of beta-1,4-glucanase mRNA in vivo. Finally, the specific activities of purified B. subtilis DLG endo-beta-1,4-glucanase and Trichoderma reesei QM9414 endo-beta-1,4-glucanase (EC 3.2.1.4) were compared by using the noncrystalline cellulosic substrate trinitrophenyl-carboxymethyl cellulose.
|
279. |
Miles JS,
Guest JR,
( 1985 ) Complete nucleotide sequence of the fumarase gene (citG) of Bacillus subtilis 168. PMID : 3923430 : DOI : 10.1093/nar/13.1.131 PMC : PMC340979 Abstract >>
The nucleotide sequence of a 2.14 kb fragment of Bacillus subtilis DNA containing the citG gene encoding fumarase was determined using the dideoxy chain termination method. The citG coding region of 1392 base pairs (464 codons) was identified, and the deduced Mr (50425) is in good agreement with that of the protein identified from expression in Escherichia coli maxicells. There is no sequence homology between the B. subtilis and E. coli fumarases. Overlapping potential promoter sequences have been identified for sigma 28, sigma 37 and sigma 55 RNA polymerase holoenzymes. The DNA fragment also contains the proximal part of the gerA locus, responsible for L-alanine-sensitive spore germination.
|
280. |
Nakamura A,
Uozumi T,
Beppu T,
( 1987 ) Nucleotide sequence of a cellulase gene of Bacillus subtilis. PMID : 3106035 : DOI : 10.1111/j.1432-1033.1987.tb11060.x Abstract >>
The nucleotide sequence of an endolytic cellulase gene of Bacillus subtilis was determined and compared with the NH2-terminal amino acid sequence of the purified enzyme. The mature protein appeared to be extended by a signal sequence of 36 amino acids. The putative AUG initiation codon was preceded by a sigma 43-type promoter of B. subtilis and an AAGGAGG sequence, typical of procaryotic ribosomal binding sites. Partial homology of amino acid sequences was found between B. subtilis cellulase and an alkalophilic Bacillus cellulase.
|
281. |
Smith H,
de Jong A,
Bron S,
Venema G,
( 1988 ) Characterization of signal-sequence-coding regions selected from the Bacillus subtilis chromosome. PMID : 3145906 : DOI : 10.1016/0378-1119(88)90207-7 Abstract >>
Signal-sequence-coding regions for protein export were selected from chromosomal Bacillus subtilis DNA. The number of different signals obtained was higher than expected on the basis of known exported proteins in B. subtilis. Most of the selected regions showed the characteristics of typical signal sequences, including a basic N-terminal region followed by a hydrophobic core and a potential signal-peptidase cleavage site. The signal-coding regions were functionally interchangeable between the B. licheniformis alpha-amylase and Escherichia coli TEM beta-lactamase genes. In addition to the signal-sequence-coding regions, the nature of the host cells, and the mature parts of the reporter proteins contributed to the amounts of protein secreted.
|
282. |
Bode W,
Papamokos E,
Musil D,
( 1987 ) The high-resolution X-ray crystal structure of the complex formed between subtilisin Carlsberg and eglin c, an elastase inhibitor from the leech Hirudo medicinalis. Structural analysis, subtilisin structure and interface geometry. PMID : 3301348 : DOI : 10.1111/j.1432-1033.1987.tb13566.x Abstract >>
Triclinic crystals of the complex formed by eglin with subtilisin Carlsberg were analyzed by X-ray diffraction. The crystal and molecular structure of this complex was determined with data that extended to 0.12-nm resolution by a combination of Patterson search methods and isomorphous replacement techniques. Its structure was refined to a crystallographic R value of 0.178 (1.0-0.12 nm) using an energy-restraint least-squares procedure. The complete subtilisin molecule could be traced without ambiguity in the refined electron density. The eglin component, from which an amino-terminal segment is cleaved off, is only defined from Lys8I (i.e. the lysine residue 8 of the inhibitor) onwards. Per unit cell, 436 fixed solvent molecules and 2 calcium ions were located. In spite of 84 amino acid replacements and one deletion, subtilisin Carlsberg exhibits a very similar polypeptide fold to subtilisin BPN'. The root-mean-square deviations of all alpha-carbon atoms (excluding those at the deletion site) from models of subtilisin BPN' [Alden, R. A., Birktoft, J. J., Kraut, J., Robertus, J. D. & Wright, C. S. (1971) Biochem. Biophys. Res. Commun. 45, 337-344] and subtilisin Novo [Drenth, J., Hol, W. G. J., Jansonius, J. N. & Kockoek, R. (1972) Eur. J. Biochem. 25, 177-181] are 0.077 nm and 0.103 nm. Most of these deviations result from global shifts rather than changes of the local geometry. The single-residue deletion at position 56 affects only the surrounding conformation. Two sites of high electron density and close distances to surrounding oxygen ligands have been found in the Carlsberg enzyme which are probably occupied by calcium ions. Eglin consists of a twisted four-stranded beta-sheet flanked by an alpha-helix and by an exposed proteinase binding loop on opposite sides. Around the reactive site, Leu45I-Asp46I, this loop is mainly stabilized by electrostatic/hydrogen bond interactions with the side chains of two arginine residues which project from the hydrophobic core [Bode, W., Papamokos, E., Musil, D., Seem?ller, W. & Fritz, H. (1986) EMBO J. 5, 813-818]. The reactive site loop conformation resembles that found in other 'small' proteinase inhibitors. The scissile peptide bond is not cleaved but its carbonyl group is slightly distorted from planar geometry. Most of the intermolecular contacts are contributed by the nine residues of the reactive-site loop Gly40I-Arg48I.(ABSTRACT TRUNCATED AT 400 WORDS)
|
283. |
Monod M,
Denoya C,
Dubnau D,
( 1986 ) Sequence and properties of pIM13, a macrolide-lincosamide-streptogramin B resistance plasmid from Bacillus subtilis. PMID : 3087948 : DOI : 10.1128/jb.167.1.138-147.1986 PMC : PMC212852 Abstract >>
We initiated a study of pIM13, a multicopy, macrolide-lincosamide-streptogramin B (MLS) plasmid first isolated from a strain of Bacillus subtilis and described by Mahler and Halvorson (J. Gen. Microbiol. 120:259-263, 1980). The copy number of this plasmid was about 200 in B. subtilis and 30 in Staphylococcus aureus. The MLS resistance determinant of pIM13 was shown to be highly homologous to ermC, an inducible element on the S. aureus plasmid pE194. The product of the pIM13 determinant was similar in size to that of ermC and immunologically cross-reactive with it. The MLS resistance of pIM13 was expressed constitutively. The complete base sequence of pIM13 is presented. The plasmid consisted of 2,246 base pairs and contained two open reading frames that specified products identified in minicell extracts. One was a protein of 16,000 molecular weight, possibly required for replication. The second was the 29,000-molecular-weight MLS resistance methylase. The regulatory region responsible for ermC inducibility was missing from pIM13, explaining its constitutivity. The remainder of the pIM13 MLS determinant was nearly identical to ermC. The ends of the region of homology between pIM13 and pE194 were associated with hyphenated dyad symmetries. A segment partially homologous to one of these termini on pIM13 and also associated with a dyad was found in pUB110 near the end of a region of homology between that plasmid and pBC16. The entire sequence of pIM13 was highly homologous to that of pE5, an inducible MLS resistance plasmid from S. aureus that differs from pIM13 in copy control.
|
284. |
Chen NY,
Hu FM,
Paulus H,
( 1987 ) Nucleotide sequence of the overlapping genes for the subunits of Bacillus subtilis aspartokinase II and their control regions. PMID : 3036830 : Abstract >>
The nucleotide sequence of a 2.9-kilobase Bacillus subtilis DNA fragment containing the entire coding region of aspartokinase II and adjacent chromosomal regions (Bondaryk, R. P., and Paulus, H. (1985a) J. Biol. Chem. 260, 585-591) has been determined. The results confirmed the earlier prediction that the two subunits of aspartokinase II, alpha and beta, are encoded by in-phase overlapping genes. The nucleotide sequence showed strong ribosome binding sites before the translation initiation codons of the alpha and beta subunits. Deletion of most of the coding region unique to the alpha subunit had no effect on the synthesis of the smaller beta subunit, demonstrating that the beta subunit is indeed the product of independent translation. The site of transcription initiation of the aspartokinase gene was found to be more than 300 nucleotides upstream from the translation start of the alpha subunit. The intervening region contained a short reading frame capable of encoding a 24-residue lysine-rich polypeptide, which overlaps a region of extensive dyad symmetry culminating in a rho-independent transcription terminator. This region may be an attenuator control element that regulates the expression of the aspartokinase gene in response to the availability of lysine, the end product of the pathway. The coding sequence of the aspartokinase II subunits was immediately followed by a rho-independent transcription terminator. This termination site has an unusual symmetry, which allows it also to serve as transcription terminator for a gene that converges on the aspartokinase II gene from the opposite direction, an interesting example of genetic economy. The deduced amino acid sequence of B. subtilis aspartokinase II was compared with the sequences of the three aspartokinases from Escherichia coli (Cassan, M., Parsot, C., Cohen, G. N., and Patte, J. C. (1986) J. Biol. Chem. 261, 1052-1057). Significant sequence similarities suggest a close evolutionary relationship between the four enzymes.
|
285. |
McIntyre ABR,
Alexander N,
Grigorev K,
Bezdan D,
Sichtig H,
Chiu CY,
Mason CE,
( 2019 ) Single-molecule sequencing detection of N6-methyladenine in microbial reference materials. PMID : 30718479 : DOI : 10.1038/s41467-019-08289-9 PMC : PMC6362088 Abstract >>
The DNA base modification N6-methyladenine (m6A) is involved in many pathways related to the survival of bacteria and their interactions with hosts. Nanopore sequencing offers a new, portable method to detect base modifications. Here, we show that a neural network can improve m6A detection at trained sequence contexts compared to previously published methods using deviations between measured and expected current values as each adenine travels through a pore. The model, implemented as the mCaller software package, can be extended to detect known or confirm suspected methyltransferase target motifs based on predictions of methylation at untrained contexts. We use PacBio, Oxford Nanopore, methylated DNA immunoprecipitation sequencing (MeDIP-seq), and whole-genome bisulfite sequencing data to generate and orthogonally validate methylomes for eight microbial reference species. These well-characterized microbial references can serve as controls in the development and evaluation of future methods for the identification of base modifications from single-molecule sequencing data.
|
286. |
Ikemura H,
Takagi H,
Inouye M,
( 1987 ) Requirement of pro-sequence for the production of active subtilisin E in Escherichia coli. PMID : 3108260 : Abstract >>
Subtilisin E, an alkaline serine protease of Bacillus subtilis 168, is first produced as a precursor, pre-pro-subtilisin, which consists of a signal peptide for protein secretion (pre-sequence) and a peptide extension of 77 amino acid residues (pro-sequence) between the signal peptide and mature subtilisin. When the entire coding region for pre-pro-subtilisin E was cloned into an Escherichia coli expression vector, active mature subtilisin E was secreted into the periplasmic space. When the pre-sequence was replaced with the E. coli OmpA signal peptide, active subtilisin E was also produced. When the OmpA signal peptide was directly fused to the mature subtilisin sequence, no protease activity was detected, although this product had the identical primary structure as subtilisin E as a result of cleavage of the OmpA signal peptide and was produced at a level of approximately 10% of total cellular protein. When the OmpA signal peptide was fused to the 15th or 44th amino acid residue from the amino terminus of the pro-sequence, active subtilisin was also not produced. These results indicate that the pro-sequence of pre-pro-subtilisin plays an important role in the formation of enzymatically active subtilisin. It is proposed that the pro-sequence is essential for guiding appropriate folding of the enzymatically active conformation of subtilisin E.
|
287. |
Suskiewicz MJ,
Hajdusits B,
Beveridge R,
Heuck A,
Vu LD,
Kurzbauer R,
Hauer K,
Thoeny V,
Rumpel K,
Mechtler K,
Meinhart A,
Clausen T,
( 2019 ) Structure of McsB, a protein kinase for regulated arginine phosphorylation. PMID : 30962626 : DOI : 10.1038/s41589-019-0265-y PMC : PMC6522372 Abstract >>
Protein phosphorylation regulates key processes in all organisms. In Gram-positive bacteria, protein arginine phosphorylation plays a central role in protein quality control by regulating transcription factors and marking aberrant proteins for degradation. Here, we report structural, biochemical, and in vivo data of the responsible kinase, McsB, the founding member of an arginine-specific class of protein kinases. McsB differs in structure and mechanism from protein kinases that act on serine, threonine, and tyrosine residues and instead has a catalytic domain related to that of phosphagen kinases (PhKs), metabolic enzymes that phosphorylate small guanidino compounds. In McsB, the PhK-like phosphotransferase domain is structurally adapted to target protein substrates and is accompanied by a novel phosphoarginine (pArg)-binding domain that allosterically controls protein kinase activity. The identification of distinct pArg reader domains in this study points to a remarkably complex signaling system, thus challenging simplistic views of bacterial protein phosphorylation.
|
288. |
Melin L,
Magnusson K,
Rutberg L,
( 1987 ) Identification of the promoter of the Bacillus subtilis sdh operon. PMID : 3036777 : DOI : 10.1128/jb.169.7.3232-3236.1987 PMC : PMC212374 Abstract >>
The Bacillus subtilis sdhCAB operon contains the structural genes for the three subunits of the membrane bound succinate dehydrogenase complex. An sdh-specific transcript of about 3,450 nucleotides was detected in vegetative bacteria. S1 nuclease mapping experiments showed that the sdh operon is transcribed from a sigma-43 promoter; the transcript starts at a guanosine residue 90 base pairs upstream from the first gene of the operon, sdhC. No sdh transcript was found in B. subtilis carrying the sdh-115 mutation, which decreases expression of the sdh operon by more than 99%. The sdh-115 mutation is a G-to-A transition in the -35 region of the sigma-43 promoter. The sdh operon is sensitive to glucose repression. When the sdh promoter region was used to drive transcription of the cat-86 gene this gene also became glucose repressed.
|
289. |
Makaguchi R,
Shishido K,
Hoshino T,
Furukawa K,
( 1986 ) The nucleotide sequence of the tetracycline resistance gene of plasmid pNS1981 from Bacillus subtilis differs from pTHT15 from a Thermophilic bacillus by two base pairs. PMID : 3090576 : Abstract >>
N/A
|
290. |
Kamei K,
Hara S,
Ikenaka T,
Murao S,
( 1988 ) Amino acid sequence of a lysozyme (B-enzyme) from Bacillus subtilis YT-25. PMID : 3148618 : DOI : 10.1093/oxfordjournals.jbchem.a122558 Abstract >>
The amino acid sequence of a lysozyme, (B-enzyme), from Bacillus subtilis YT-25 was determined by conventional methods. B-Enzyme comprised 117 amino acid residues and had a heterogeneous sequence in the amino-terminal region. The amino acid sequence of B-enzyme was different from those of all other lysozymes the sequences of which are known. However, the partial amino acid sequence of Ser(74) to Ser(97) of B-enzyme was homologous with that of the active-site region of hen egg-white lysozyme (Ser(36) to Ser(60], which includes one of the catalytic amino acids, Asp(52). It is interesting that B-enzyme has an amino acid sequence homologous with that of the gag protein p25 of the AIDS virus ARV-2.
|
291. |
Wu B,
Zheng S,
Pedroso MM,
Guddat LW,
Chang S,
He B,
Schenk G,
( 2018 ) Processivity and enzymatic mechanism of a multifunctional family 5 endoglucanase from Bacillus subtilis BS-5 with potential applications in the saccharification of cellulosic substrates. PMID : 29422948 : DOI : 10.1186/s13068-018-1022-2 PMC : PMC5787917 Abstract >>
Presently, enzymes still constitute a major part of the cost of biofuel production from lignocellulosic biomass. Processive endoglucanases, which possess both endoglucanase and exoglucanase activity, have the potential to reduce the costs of biomass saccharification when used together with commercial cellulases. Therefore, the exploration of new processive endoglucanases has attracted much attention with a view to accelerating the industrialization of biofuels and biochemicals. The endoglucanase EG5C and its truncated form EG5C-1 from Bacillus subtilis BS-5 were expressed and characterized. EG5C was a typical endoglucanase, comprised of a family 5 catalytic domain and family 3 carbohydrate-binding domain, and which had high activity toward soluble cellulosic substrates, but low activity toward insoluble cellulosic substrates. Importantly, the truncated form EG5C-1 was a processive endoglucanase that hydrolyzed not only carboxymethyl cellulose (CMC), but also insoluble cellulosic substrates. The hydrolytic activities of EG5C-1 towards CMC, phosphoric acid-swollen cellulose (PASC), p-nitrophenyl-�]-d-cellobioside, filter paper and Avicel are 4170, 700, 2550, 405 and 320 U/�gmol, respectively. These data demonstrated that EG5C-1 had higher activity ratio of exoglucanase to endoglucanase than other known processive endoglucanases. When PASC was degraded by EG5C-1, the ratio of soluble to insoluble reducing sugars was about 3.7 after 3 h of incubation with cellobiose and cellotriose as the main products. Importantly, EG5C-1 alone was able to hydrolyze filter paper and PASC. At 5% substrate concentration and 10 FPU/g PASC enzyme loading, the saccharification yield was 76.5% after 60 h of incubation. Replacement of a phenylalanine residue (F238) by an alanine at the entrance/exit of the substrate binding cleft significantly reduces the ability of EG5C-1 to degrade filter paper and Avicel, but this mutation has little impact on CMCase activity. The processivity of this mutant was also greatly reduced while its cellulose binding ability was markedly enhanced. The processive endoglucanase EG5C-1 from B. subtilis BS-5 exhibits excellent properties that render it a suitable candidate for use in biofuel and biochemical production from lignocellulosic biomass. In addition, our studies also provide useful information for research on enzyme processivity at the molecular level.
|
292. |
Abdellaziz L,
Chollet M,
Abderrahmani A,
Béchet M,
Yaici L,
Chataigné G,
Arias AA,
Leclère V,
Jacques P,
( 2018 ) Lipopeptide biodiversity in antifungal Bacillus strains isolated from Algeria. PMID : 29947835 : DOI : 10.1007/s00203-018-1537-8 Abstract >>
Several Bacillus strains have been well studied for their ability to control soil-borne plant diseases. This property is linked to the production of several families of lipopeptides. Depending of their structure, these compounds show antifungal and/or plant systemic resistance inducing activities. In this work, the biodiversity of lipopeptides produced by different antifungal Bacillus strains isolated from seeds, rhizospheric, and non-rhizospheric soils in Algeria was analyzed. Sixteen active strains were characterized by PCR for their content in genes involved in lipopeptide biosynthesis and by MALDI-ToF for their lipopeptide production, revealing a high biodiversity of products. The difficulty to detect kurstakin genes led us to design two new sets of specific primers. An interesting potential of antifungal activity and the synthesis of two forms of fengycins differing in the eighth amino acid (Gln/Glu) were found from the strain 8. Investigation of its genome led to the finding of an adenylation domain of the fengycin synthetase predicted to activate the glutamate residue instead of the glutamine one. According to the comparison of both the results of MALDI-ToF-MS and genome analysis, it was concluded that this adenylation domain could activate both residues at the same time. This study highlighted that the richness of the Algerian ecosystems in Bacillus strains is able to produce: surfactin, pumilacidin, lichenysin, kurstakin, and different types of fengycins.
|
293. |
Kiss A,
Posfai G,
Keller CC,
Venetianer P,
Roberts RJ,
( 1985 ) Nucleotide sequence of the BsuRI restriction-modification system. PMID : 2997708 : DOI : 10.1093/nar/13.18.6403 PMC : PMC321967 Abstract >>
The genes of the 5'-GGCC specific BsuRI restriction-modification system of Bacillus subtilis have been cloned and expressed in E. coli and their nucleotide sequence has been determined. The restriction and modification genes code for polypeptides with calculated molecular weights of 66,314 and 49,642, respectively. Both enzymes are coded by the same DNA strand. The restriction gene is upstream of the methylase gene and the coding regions are separated by 780 bp. Analysis of the RNA transcripts by S1-nuclease mapping indicates that the restriction and modification genes are transcribed from different promoters. Comparison of the amino acid sequences revealed no homology between the BsuRI restriction and modification enzymes. There are, however, regions of homology between the BsuRI methylase and two other GGCC specific modification enzymes, the BspRI and SPR methylases.
|
294. |
Steinmetz M,
Le Coq D,
Aymerich S,
Gonzy-Tréboul G,
Gay P,
( 1985 ) The DNA sequence of the gene for the secreted Bacillus subtilis enzyme levansucrase and its genetic control sites. PMID : 2993818 : DOI : 10.1007/bf00425427 Abstract >>
We present the sequence of a 2 kb fragment of the Bacillus subtilis Marburg genome containing sacB, the structural gene of levansucrase, a secreted enzyme inducible by sucrose. The peptide sequence deduced for the secreted enzyme is very similar to that directly determined by Delfour (1981) for levansucrase of the non-Marburg strain BS5. The peptide sequence is preceded by a 29 amino acid signal peptide. Codon usage in sacB is rather different from that in the sequenced genes of other secreted enzymes in B. subtilis, especially alpha-amylase. Genetic evidence has shown that the sacB promotor is rather far from the beginning of sacB (200 bp or more). The 200 bp region preceding sacB shows some of the features of an attenuator. A preliminary discussion of the putative workings and roles of this attenuator-like structure is proposed. sacRc mutations, which allow constitutive expression of levansucrase, have been located within the 450 bp upstream of sacB. It is shown that sacRc and sacR+ alleles control in cis the expression of the adjacent sacB gene.
|
295. |
MacKay RM,
Lo A,
Willick G,
Zuker M,
Baird S,
Dove M,
Moranelli F,
Seligy V,
( 1986 ) Structure of a Bacillus subtilis endo-beta-1,4-glucanase gene. PMID : 3024130 : DOI : 10.1093/nar/14.22.9159 PMC : PMC311936 Abstract >>
The nucleotide sequence of the portion of a Bacillus subtilis (strain PAP115) 3 kb Pst I fragment which contains an endo-beta-1, 4-glucanase gene has been determined. This gene encodes a protein of 499 amino acid residues (Mr = 55,234) with a typical B. subtilis signal peptide. Escherichia coli which has been transformed with this gene produces an extracellular endoglucanase with an amino-terminus corresponding to the thirtieth encoded amino acid residue. The gene is preceded by a cryptic reading frame with a rho-independent terminator structure, and itself has such a structure in the immediate 3'-flanking region. We have also identified, in the 5'-flanking region, nucleotide sequences which resemble promoter elements recognized by Bacillus RNA polymerase E sigma 43. Comparison of the encoded amino acid sequence to other known beta-glucanases reveals a small region of similarity to the encoded protein of the Clostridium thermocellum celB gene. These similar regions may contain substrate-binding and/or catalytic sites.
|
296. |
Fujita Y,
Fujita T,
Miwa Y,
Nihashi J,
Aratani Y,
( 1986 ) Organization and transcription of the gluconate operon, gnt, of Bacillus subtilis. PMID : 3020045 : Abstract >>
The gluconate (gnt) operon of Bacillus subtilis has been cloned and sequenced. Analysis of the sequence (5482 base pairs) revealed four open reading frames, each of which was preceded by a Shine-Dalgarno sequence. These four frames were designated from the 5'-end as gntR, gntK, gntP, and gntZ. The gntR and gntK genes overlapped by 5 bases. The gntK and gntP gene products (consisting of 513 and 448 amino acids) were identified as gluconate kinase and permease, respectively, by means of insertional inactivation and deletion analysis of these genes subcloned in plasmid pC194. The functions of the gntR and gntZ gene products (243 and 468 amino acids) are presently unknown. S1 nuclease mapping and subcloning in a promoter probe vector (pPL603B) provided evidence that the gnt operon was transcribed as a polycistronic mRNA. Besides the gnt promoter about 40 base pairs upstream of the gntR gene, we detected two overlapping internal promoters between the gntP and gntZ genes. The gnt transcripts terminate about 45 base pairs downstream of the gntZ gene.
|
297. |
Wang XC,
You SP,
Zhang JX,
Dai YM,
Zhang CY,
Qi W,
Dou TY,
Su RX,
He ZM,
( 2018 ) Rational design of a thermophilic �]-mannanase fromBacillus subtilis TJ-102 to improve its thermostability. PMID : 30143199 : DOI : 10.1016/j.enzmictec.2018.07.005 Abstract >>
A rational design method to improve �]-mannanase (ManTJ102) thermostability was developed successfully in this study. The flexible area of residues 330-340 in ManTJ102 was firstly selected from analysis of molecular dynamics simulation and then the critical amino acid residue (Ala336Pro) with the lowest mutation energy was determined by virtual mutation, whose mutant was named as Mutant336. Afterward, the dynamics transition temperature (Tdtt) of ManTJ102 and Mutant336 was evaluated by simulated annealing and heating, and Mutant336 with higher Tdtt was implemented for experimental verification of the enzyme thermostability. As a result, the half-life of Mutant336 activity was 120 min at 60 �XC, which was 24-fold of ManTJ102, and the irreversible thermal denaturation constant of Mutant336 was only about 2/5 of ManTJ102, indicating that Mutant336 has better thermostability than ManTJ102. Furthermore, Mutant336 has much higher �]-mannanase activity and specific activity than ManTJ102. Therefore, Mutant336 was more suitable to further research for applications.
|
298. |
Moriya S,
Ogasawara N,
Yoshikawa H,
( 1985 ) Structure and function of the region of the replication origin of the Bacillus subtilis chromosome. III. Nucleotide sequence of some 10,000 base pairs in the origin region. PMID : 2987847 : DOI : 10.1093/nar/13.7.2251 PMC : PMC341153 Abstract >>
Approximately 10,000 nucleotides were sequenced in the oriC region of the Bacillus subtilis chromosome. The first replicating DNA strands are hybridized with a SalI-EcoRI fragment (nucleotide #1206-2954) in one direction (left to right) and an EcoRI-PstI fragment (#2949-4233) in the other. Seven open reading frames (ORF) accompanied with Shine-Dalgarno (SD) sequences were identified. ORF638 and ORF821 were identified as gyrB and gyrA genes respectively based on genetic evidences and amino acid sequence data. Comparison of amino acid sequences revealed that ORF44, ORF446, ORF378 and ORF323 are homologous with rpmH, dnaA, dnaN and recF of Escherichia coli, respectively. Thus, the organization of the ORFs from ORF44 to ORF638 resembles the organization of genes in the rpmH-gyrB region of the E. coli chromosome. Two non-coding regions characteristic for oriC signals were found near the site of initiation of the first replicating DNA. They are composed of repeating sequences whose consensus sequence TTAT(C/A)CACA is identical to that of 4 repeating sequences in the oriC of E. coli.
|
299. |
Usluer GD,
DiMaio F,
Yang SK,
Hansen JM,
Polka JK,
Mullins RD,
Kollman JM,
( 2018 ) Cryo-EM structure of the bacterial actin AlfA reveals unique assembly and ATP-binding interactions and the absence of a conserved subdomain. PMID : 29440491 : DOI : 10.1073/pnas.1715836115 PMC : PMC5879662 Abstract >>
Bacterial actins are an evolutionarily diverse family of ATP-dependent filaments built from protomers with a conserved structural fold. Actin-based segregation systems are encoded on many bacterial plasmids and function to partition plasmids into daughter cells. The bacterial actin AlfA segregates plasmids by a mechanism distinct from other partition systems, dependent on its unique dynamic properties. Here, we report the near-atomic resolution electron cryo-microscopy structure of the AlfA filament, which reveals a strikingly divergent filament architecture resulting from the loss of a subdomain conserved in all other actins and a mode of ATP binding. Its unusual assembly interfaces and nucleotide interactions provide insight into AlfA dynamics, and expand the range of evolutionary variation accessible to actin quaternary structure.
|
300. |
Szewczak-Harris A,
Löwe J,
( 2018 ) Cryo-EM reconstruction of AlfA from Bacillus subtilis reveals the structure of a simplified actin-like filament at 3.4-? resolution. PMID : 29440489 : DOI : 10.1073/pnas.1716424115 PMC : PMC5879667 Abstract >>
Low copy-number plasmid pLS32 of Bacillus subtilis subsp. natto contains a partitioning system that ensures segregation of plasmid copies during cell division. The partitioning locus comprises actin-like protein AlfA, adaptor protein AlfB, and the centromeric sequence parN Similar to the ParMRC partitioning system from Escherichia coli plasmid R1, AlfA filaments form actin-like double helical filaments that arrange into an antiparallel bipolar spindle, which attaches its growing ends to sister plasmids through interactions with AlfB and parN Because, compared with ParM and other actin-like proteins, AlfA is highly diverged in sequence, we determined the atomic structure of nonbundling AlfA filaments to 3.4-? resolution by cryo-EM. The structure reveals how the deletion of subdomain IIB of the canonical actin fold has been accommodated by unique longitudinal and lateral contacts, while still enabling formation of left-handed, double helical, polar and staggered filaments that are architecturally similar to ParM. Through cryo-EM reconstruction of bundling AlfA filaments, we obtained a pseudoatomic model of AlfA doublets: the assembly of two filaments. The filaments are antiparallel, as required by the segregation mechanism, and exactly antiphasic with near eightfold helical symmetry, to enable efficient doublet formation. The structure of AlfA filaments and doublets shows, in atomic detail, how deletion of an entire domain of the actin fold is compensated by changes to all interfaces so that the required properties of polymerization, nucleotide hydrolysis, and antiparallel doublet formation are retained to fulfill the system's biological raison d'?tre.
|
301. |
Lin CK,
Goldfarb DS,
Doi RH,
Rodriguez RL,
( 1985 ) Mutations that affect the translation efficiency of Tn9-derived cat gene in Bacillus subtilis. PMID : 2982142 : DOI : 10.1073/pnas.82.1.173 PMC : PMC396994 Abstract >>
We have isolated two spontaneous mutations that increase the expression of the Tn9-derived cat gene in Bacillus subtilis. These mutations, which appear to affect initiation of translation of chloramphenicol acetyltransferase (CAT; acetyl-CoA:chloramphenicol 3-O-acetyltransferase, EC 2.3.1.28) consist of a tandem duplication and triplication of a 55-base-pair sequence located at the 5' end of cat. Included in the repeated sequence are the Shine-Dalgarno site, initiation codon, and a region of dyad symmetry located within the structural portion of the cat gene. A striking feature of the mutated initiation sites is their potential to form stem-loop structures at the 5' end of the cat messenger RNA. Within the single-stranded loops of these structures are the ribosome binding site and initiation codon for the cat gene. It appears that the Gram-negative cat translation initiation site has mutated to permit efficient utilization in B. subtilis without directly affecting Shine-Dalgarno sequence homology. This report suggests that secondary structure in the vicinity of the Shine-Dalgarno site can exert a strong positive influence on the initiation of translation in B. subtilis.
|
302. |
( 2013 ) Cloning, expression, and characterization of �]-mannanase from Bacillus subtilis MAFIC-S11 in Pichia pastoris. PMID : 23446982 : DOI : 10.1007/s12010-013-0156-8 Abstract >>
The �]-mannanase gene (1,029 nucleotide) from Bacillus subtilis MAFIC-S11, encoding a polypeptide of 342 amino acids, was cloned and expressed in Pichia pastoris. To increase its expression, the �]-mannanase gene was optimized for codon usage (mannS) and fused downstream to a sequence-encoding modified �\-factor signal peptide. The expression level was improved by 2-fold. This recombinant enzyme (mannS) showed its highest activity of 24,600 U/mL after 144-h fermentation. The optimal temperature and pH of mannS were 50 �XC and 6.0, respectively, and its specific activity was 3,706 U/mg. The kinetic parameters V max and K m were determined as 20,000 U/mg and 8 mg/mL, respectively, representing the highest ever expression level of �]-mannanase reported in P. pastoris. In addition, the enzyme exhibited much higher binding activity to chitin, chitosan, Avicel, and mannan. The superior catalytic properties of mannS suggested great potential as an effective additive in animal feed industry.
|
303. |
( 2013 ) Over-expression, secretion, biochemical characterisation, and structure analysis of Bacillus subtilis aminopeptidase. PMID : 23426795 : DOI : 10.1002/jsfa.6105 Abstract >>
Aminopeptidases have great application in the food industry. Current research on the expression of aminopeptidases mainly focuses on the Escherichia coli expression system. However, the application of recombinant E. coli in the food industry is restricted due to its pathogenicity and low secretory efficiency, which should be concerned in the industrial production of aminopeptidases. The gene of aminopeptidase from Bacillus subtilis Zj016 (BSAP) was identified. Over-expression and secretion of BSAP were achieved in a B. subtilis expression system with the signal peptide of itself. The yield researched 52 �� 1.9 U mL(-1) , which was 18 times that of the wild-type microbe. The purified enzyme was stable at pH 7.5-9.0 and below 60�XC, and was inhibited by several metal ions except appropriate Co(2+) . BSAP was most active toward p-nitroaniline derivatives of Leu, Arg and Lys. Homology modelling and structure analysis showed that there was a flexible protease-associated domain in the predicted structure of BSAP. The study presented a simple procedure for over-expression and purification of BSAP. The substrate specificity and structure information were indicated based on the characterisation and homology modelling. This will be useful for further research of aminopeptidases not only from an academic standpoint but also from an applied point of view.
|
304. |
( 2013 ) Conformational change-induced repeat domain expansion regulates Rap phosphatase quorum-sensing signal receptors. PMID : 23526881 : DOI : 10.1371/journal.pbio.1001512 PMC : PMC3601965 Abstract >>
The large family of Gram-positive quorum-sensing receptors known as the RNPP proteins consists of receptors homologous to the Rap, NprR, PlcR, and PrgX proteins that are regulated by imported oligopeptide autoinducers. Rap proteins are phosphatases and transcriptional anti-activators, and NprR, PlcR, and PrgX proteins are DNA binding transcription factors. Despite their obvious importance, the mechanistic basis of oligopeptide receptor regulation is largely unknown. Here, we report the X-ray crystal structure of the Bacillus subtilis quorum-sensing receptor RapJ in complex with the centrally important oligopeptide autoinducer competence and sporulation factor (CSF, also termed PhrC), a member of the Phr family of quorum-sensing signals. Furthermore, we present the crystal structure of RapI. Comparison of the RapJ-PhrC, RapI, RapH-Spo0F, and RapF-ComA(C) crystal structures reveals the mechanistic basis of Phr activity. More specifically, when complexed with target proteins, Rap proteins consist of a C-terminal tetratricopeptide repeat (TPR) domain connected by a flexible helix-containing linker to an N-terminal 3-helix bundle. In the absence of a target protein or regulatory peptide, the Rap protein 3-helix bundle adopts different conformations. However, in the peptide-bound conformation, the Rap protein N-terminal 3-helix bundle and linker undergo a radical conformational change, form TPR-like folds, and merge with the existing C-terminal TPR domain. To our knowledge, this is the first example of conformational change-induced repeat domain expansion. Furthermore, upon Phr binding, the entire Rap protein is compressed along the TPR superhelical axis, generating new intramolecular contacts that lock the Rap protein in an inactive state. The fact that Rap proteins are conformationally flexible is surprising considering that it is accepted dogma that TPR proteins do not undergo large conformational changes. Repeat proteins are widely used as scaffolds for the development of designed affinity reagents, and we propose that Rap proteins could be used as scaffolds for engineering novel ligand-switchable affinity reagents.
|
305. |
Wang F,
Burrage AM,
Postel S,
Clark RE,
Orlova A,
Sundberg EJ,
Kearns DB,
Egelman EH,
( 2017 ) A structural model of flagellar filament switching across multiple bacterial species. PMID : 29038601 : DOI : 10.1038/s41467-017-01075-5 PMC : PMC5643327 Abstract >>
The bacterial flagellar filament has long been studied to understand how a polymer composed of a single protein can switch between different supercoiled states with high cooperativity. Here we present near-atomic resolution cryo-EM structures for flagellar filaments from both Gram-positive Bacillus subtilis and Gram-negative Pseudomonas aeruginosa. Seven mutant flagellar filaments in B. subtilis and two in P. aeruginosa capture two different states of the filament. These reliable atomic models of both states reveal conserved molecular interactions in the interior of the filament among B. subtilis, P. aeruginosa and Salmonella enterica. Using the detailed information about the molecular interactions in two filament states, we successfully predict point mutations that shift the equilibrium between those two states. Further, we observe the dimerization of P. aeruginosa outer domains without any perturbation of the conserved interior of the filament. Our results give new insights into how the flagellin sequence has been "tuned" over evolution.Bacterial flagellar filaments are composed almost entirely of a single protein-flagellin-which can switch between different supercoiled states in a highly cooperative manner. Here the authors present near-atomic resolution cryo-EM structures of nine flagellar filaments, and begin to shed light on the molecular basis of filament switching.
|
306. |
( 2013 ) Biodiversity of aerobic endospore-forming bacterial species occurring in Yanyanku and Ikpiru, fermented seeds of Hibiscus sabdariffa used to produce food condiments in Benin. PMID : 23571124 : DOI : 10.1016/j.ijfoodmicro.2013.02.008 Abstract >>
Yanyanku and Ikpiru made by the fermentation of Malcavene bean (Hibiscus sabdariffa) are used as functional additives for Parkia biglobosa seed fermentations in Benin. A total of 355 aerobic endospore-forming bacteria (AEFB) isolated from Yanyanku and Ikpiru produced in northern and southern Benin were identified using phenotypic and genotypic methods, including GTG5-PCR, M13-PCR, 16S rRNA, gyrA and gyrB gene sequencing. Generally, the same 5-6 species of the genus Bacillus predominated: Bacillus subtilis (17-41% of isolates), Bacillus cereus (8-39%), Bacillus amyloliquefaciens (9-22%), Bacillus licheniformis (3-26%), Bacillus safensis (8-19%) and Bacillus altitudinis (0-19%). Bacillus aryabhattai, Bacillus flexus, and Bacillus circulans (0-2%), and species of the genera Lysinibacillus (0-14%), Paenibacillus (0-13%), Brevibacillus (0-4%), and Aneurinibacillus (0-3%) occurred sporadically. The diarrheal toxin encoding genes cytK-1, cytK-2, hblA, hblC, and hblD were present in 0%, 91% 15%, 34% and 35% of B. cereus isolates, respectively. 9% of them harbored the emetic toxin genetic determinant, cesB. This study is the first to identify the AEFB of Yanyanku and Ikpiru to species level and perform a safety evaluation based on toxin gene detections. We further suggest, that the gyrA gene can be used for differentiating the closely related species Bacillus pumilus and B. safensis.
|
307. |
Takenaka S,
Yoshinami J,
Kuntiya A,
Techapun C,
Leksawasdi N,
Seesuriyachan P,
Chaiyaso T,
Watanabe M,
Tanaka K,
Yoshida KI,
( 2018 ) Characterization and mutation analysis of a halotolerant serine protease from a new isolate of Bacillus subtilis. PMID : 29038928 : DOI : 10.1007/s10529-017-2459-2 Abstract >>
A bacterial halotolerant enzyme was characterized to understand the molecular mechanism of salt adaptation and to explore its protein engineering potential. Halotolerant serine protease (Apr_No16) from a newly isolated Bacillus subtilis strain no. 16 was characterized. Multiple alignments with previously reported non-halotolerant proteases, including subtilisin Carlsberg, indicated that Apr_No16 has eight acidic or polar amino acid residues that are replaced by nonpolar amino acids in non-halotolerant proteases. Those residues were hypothesized to be one of the primary contributors to salt adaptation. An eightfold mutant substituted with Ala residues exhibited 1.2- and 1.8-fold greater halotolerance at 12.5% (w/v) NaCl than Apr_No16 and Carlsberg, respectively. Amino acid substitution notably shifted the theoretical pI of the eightfold mutant, from 6.33 to 9.23, compared with Apr_No16. The resulting protein better tolerated high salt conditions. Changing the pI of a bacterial serine protease may be an effective strategy to improve the enzyme's halotolerance.
|
308. |
( 2012 ) Antimicrobial susceptibility of Bacillus strains isolated from primary starters for African traditional bread production and characterization of the bacitracin operon and bacitracin biosynthesis. PMID : 22941078 : DOI : 10.1128/AEM.00730-12 PMC : PMC3485967 Abstract >>
Bacillus spp. are widely used as feed additives and probiotics. However, there is limited information on their resistance to various antibiotics, and there is a growing concern over the transfer of antibiotic resistance genes. The MIC for 8 antibiotics was determined for 85 Bacillus species strains, Bacillus subtilis subsp. subtilis (n = 29), Bacillus licheniformis (n = 38), and Bacillus sonorensis (n = 18), all of which were isolated from starters for Sudanese bread production. All the strains were sensitive to tetracycline (8.0 mg/liter), vancomycin (4.0 mg/liter), and gentamicin (4.0 mg/liter) but resistant to streptomycin. Sensitivity to clindamycin, chloramphenicol, and kanamycin was species specific. The erythromycin resistance genes ermD and ermK were detected by PCR in all of the erythromycin-resistant (MIC, ?16.0 mg/liter) B. licheniformis strains and one erythromycin-sensitive (MIC, 4.0 mg/liter) B. licheniformis strain. Several amino acid changes were present in the translated ermD and ermK nucleotide sequences of the erythromycin-sensitive strain, which could indicate ErmD and ErmK protein functionalities different from those of the resistance strains. The ermD and ermK genes were localized on an 11.4-kbp plasmid. All of the B. sonorensis strains harbored the bacitracin synthetase gene, bacA, and the transporter gene bcrA, which correlated with their observed resistance to bacitracin. Bacitracin was produced by all the investigated species strains (28%), as determined by ultra-high-definition quadrupole time-of-flight liquid chromatography-mass spectrometry (UHD-QTOF LC/MS). The present study has revealed species-specific variations in the antimicrobial susceptibilities of Bacillus spp. and provides new information on MIC values, as well as the occurrence of resistance genes in Bacillus spp., including the newly described species B. sonorensis.
|
309. |
( 2013 ) Co-production of surfactin and a novel bacteriocin by Bacillus subtilis subsp. subtilis H4 isolated from Bikalga, an African alkaline Hibiscus sabdariffa seed fermented condiment. PMID : 23466466 : DOI : 10.1016/j.ijfoodmicro.2013.01.013 Abstract >>
Bikalga is a Hibiscus sabdariffa seed fermented condiment widely consumed in Burkina Faso and neighboring countries. The fermentation is dominated by Bacillus subtilis group species. Ten B. subtilis subsp. subtilis (six isolates) and Bacillus licheniformis (four isolates) isolated from traditional Bikalga were examined for their antimicrobial activity against a panel of 36 indicator organisms including Gram-positive and Gram-negative bacteria and yeasts. The Bacillus spp. isolates showed variable inhibitory abilities depending on the method used. Both Gram-positive and Gram-negative bacteria were inhibited in the agar spot assay while only Gram-positive pathogens were inhibited in the agar well diffusion assay. Cell free supernatants (CFS) of pure cultures of 3 B. subtilis subsp. subtilis (G2, H4 and F1) strains inhibited growth of Listeria monocytogenes, Micrococcus luteus, Staphylococcus aureus and Bacillus cereus, while CFS of 2 B. licheniformis (E3 and F9) strains only inhibited M. luteus. The antimicrobial substance(s) produced by B. subtilis subsp. subtilis H4 was further characterized. The antimicrobial substance(s) produced by H4 was detected from mid-exponential growth phase. The activity was sensitive to protease and trypsin, but resistant to the proteolytic action of proteinase K and papain. Treatment with �\-amylase and lipase II resulted in a complete loss of antimicrobial effect, indicating that a sugar moiety and lipid moiety are necessary for the activity. Treatment with mercapto-ethanol resulted in a significant loss, indicative of the presence of disulfide bridges. The antimicrobial activity of H4 was heat resistant and active at pH3-10. PCR detection of yiwB, sboA, spoX, albA and spaS, etnS genes and genes coding for surfactins and plipastatins (fengycins) indicated a potential for subtilosin, subtilin and lipopeptide production, respectively. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was carried out and a single band of approximately 4kDa had antimicrobial activity. Ultra high performance liquid chromatography-time of flight mass spectrometry (UHPLC-TOFMS) analysis of the 4kDa band allowed identification of surfactin and a protein with a monoisotopic mass of 3346.59Da, which is dissimilar in size to subtilosin and subtilin. Surfactin is a cyclic lipoheptapeptide, which contains a �]-hydroxy fatty acid, but no di-sulfide bridges or sugar residues. The complete loss of activity upon amylase treatment indicates that surfactin was not responsible for the observed antimicrobial effect. However, it cannot completely be ruled out that surfactin acts synergistically with the detected protein, though further investigations are needed to confirm this.
|
310. |
( 2012 ) Strain screening, fermentation, separation, and encapsulation for production of nattokinase functional food. PMID : 22987066 : DOI : 10.1007/s12010-012-9894-2 Abstract >>
This study presents a novel and integrated preparation technology for nattokinase functional food, including strain screening, fermentation, separation, and encapsulation. To rapidly screen a nattokinase-productive strain, PCR-based screening method was combined with fibrinolytic activity-based method, and a high productive strain, Bacillus subtilis LSSE-22, was isolated from Chinese soybean paste. Reduction of poly-�^-glutamic acid (�^-PGA) concentration may contribute to separation of nattokinase and reduction of late-onset anaphylaxis risk. Chickpeas were confirmed as the favorable substrate for enhancement of nattokinase production and reduction of �^-PGA yield. Using cracked chickpeas, the nattokinase activity reached 356.25 �� 17.18 FU/g (dry weight), which is much higher than previous reports. To further reduce �^-PGA concentration, ethanol fractional extraction and precipitation were applied for separation of nattokinase. By extraction with 50 % and precipitation with 75 % ethanol solution, 4,000.58 �� 192.98 FU/g of nattokinase powders were obtained, and the activity recovery reached 89 �� 1 %, while �^-PGA recovery was reduced to 21 �� 2 %. To improve the nattokinase stability at acidic pH condition, the nattokinase powders were encapsulated, and then coated with methacrylic acid-ethyl acrylate copolymer. After encapsulation, the nattokinase was protected from being denatured under various acid conditions, and pH-responsible controlled release at simulated intestinal fluid was realized.
|
311. |
( 2012 ) Improving the thermostability of alpha-amylase by combinatorial coevolving-site saturation mutagenesis. PMID : 23057711 : DOI : 10.1186/1471-2105-13-263 PMC : PMC3478181 Abstract >>
The generation of focused mutant libraries at hotspot residues is an important strategy in directed protein evolution. Existing methods, such as combinatorial active site testing and residual coupling analysis, depend primarily on the evolutionary conserved information to find the hotspot residues. Hardly any attention has been paid to another important functional and structural determinants, the functionally correlated variation information--coevolution. In this paper, we suggest a new method, named combinatorial coevolving-site saturation mutagenesis (CCSM), in which the functionally correlated variation sites of proteins are chosen as the hotspot sites to construct focused mutant libraries. The CCSM approach was used to improve the thermal stability of �\-amylase from Bacillus subtilis CN7 (Amy7C). The results indicate that the CCSM can identify novel beneficial mutation sites, and enhance the thermal stability of wild-type Amy7C by 8�XC (T5030), which could not be achieved with the ordinarily rational introduction of single or a double point mutation. Our method is able to produce more thermostable mutant �\-amylases with novel beneficial mutations at new sites. It is also verified that the coevolving sites can be used as the hotspots to construct focused mutant libraries in protein engineering. This study throws new light on the active researches of the molecular coevolution.
|
312. |
( 2013 ) Isolation and characterization of antagonistic Bacillus strains capable to degrade ethylenethiourea. PMID : 23143288 : DOI : 10.1007/s00284-012-0263-8 Abstract >>
In this study, more than 150 bacteria showing antagonistic properties against bacterial and fungal pathogens of the tomato plant were isolated and characterized. The most efficient agents against these phytopathogenic microorganisms belong to the genus Bacillus: the best biocontrol isolates were representatives of Bacillus subtilis, B. mojavensis and B. amyloliquefaciens species. They intensively produced fengycin or/and surfactin depsipeptide antibiotics and also proved to be excellent protease secretors. It was proved, that the selected strains were able to use ethylenethiourea (ETU) as sole nitrogen source. These antagonistic and ETU-degrading Bacillus strains can be applied as biocontrol and also as bioremediation agents.
|
313. |
( 2012 ) The First structure of a lantibiotic immunity protein, SpaI from Bacillus subtilis, reveals a novel fold. PMID : 22904324 : DOI : 10.1074/jbc.M112.401620 PMC : PMC3471728 Abstract >>
Lantibiotics are peptide-derived antibiotics that inhibit the growth of Gram-positive bacteria via interactions with lipid II and lipid II-dependent pore formation in the bacterial membrane. Due to their general mode of action the Gram-positive producer strains need to express immunity proteins (LanI proteins) for protection against their own lantibiotics. Little is known about the immunity mechanism protecting the producer strain against its own lantibiotic on the molecular level. So far, no structures have been reported for any LanI protein. We solved the structure of SpaI, a LanI protein from the subtilin producing strain Bacillus subtilis ATCC 6633. SpaI is a 16.8-kDa lipoprotein that is attached to the outside of the cytoplasmic membrane via a covalent diacylglycerol anchor. SpaI together with the ABC transporter SpaFEG protects the B. subtilis membrane from subtilin insertion. The solution-NMR structure of a 15-kDa biologically active C-terminal fragment reveals a novel fold. We also demonstrate that the first 20 N-terminal amino acids not present in this C-terminal fragment are unstructured in solution and are required for interactions with lipid membranes. Additionally, growth tests reveal that these 20 N-terminal residues are important for the immunity mediated by SpaI but most likely are not part of a possible subtilin binding site. Our findings are the first step on the way of understanding the immunity mechanism of B. subtilis in particular and of other lantibiotic producing strains in general.
|
314. |
( 2013 ) Structure-based engineering of histidine residues in the catalytic domain of �\-amylase from Bacillus subtilis for improved protein stability and catalytic efficiency under acidic conditions. PMID : 23262127 : DOI : 10.1016/j.jbiotec.2012.12.007 Abstract >>
This work aims to improve the protein stability and catalytic efficiency of �\-amylase from Bacillus subtilis under acidic conditions by site-directed mutagenesis. Based on the analysis of a three dimensional structure model, four basic histidine (His) residues His(222), His(275), His(293), and His(310) in the catalytic domain were selected as the mutation sites and were further replaced with acidic aspartic acid (Asp), respectively, yielding four mutants H222D, H275D, H293D, H310D. The mutant H222D was inactive. Double and triple mutations were further conducted and four mutants H275/293D, H275/310D, H293/310D, and H275/293/310D were obtained. The acidic stability of enzyme was significantly enhanced after mutation, and 45-92% of initial activity of mutants was retained after incubation at pH 4.5 and 25�XC for 24h, while that for wild-type was only 39.5%. At pH 4.5, the specific activity of wild-type and mutants H275D, H293D, H310D, H275/293D, H275/310D, H293/310D, and H275/293/310D were 108.2, 131.8, 138.9, 196.6, 156.3, 204.6, and 216.2U/mg, respectively. The catalytic efficiency for each active mutant was much higher than that of wild-type at low pH. The kcat/Km values of the mutants H275D, H293D, H310D, H275/293D, H275/310D, H293/310D, and H275/293/310D at pH 4.5 were 3.3-, 4.3-, 6.5-, 4.5-, 11.0-, 14.5-, and 16.7-fold higher, respectively, than that of the wild-type. As revealed by the structure models of the wild-type and mutant enzymes, the hydrogen bonds and salt bridges were increased after mutation, and an obvious shift of the basic limb toward acidity was observed for mutants. These changes around the catalytic domain contributed to the significantly improved protein stability and catalytic efficiency at low pH. This work provides an effective strategy to improve the catalytic activity and stability of �\-amylase under acidic conditions, and the results obtained here may be useful for the improvement of acid-resistant ability of other enzymes.
|
315. |
( 2012 ) phoR sequences as a phylogenetic marker to differentiate the species in the Bacillus subtilis group. PMID : 23145827 : DOI : 10.1139/w2012-106 Abstract >>
Bacillus subtilis and its closely related species are indistinguishable from one another by morphological characteristics and 16S rDNA sequences. In this study, the partial phoR sequence was tested to determine the phylogenetic relationship of species in the B. subtilis group. Degenerate primers were developed according to the relatively conserved nucleotide sequences of phoR and the linked gene phoP in the B. subtilis group. The primers amplified a 1100 bp phoR fragment from strains representative of 6 species in the B. subtilis group. Based on the sequenced fragments, 26 type strains comprising these 6 species were clearly distinguished. At the intraspecies level, the phoR sequence similarities were 90%-100%, but at the interspecies level, the phoR sequence similarities were 32.8%-75%. Compared with the gyrB sequence, the phoR sequences showed a larger divergence especially at the interspecies levels. Therefore, the phoR sequence may be an efficient alternative marker for phylogenetic and taxonomic analysis of species in the B. subtilis group. Twenty-three Bacillus undomesticated isolates were tested for identification and phylogenetic analysis based on the phoR and gyrB sequences. The 23 isolates could be clearly delineated into 4 distinct groups, 10 as B. subtilis, 3 as B. mojavensis, 2 as B. atrophaeus, and 8 as B. amyloliquefaciens.
|
316. |
( 1998 ) The yvsA-yvqA (293 degrees-289 degrees) region of the Bacillus subtilis chromosome containing genes involved in metal ion uptake and a putative sigma factor. PMID : 9639930 : DOI : 10.1099/00221287-144-6-1593 Abstract >>
The region between yvsA (293 degrees) and yvqA (289 degrees) of the Bacillus subtilis chromosome has been sequenced within the framework of the B. subtilis 168 international sequencing programme. A primary analysis of the 42 ORFs identified in this 43 kb region is presented. The region included a high proportion of genes that did not show homology with genes in other bacteria. The identified ORFs showed homology to proteins involved in the transport of metal ions, two-component signal transducers, ATP-binding-cassette-type transporters and a sigma factor.
|
317. |
( 1998 ) A putative lichenysin A synthetase operon in Bacillus licheniformis: initial characterization. PMID : 9765590 : DOI : 10.1016/s0167-4781(98)00096-7 Abstract >>
Certain Bacillus licheniformis strains isolated from oil wells have been shown to produce a very effective biosurfactant, lichenysin A, which is structurally similar to another less active lipopeptide, surfactin. Surfactin, like many small peptides in prokaryotes and lower eukaryotes, is synthesized non-ribosomally by multi-enzyme peptide synthetase complex. Analysis of several peptide synthetases of bacterial and fungal origin has revealed a high degree of sequence conservation. Two 35-mer oligonucleotides derived from highly conserved motifs ('core I' and 'core II') of surfactin synthetase were used to identify the cloned putative operon of lichenysin A synthetase lchA from B. licheniformis BNP29, a strain not amenable to genetic manipulation in a BAC system (F-plasmid-based bacterial artificial chromosome) based on Escherichia coli and its single-copy plasmid F-factor. A 32.4 kb fragment containing lichenysin A biosynthesis locus was sequenced and analysed. The structural architecture of putative lichenysin A synthetase protein containing seven amino acid (aa) activation-thiolation, two epimerization and one thioesterase domains is discussed in terms of its similarity to surfactin and other peptide synthetases. The 100 aa peptide chain situated between the highly conserved signature sequences FDXX and NXYGPTE(IV)X within amino acid binding domains of peptide synthetases is proposed to be a minimal block dictating the substrate specificity of the enzymes. A new operon-type structure has been localized directly upstream from the lichenysin A synthetase genes which, on the basis of sequence determination, potentially encode a four-member ABC-type transport system involved in product secretion.
|
318. |
( 1998 ) Crystal structure of restriction endonuclease BglI bound to its interrupted DNA recognition sequence. PMID : 9736624 : DOI : 10.1093/emboj/17.18.5466 PMC : PMC1170872 Abstract >>
The crystal structure of the type II restriction endonuclease BglI bound to DNA containing its specific recognition sequence has been determined at 2.2 A resolution. This is the first structure of a restriction endonuclease that recognizes and cleaves an interrupted DNA sequence, producing 3' overhanging ends. BglI is a homodimer that binds its specific DNA sequence with the minor groove facing the protein. Parts of the enzyme reach into both the major and minor grooves to contact the edges of the bases within the recognition half-sites. The arrangement of active site residues is strikingly similar to other restriction endonucleases, but the co-ordination of two calcium ions at the active site gives new insight into the catalytic mechanism. Surprisingly, the core of a BglI subunit displays a striking similarity to subunits of EcoRV and PvuII, but the dimer structure is dramatically different. The BglI-DNA complex demonstrates, for the first time, that a conserved subunit fold can dimerize in more than one way, resulting in different DNA cleavage patterns.
|
319. |
( 1998 ) Molecular cloning of the transglutaminase gene from Bacillus subtilis and its expression in Escherichia coli. PMID : 9692191 : Abstract >>
We cloned and characterized a gene, tgl, encoding transglutaminase in Bacillus subtilis. The tgl gene contained a open reading frame 735-nucleotides long that encoded a 245-residue protein with the molecular weight of 28,300. The deduced amino acid sequence had little sequence similarity with sequences of other transglutaminases from a Streptoverticillium sp. or from mammals. The -10 and -35 regions of a putative promoter resembled the consensus sequence for the sigma K-dependent promoter. In addition, a sequence similar to the consensus sequence for the GerE binding site was found upstream from this region. These findings suggested that tgl was transcribed in the mother cells during a late stage of sporulation. Evidence for this suggestion was that transglutaminase activity was detected in sporulating cells during the same stage. Transglutaminase activity was detected in Escherichia coli cells transformed with a plasmid for expression of the tgl gene.
|
320. |
( 1998 ) An 8 kb nucleotide sequence at the 3' flanking region of the sspC gene (184 degrees) on the Bacillus subtilis 168 chromosome containing an intein and an intron. PMID : 9679200 : DOI : 10.1093/dnares/5.2.121 Abstract >>
As part of the Bacillus subtilis genome sequencing project, we determined the complete nucleotide sequence of an 8000-bp fragment downstream of the sspC gene (184 degrees) of the B. subtilis 168 chromosome. The sequence analysis shows that the sspC gene is located inside of the SP beta region, which differs from the current genetic map of B. subtilis 168. This region contains 12 putative ORFs (yojQ through yojZ and sspC). A homology search for the deduced products of the ORFs shows significant similarities to enzymes involved in deoxyribonucleotide metabolism: ribonucleotide reductase (Nrd) E, NrdF, thioredoxin and dUTPase. Interestingly, this DNA fragment includes two split genes, yojP containing conserved motifs of an intein and yojQ and yojS with an 808-bp intervening sequence for a putative intron structure. In addition, the yojR gene includes a putative new DNA replication terminator.
|
321. |
( 1998 ) Molecular cloning and nucleotide sequence of the superoxide dismutase gene and characterization of its product from Bacillus subtilis. PMID : 9658017 : PMC : PMC107342 Abstract >>
Bacillus subtilis was found to possess one detectable superoxide dismutase (Sod) in both vegetative cells and spores. The Sod activity in vegetative cells was maximal at stationary phase. Manganese was necessary to sustain Sod activity at stationary phase, but paraquat, a superoxide generator, did not induce the expression of Sod. The specific activity of purified Sod was approximately 2, 600 U/mg of protein, and the enzyme was a homodimer protein with a molecular mass of approximately 25,000 per monomer. The gene encoding Sod, designated sodA, was cloned by the combination of several PCR methods and the Southern hybridization method. DNA sequence analysis revealed the presence of one open reading frame consisting of 606 bp. Several putative promoter sites were located in the upstream region of sodA. The deduced amino acid sequence showed high homology with other bacterial manganese Sods. Conserved regions in bacterial manganese Sod could also be seen. The phenotype of double mutant Escherichia coli sodA sodB, which could not grow in minimal medium without supplemental amino acids, was complemented by the expression of B. subtilis sodA.
|
322. |
( 1998 ) A novel Bacillus natto plasmid pLS32 capable of replication in Bacillus subtilis. PMID : 9490016 : DOI : 10.1016/s0014-5793(98)00015-5 Abstract >>
Plasmid pLS32 is a relatively large (approximately 70 kbp), cryptic, low copy-number plasmid present in Bacillus natto. We isolated and analyzed the replication region of the plasmid in B. subtilis, and the following results were obtained: the replication region contained an open reading frame encoding a 287-amino acid protein (RepN), whose amino acid sequence was partially homologous with those of the Rep proteins encoded on plasmids pAD1 and pLJ1 isolated from Enterococcus faecalis and Lactobacillus helveticus, respectively; the replication origin (oriN) was located in the repN-coding region; the copy number of a pLS32 derivative, pBET131, was 2 to 3 per chromosome; replication of pBET131 required poll. These features show that pLS32 is a novel plasmid capable of replication in B. subtilis.
|
323. |
( 1997 ) Cloning and characterization of a relA/spoT homologue from Bacillus subtilis. PMID : 9383190 : DOI : 10.1046/j.1365-2958.1997.5511919.x Abstract >>
A PCR-amplified DNA fragment of the relA gene from genomic Bacillus subtilis DNA was used to isolate the entire relA/spoT homologue and two adjacent open reading frames (ORFs) from a lambda ZAP Express library. The relA gene, which encodes a protein of 734 amino acid residues (aa), is flanked by an ORF (170aa) that shares high similarity to adenine phosphoribosyltransferase genes (apt), and downstream by an ORF (131 aa) of unknown function. This genetic organization is similar to that in Streptomyces coelicolor A3(2) and Streptococcus equismilis H46A. relA shows significant similarity to the Escherichia coli relA and spoT genes, which are responsible for the synthesis and degradation of the highly phosphorylated guanosine nucleotides (p)ppGpp, triggering the stringent response. Deletion of the relA gene generated a (p)ppGpp0 phenotype that demonstrated its essential role in the response to amino acid deprivation and resulted in impaired/lowered induction of proteins involved in stress response as well as amino acid biosynthesis, as judged by two-dimensional gel electrophoresis. The same effects of impaired induction of some sigmaB-independent proteins could also be shown in a sigB/relA double mutant, supporting the role of relA in derepression/induction of catabolic and anabolic genes during stringent response.
|
324. |
( 1997 ) The Bacillus subtilis genome from gerBC (311 degrees) to licR (334 degrees). PMID : 9353933 : DOI : 10.1099/00221287-143-10-3313 Abstract >>
As part of the international project to sequence the Bacillus subtilis genome, the DNA region located between gerBC (311 degrees) and licR (334 degrees) was assigned to the institut Pasteur. In this paper, the cloning and sequencing of 176 kb of DNA and the analysis of the sequence of the entire 271 kb region (6.5% of the B. subtilis chromosome) is described; 273 putative coding sequences were identified. Although the complete genome sequences of seven other organisms (five bacteria, one archaeon and the yeast Saccharomyces cerevisiae) are available in public database, 65 genes from this region of the B. subtilis chromosome encode proteins without significant similarities to other known protein sequences. Among the 208 other genes, 115 have paralogues in the currently known B. subtilis DNA sequences and the products of 178 genes were found to display similarities to protein sequences from public databases for which a function is known. Classification of these genes shows a high proportion of them to be involved in the adaptation to various growth conditions (non-essential cell wall constituents, catabolic and bioenergetic pathways); a small number of the genes are essential or encode anabolic enzymes.
|
325. |
( 1997 ) A Bacillus subtilis chromosome segment at the 100 degrees to 102 degrees position encoding 11 membrane proteins. PMID : 9353932 : DOI : 10.1099/00221287-143-10-3309 Abstract >>
The 25.9 kbp region upstream of nprB at 100 degrees-102 degrees on the Bacillus subtilis chromosome was sequenced. This revealed a known gene, degA, which was previously mislocated on the genetic map. A total of 29 putative ORFs were identified including a cluster of three ORFs whose products show clear homology with sulphate adenylyl pathway enzymes and, in addition, 11 ORFs whose products have one or more membrane domains, as indicated by their hydropathy profiles.
|
326. |
( 1998 ) Rolling-circle plasmids from Bacillus subtilis: complete nucleotide sequences and analyses of genes of pTA1015, pTA1040, pTA1050 and pTA1060, and comparisons with related plasmids from gram-positive bacteria. PMID : 9532747 : DOI : 10.1111/j.1574-6976.1998.tb00357.x Abstract >>
Most small plasmids of Gram-positive bacteria use the rolling-circle mechanism of replication and several of these have been studied in considerable detail at the DNA level and for the function of their genes. Although most of the common laboratory Bacillus subtilis 168 strains do not contain plasmids, several industrial strains and natural soil isolates do contain rolling-circle replicating (RCR) plasmids. So far, knowledge about these plasmids was mainly limited to: (i) a classification into seven groups, based on size and restriction patterns; and (ii) DNA sequences of the replication region of a limited number of them. To increase the knowledge, also with respect to other functions specified by these plasmids, we have determined the complete DNA sequence of four plasmids, representing different groups, and performed computer-assisted and experimental analyses on the possible function of their genes. The plasmids analyzed are pTA1015 (5.8 kbp), pTA1040 (7.8 kbp), pTA1050 (8.4 kbp), and pTA1060 (8.7 kbp). These plasmids have a structural organization similar to most other known RCR plasmids. They contain highly related replication functions, both for leading and lagging strand synthesis. pTA1015 and pTA1060 contain a mobilization gene enabling their conjugative transfer. Strikingly, in addition to the conserved replication modules, these plasmids contain unique module(s) with genes which are not present on known RCR plasmids of other Gram-positive bacteria. Examples are genes encoding a type I signal peptidase and genes encoding proteins belonging to the family of response regulator aspartate phosphatases. The latter are likely to be involved in the regulation of post-exponential phase processes. The presence of these modules on plasmids may reflect an adaptation to the special conditions to which the host cells were exposed.
|
327. |
( 1998 ) Characterization of glucose-specific catabolite repression-resistant mutants of Bacillus subtilis: identification of a novel hexose:H+ symporter. PMID : 9457850 : PMC : PMC106914 Abstract >>
Insertional mutagenesis was conducted on Bacillus subtilis cells to screen for mutants resistant to catabolite repression. Three classes of mutants that were resistant to glucose-promoted but not mannitol-promoted catabolite repression were identified. Cloning and sequencing of the mutated genes revealed that the mutations occurred in the structural genes for (i) enzyme II of the phosphoenolpyruvate-glucose phosphotransferase (PtsG), (ii) antiterminator GlcT, which controls PtsG synthesis, and (iii) a previously uncharacterized carrier of the major facilitator superfamily, which we have designated GlcP. The last protein exhibits greatest sequence similarity to the fucose:H+ symporter of Escherichia coli and the glucose/galactose:H+ symporter of Brucella abortus. In a wild-type B. subtilis genetic background, the glcP::Tn10 mutation (i) partially but specifically relieved glucose- and sucrose-promoted catabolite repression, (ii) reduced the growth rate in minimal glucose medium, and (iii) reduced rates of [14C]glucose and [14C]methyl alpha-glucoside uptake. In a delta pts genetic background no phenotype was observed, suggesting that expression of the glcP gene required a functional phosphotransferase system. When overproduced in a delta pts mutant of E. coli, GlcP could be shown to specifically transport glucose, mannose, 2-deoxyglucose and methyl alpha-glucoside with low micromolar affinities. Accumulation of the nonmetabolizable glucose analogs was demonstrated, and inhibitor studies suggested a dependency on the proton motive force. We conclude that B. subtilis possesses at least two distinct routes of glucose entry, both of which contribute to the phenomenon of catabolite repression.
|
328. |
( 1998 ) Crystal structure of ErmC', an rRNA methyltransferase which mediates antibiotic resistance in bacteria. PMID : 9585521 : DOI : 10.1021/bi973113c Abstract >>
The prevalent mechanism of bacterial resistance to erythromycin and other antibiotics of the macrolide-lincosamide-streptogramin B group (MLS) is methylation of the 23S rRNA component of the 50S subunit in bacterial ribosomes. This sequence-specific methylation is catalyzed by the Erm group of methyltransferases (MTases). They are found in several strains of pathogenic bacteria, and ErmC is the most studied member of this class. The crystal structure of ErmC' (a naturally occurring variant of ErmC) from Bacillus subtilis has been determined at 3.0 A resolution by multiple anomalous diffraction phasing methods. The structure consists of a conserved alpha/beta amino-terminal domain which binds the cofactor S-adenosyl-l-methionine (SAM), followed by a smaller, alpha-helical RNA-recognition domain. The beta-sheet structure of the SAM-binding domain is well-conserved between the DNA, RNA, and small-molecule MTases. However, the C-terminal nucleic acid binding domain differs from the DNA-binding domains of other MTases and is unlike any previously reported RNA-recognition fold. A large, positively charged, concave surface is found at the interface of the N- and C-terminal domains and is proposed to form part of the protein-RNA interaction surface. ErmC' exhibits the conserved structural motifs previously found in the SAM-binding domain of other methyltransferases. A model of SAM bound to ErmC' is presented which is consistent with the motif conservation among MTases.
|
329. |
( 1998 ) A 35.7 kb DNA fragment from the Bacillus subtilis chromosome containing a putative 12.3 kb operon involved in hexuronate catabolism and a perfectly symmetrical hypothetical catabolite-responsive element. PMID : 9579062 : DOI : 10.1099/00221287-144-4-877 Abstract >>
The Bacillus subtilis strain 168 chromosomal region extending from 109 degrees to 112 degrees has been sequenced. Among the 35 ORFs identified, cotT and rapA were the only genes that had been previously mapped and sequenced. Out of ten ORFs belonging to a single putative transcription unit, seven are probably involved in hexuronate catabolism. Their sequences are homologous to Escherichia coli genes exuT, uidB, uxaA, uxaB, uxaC, uxuA and uxuB, which are all required for the uptake of free D-glucuronate, D-galacturonate and beta-glucuronide, and their transformation into glyceraldehyde 3-phosphate and pyruvate via 2-keto-3-deoxygluconate. The remaining three ORFs encode two dehydrogenases and a transcriptional regulator. The operon is preceded by a putative catabolite-responsive element (CRE), located between a hypothetical promoter and the RBS of the first gene. This element, the longest and the only so far described that is fully symmetrical, consists of a 26 bp palindrome matching the theoretical B. subtilis CRE sequence. The remaining predicted amino acid sequences that share homologies with other proteins comprise: a cytochrome P-450, a glycosyltransferase, an ATP-binding cassette transporter, a protein similar to the formate dehydrogenase alpha-subunit (FdhA), protein similar to NADH dehydrogenases, and three homologues of polypeptides that have undefined functions.
|
330. |
( 1998 ) Isolation, characterization, molecular gene cloning, and sequencing of a novel phytase from Bacillus subtilis. PMID : 9603817 : PMC : PMC106281 Abstract >>
The Bacillus subtilis strain VTT E-68013 was chosen for purification and characterization of its excreted phytase. Purified enzyme had maximal phytase activity at pH 7 and 55 degrees C. Isolated enzyme required calcium for its activity and/or stability and was readily inhibited by EDTA. The enzyme proved to be highly specific since, of the substrates tested, only phytate, ADP, and ATP were hydrolyzed (100, 75, and 50% of the relative activity, respectively). The phytase gene (phyC) was cloned from the B. subtilis VTT E-68013 genomic library. The deduced amino acid sequence (383 residues) showed no homology to the sequences of other phytases nor to those of any known phosphatases. PhyC did not have the conserved RHGXRXP sequence found in the active site of known phytases, and therefore PhyC appears not to be a member of the phytase subfamily of histidine acid phosphatases but a novel enzyme having phytase activity. Due to its pH profile and optimum, it could be an interesting candidate for feed applications.
|
331. |
( 1997 ) Sequence completion, identification and definition of the fengycin operon in Bacillus subtilis 168. PMID : 9387222 : DOI : 10.1099/00221287-143-11-3443 Abstract >>
A 15 kb DNA fragment from the Bacillus subtilis chromosome between citB and ppsC has been sequenced, and new ORFs encoding putative enzymes involved in lipopolypeptide synthesis, which complete a partial operon previously reported, and a new set of enzymes responsible for lipid metabolism have been identified. From the analysis of DNA sequence homology of the fragment it was deduced that these new peptide synthetase genes are part of an operon for the biosynthesis of the fungicide fengycin.
|
332. |
( 1997 ) Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnB-dnaB region. PMID : 9387221 : DOI : 10.1099/00221287-143-11-3431 Abstract >>
The 200 kb region of the Bacillus subtilis chromosome spanning from 255 to 275 degrees on the genetic map was sequenced. The strategy applied, based on use of yeast artificial chromosomes and multiplex Long Accurate PCR, proved to be very efficient for sequencing a large bacterial chromosome area. A total of 193 genes of this part of the chromosome was classified by level of knowledge and biological category of their functions. Five levels of gene function understanding are defined. These are: (i) experimental evidence is available of gene product or biological function; (ii) strong homology exists for the putative gene product with proteins from other organisms; (iii) some indication of the function can be derived from homologies with known proteins; (iv) the gene product can be clustered with hypothetical proteins; (v) no indication on the gene function exists. The percentage of detected genes in each category was: 20, 28, 20, 15 and 17, respectively. In the sequenced region, a high percentage of genes are implicated in transport and metabolic linking of glycolysis and the citric acid cycle. A functional connection of several genes from this region and the genes close to 140 degrees in the chromosome was also observed.
|
331, Shih-Pin Rd., Hsinchu 30062, Taiwan
Phone: +886-3-5223191
E-mail: bcrcweb@firdi.org.tw
web maintainance: +886-3-5223191 ext 593
Copyright © 2018.BCRC All rights reserved.The duplication or use of information and data such as texts or images or any linkage the website at the "bcrc.firdi.org.tw" is only permitted with the indication of the source or with prior approval by the BCRC(Bioresource Collection and Research Center).