| 1. |
Perez-Martinez G,
Kok J,
Venema G,
van Dijl JM,
Smith H,
Bron S,
( 1992 ) Protein export elements from Lactococcus lactis. PMID : 1406586 : DOI : 10.1007/bf00538699 Abstract >>
Broad-host-range plasmids carrying alpha-amylase or beta-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the export of the reporter proteins in Escherichia coli. Several of the selected export elements were also active in Bacillus subtilis and L. lactis, although the efficiencies depended strongly on the host organism and reporter gene used. The export elements AL9 and BL1 were highly efficient in L. lactis in the expression and secretion of at least two heterologous proteins (Bacillus licheniformis alpha-amylase and E. coli TEM-beta-lactamase). AL9 even permitted growth of this organism on starch as the sole carbon source. Nucleotide sequence analysis of five selected fragments indicated that these encode oligopeptides with the major characteristics of typical signal peptides. The putative expression signals had a limited similarity to previously described expression signals for E. coli, B. subtilis and L. lactis. Differences in both expression and export efficiency are likely to underlie the host-specific effects.
|
2. |
Godon JJ,
Chopin MC,
Ehrlich SD,
( 1992 ) Branched-chain amino acid biosynthesis genes in Lactococcus lactis subsp. lactis. PMID : 1400210 : DOI : 10.1128/jb.174.20.6580-6589.1992 PMC : PMC207629 Abstract >>
The genes for biosynthesis of the branched-chain amino acids leucine, isoleucine, and valine in Lactococcus lactis subsp. lactis NCDO2118 were characterized by cloning, complementation in Escherichia coli and Bacillus subtilis, and nucleotide sequence analysis. Nine structural genes are clustered on a 12-kb DNA fragment in the order leuABCD ilvDBNCA. Upstream of these genes, the nucleotide sequence suggests the existence of regulation by transcriptional attenuation. Between the leuD and ilvD genes is an unexpected gene, encoding a protein which belongs to the ATP-binding cassette protein superfamily.
|
3. |
Delorme C,
Ehrlich SD,
Renault P,
( 1992 ) Histidine biosynthesis genes in Lactococcus lactis subsp. lactis. PMID : 1400209 : DOI : 10.1128/jb.174.20.6571-6579.1992 PMC : PMC207627 Abstract >>
The genes of Lactococcus lactis subsp. lactis involved in histidine biosynthesis were cloned and characterized by complementation of Escherichia coli and Bacillus subtilis mutants and DNA sequencing. Complementation of E. coli hisA, hisB, hisC, hisD, hisF, hisG, and hisIE genes and the B. subtilis hisH gene (the E. coli hisC equivalent) allowed localization of the corresponding lactococcal genes. Nucleotide sequence analysis of the 11.5-kb lactococcal region revealed 14 open reading frames (ORFs), 12 of which might form an operon. The putative operon includes eight ORFs which encode proteins homologous to enzymes involved in histidine biosynthesis. The operon also contains (i) an ORF encoding a protein homologous to the histidyl-tRNA synthetases but lacking a motif implicated in synthetase activity, which suggests that it has a role different from tRNA aminoacylation, and (ii) an ORF encoding a protein that is homologous to the 3'-aminoglycoside phosphotransferases but does not confer antibiotic resistance. The remaining ORFs specify products which have no homology with proteins in the EMBL and GenBank data bases.
|
4. |
Sybesma W,
Starrenburg M,
Kleerebezem M,
Mierau I,
de Vos WM,
Hugenholtz J,
( 2003 ) Increased production of folate by metabolic engineering of Lactococcus lactis. PMID : 12788700 : DOI : 10.1128/aem.69.6.3069-3076.2003 PMC : PMC161528 Abstract >>
The dairy starter bacterium Lactococcus lactis is able to synthesize folate and accumulates large amounts of folate, predominantly in the polyglutamyl form. Only small amounts of the produced folate are released in the extracellular medium. Five genes involved in folate biosynthesis were identified in a folate gene cluster in L. lactis MG1363: folA, folB, folKE, folP, and folC. The gene folKE encodes the biprotein 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase and GTP cyclohydrolase I. The overexpression of folKE in L. lactis was found to increase the extracellular folate production almost 10-fold, while the total folate production increased almost 3-fold. The controlled combined overexpression of folKE and folC, encoding polyglutamyl folate synthetase, increased the retention of folate in the cell. The cloning and overexpression of folA, encoding dihydrofolate reductase, decreased the folate production twofold, suggesting a feedback inhibition of reduced folates on folate biosynthesis.
|
5. |
Huang DC,
Novel M,
Huang XF,
Novel G,
( 1992 ) Nonidentity between plasmid and chromosomal copies of ISS1-like sequences in Lactococcus lactis subsp. lactis CNRZ270 and their possible role in chromosomal integration of plasmid genes. PMID : 1339371 : DOI : 10.1016/0378-1119(92)90246-l Abstract >>
The nucleotide sequence of an insertion sequence (IS) observed during mating experiments using the lactose-protease plasmid, pUCL22, of Lactococcus (Lc.) lactis subsp. lactis CNRZ270, was found to be similar to that of ISS1 from Lc. lactis subsp. lactis ML3. The IS was named ISS1RS. The chromosome of this strain contains several copies of ISS1-like IS as assessed by hybridization. One of these copies was cloned and named ISS1CH. Its sequence differs from that of the plasmid-borne copy, and appears to be more closely related to ISS1N from Lc. lactis subsp. cremoris SK11. This suggests independent introduction of both ISS1 elements. Moreover, the observation of plasmid genes integrated in the CNRZ270 chromosome near ISS1CH suggests that their presence is the result of integration by a Campbell mechanism using both IS homologies. ISS1-like sequences were also found on plasmids of numerous Lc. lactis strains, as well as one out of seven Lactobacillus (Lb.) casei and one out of three Lb. plantarum strains examined.
|
6. |
Zendo T,
Fukao M,
Ueda K,
Higuchi T,
Nakayama J,
Sonomoto K,
( 2003 ) Identification of the lantibiotic nisin Q, a new natural nisin variant produced by Lactococcus lactis 61-14 isolated from a river in Japan. PMID : 12913315 : DOI : 10.1271/bbb.67.1616 Abstract >>
Lactococcus lactis 61-14 isolated from river water produced a bacteriocin active against a wide range of Gram-positive bacteria. N-terminal amino acid sequencing, mass spectral analysis of the purified bacteriocin, and genetic analysis using nisin-specific primers showed that the bacteriocin was a new natural nisin variant, termed nisin Q. Nisin Q and nisin A differ in four amino acids in the mature peptide and two in the leader sequence.
|
7. |
Thoden JB,
Kim J,
Raushel FM,
Holden HM,
( 2003 ) The catalytic mechanism of galactose mutarotase. PMID : 12717027 : DOI : 10.1110/ps.0243203 PMC : PMC2323875 Abstract >>
Galactose mutarotase catalyzes the first step in normal galactose metabolism by catalyzing the conversion of beta-D-galactose to alpha-D-galactose. The structure of the enzyme from Lactococcus lactis was recently solved in this laboratory and shown to be topologically similar to domain 5 of beta-galactosidase. From this initial X-ray analysis, four amino acid residues were demonstrated to be intimately involved in sugar binding to the protein: His 96, His 170, Asp 243, and Glu 304. Here we present a combined X-ray crystallographic and kinetic analysis designed to examine the role of these residues in the reaction mechanism of the enzyme. For this investigation, the following site-directed mutant proteins were prepared: H96N, H170N, D243N, D243A, E304Q, and E304A. All of the structures of these proteins, complexed with either glucose or galactose, were solved to a nominal resolution of 1.95 A or better, and their kinetic parameters were measured against D-galactose, D-glucose, L-arabinose, or D-xylose. From these studies, it can be concluded that Glu 304 and His 170 are critical for catalysis and that His 96 and Asp 243 are important for proper substrate positioning within the active site. Specifically, Glu 304 serves as the active site base to initiate the reaction by removing the proton from the C-1 hydroxyl group of the sugar substrate and His 170 functions as the active site acid to protonate the C-5 ring oxygen.
|
8. |
Huard C,
Miranda G,
Wessner F,
Bolotin A,
Hansen J,
Foster SJ,
Chapot-Chartier MP,
( 2003 ) Characterization of AcmB, an N-acetylglucosaminidase autolysin from Lactococcus lactis. PMID : 12634338 : DOI : 10.1099/mic.0.25875-0 Abstract >>
A gene encoding a putative peptidoglycan hydrolase, named acmB, which is a paralogue of the major autolysin acmA gene, was identified in the Lactococcus lactis genome sequence. The acmB gene is transcribed in L. lactis MG1363 and its expression is modulated during cellular growth. The encoded AcmB protein has a modular structure with three domains: an N-terminal domain, especially rich in Ser, Thr, Pro and Asn residues, resembling a cell-wall-associated domain; a central domain homologous to the Enterococcus hirae muramidase catalytic domain; and a C-terminal domain of unknown function. A recombinant AcmB derivative, devoid of its N-terminal domain, was expressed in Escherichia coli. It exhibited hydrolysing activity on the peptidoglycan of several Gram-positive bacteria, including L. lactis. Though showing sequence similarity with enterococcal muramidase, AcmB has N-acetylglucosaminidase specificity. The acmB gene was inactivated in order to evaluate the role of the enzyme. AcmB does not appear to be involved in cell separation but contributes to cellular autolysis.
|
9. |
Bongers RS,
Hoefnagel MH,
Starrenburg MJ,
Siemerink MA,
Arends JG,
Hugenholtz J,
Kleerebezem M,
( 2003 ) IS981-mediated adaptive evolution recovers lactate production by ldhB transcription activation in a lactate dehydrogenase-deficient strain of Lactococcus lactis. PMID : 12867459 : DOI : 10.1128/jb.185.15.4499-4507.2003 PMC : PMC165757 Abstract >>
Lactococcus lactis NZ9010 in which the las operon-encoded ldh gene was replaced with an erythromycin resistance gene cassette displayed a stable phenotype when grown under aerobic conditions, and its main end products of fermentation under these conditions were acetate and acetoin. However, under anaerobic conditions, the growth of these cells was strongly retarded while the main end products of fermentation were acetate and ethanol. Upon prolonged subculturing of this strain under anaerobic conditions, both the growth rate and the ability to produce lactate were recovered after a variable number of generations. This recovery was shown to be due to the transcriptional activation of a silent ldhB gene coding for an Ldh protein (LdhB) with kinetic parameters different from those of the native las operon-encoded Ldh protein. Nevertheless, cells producing LdhB produced mainly lactate as the end product of fermentation. The mechanism underlying the ldhB gene activation was primarily studied in a single-colony isolate of the recovered culture, designated L. lactis NZ9015. Integration of IS981 in the upstream region of ldhB was responsible for transcription activation of the ldhB gene by generating an IS981-derived -35 promoter region at the correct spacing with a natively present -10 region. Subsequently, analysis of 10 independently isolated lactate-producing derivatives of L. lactis NZ9010 confirmed that the ldhB gene is transcribed in all of them. Moreover, characterization of the upstream region of the ldhB gene in these derivatives indicated that site-specific and directional IS981 insertion represents the predominant mechanism of the observed recovery of the ability to produce lactate.
|
10. |
Steidler L,
Neirynck S,
Huyghebaert N,
Snoeck V,
Vermeire A,
Goddeeris B,
Cox E,
Remon JP,
Remaut E,
( 2003 ) Biological containment of genetically modified Lactococcus lactis for intestinal delivery of human interleukin 10. PMID : 12808464 : DOI : 10.1038/nbt840 Abstract >>
Genetically modified Lactococcus lactis secreting interleukin 10 provides a therapeutic approach for inflammatory bowel disease. However, the release of such genetically modified organisms through clinical use raises safety concerns. In an effort to address this problem, we replaced the thymidylate synthase gene thyA of L. lactis with a synthetic human IL10 gene. This thyA- hIL10+ L. lactis strain produced human IL-10 (hIL-10), and when deprived of thymidine or thymine, its viability dropped by several orders of magnitude, essentially preventing its accumulation in the environment. The biological containment system and the bacterium's capacity to secrete hIL-10 were validated in vivo in pigs. Our approach is a promising one for transgene containment because, in the unlikely event that the engineered L. lactis strain acquired an intact thyA gene from a donor such as L. lactis subsp. cremoris, the transgene would be eliminated from the genome.
|
11. |
Charbonnel P,
Lamarque M,
Piard JC,
Gilbert C,
Juillard V,
Atlan D,
( 2003 ) Diversity of oligopeptide transport specificity in Lactococcus lactis species. A tool to unravel the role of OppA in uptake specificity. PMID : 12590143 : DOI : 10.1074/jbc.M212454200 Abstract >>
The specific oligopeptide transport system Opp is essential for growth of Lactococcus lactis in milk. We examined the biodiversity of oligopeptide transport specificity in the L. lactis species. Six strains were tested for (i) consumption of peptides during growth in a chemically defined medium and (ii) their ability to transport these peptides. Each strain demonstrated some specific preferences for peptide utilization, which matched the specificity of peptide transport. Sequencing of the binding protein OppA in some strains revealed minor differences at the amino acid level. The differences in specificity were used as a tool to unravel the role of the binding protein in transport specificity. The genes encoding OppA in four strains were cloned and expressed in L. lactis MG1363 deleted for its oppA gene. The substrate specificity of these engineered strains was found to be similar to that of the L. lactis MG1363 parental strain, whichever oppA gene was expressed. In situ binding experiments demonstrated the ability of OppA to interact with non-transported peptides. Taken together, these results provide evidence for a new concept. Despite that fact that OppA is essential for peptide transport, it is not the (main) determinant of peptide transport specificity in L. lactis.
|
12. |
Obis D,
Bouvier J,
Guillot A,
Fourçans A,
Bouvier I,
Gutierrez C,
Mistou MY,
Romeo Y,
( 2003 ) Osmoregulation in Lactococcus lactis: BusR, a transcriptional repressor of the glycine betaine uptake system BusA. PMID : 12581365 : DOI : 10.1046/j.1365-2958.2003.03362.x Abstract >>
The busA (opuA) locus of Lactococcus lactis encodes a glycine betaine uptake system. Transcription of busA is osmotically inducible and its induction after an osmotic stress is reduced in the presence of glycine betaine. Using a genetic screen in CLG802, an Escherichia coli strain carrying a lacZ transcriptional fusion expressed under the control of the busA promoter, we isolated a genomic fragment from the L. lactis subsp. cremoris strain MG1363, which represses transcription from busAp. The cloned locus responsible for this repression was identified as a gene present upstream from the busA operon, encoding a putative DNA binding protein. This gene was named busR. Electrophoretic mobility shift and footprinting experiments showed that BusR is able to bind a site that overlaps the busA promoter. Overexpression of busR in L. lactis reduced expression of busA. Its disruption led to increased and essentially constitutive transcription of busA at low osmolarity. Therefore, BusR is a major actor of the osmotic regulation of busA in L. lactis.
|
13. |
Grossiord BP,
Luesink EJ,
Vaughan EE,
Arnaud A,
de Vos WM,
( 2003 ) Characterization, expression, and mutation of the Lactococcus lactis galPMKTE genes, involved in galactose utilization via the Leloir pathway. PMID : 12533462 : DOI : 10.1128/jb.185.3.870-878.2003 PMC : PMC142802 Abstract >>
A cluster containing five similarly oriented genes involved in the metabolism of galactose via the Leloir pathway in Lactococcus lactis subsp. cremoris MG1363 was cloned and characterized. The order of the genes is galPMKTE, and these genes encode a galactose permease (GalP), an aldose 1-epimerase (GalM), a galactokinase (GalK), a hexose-1-phosphate uridylyltransferase (GalT), and a UDP-glucose 4-epimerase (GalE), respectively. This genetic organization reflects the order of the metabolic conversions during galactose utilization via the Leloir pathway. The functionality of the galP, galK, galT, and galE genes was shown by complementation studies performed with both Escherichia coli and L. lactis mutants. The GalP permease is a new member of the galactoside-pentose-hexuronide family of transporters. The capacity of GalP to transport galactose was demonstrated by using galP disruption mutant strains of L. lactis MG1363. A galK deletion was constructed by replacement recombination, and the mutant strain was not able to ferment galactose. Disruption of the galE gene resulted in a deficiency in cell separation along with the appearance of a long-chain phenotype when cells were grown on glucose as the sole carbon source. Recovery of the wild-type phenotype for the galE mutant was obtained either by genetic complementation or by addition of galactose to the growth medium.
|
14. |
Thoden JB,
Kim J,
Raushel FM,
Holden HM,
( 2002 ) Structural and kinetic studies of sugar binding to galactose mutarotase from Lactococcus lactis. PMID : 12218067 : DOI : 10.1074/jbc.M208395200 Abstract >>
Galactose mutarotase catalyzes the conversion of beta-D-galactose to alpha-D-galactose in the Leloir pathway for galactose metabolism. The high resolution x-ray structure of the dimeric enzyme from Lactococcus lactis was recently solved and shown to be topologically similar to the 18-stranded, anti-parallel beta-motif observed for domain 5 of beta-galactosidase. In addition to determining the overall molecular fold of galactose mutarotase, this initial investigation also provided a detailed description of the electrostatic interactions between the enzyme and its physiologically relevant substrate, galactose. Specifically, the side chains of His-96 and His-170 were shown to be located within hydrogen bonding distance to the C-5 oxygen of the substrate, while the carboxylate of Glu-304 was positioned near the C-1 hydroxyl group of the sugar. On the basis of this initial study, a possible role for Glu-304 as the general acid/base group in catalysis was put forth. Here we describe the combined x-ray crystallographic and kinetic analyses of L. lactis galactose mutarotase complexed with D-glucose, D-fucose, D-quinovose, L-arabinose, or D-xylose. These investigations have revealed that there are several distinct binding modes for these sugars, which are dependent upon the spatial orientation of the C-4 hydroxyl group. In those sugars with the same C-4 hydroxyl group orientation as galactose, their C-1 hydroxyl groups are invariably located near Glu-304. For those sugars, which have the same C-4 hydroxyl group configuration as glucose, the C-1 hydroxyls are typically located near Asp-243. These different binding modes correlate with both the observed kinetic parameters and the presence or absence of a hydrogen bond between the guanidinium group of Arg-71 and the C-4 hydroxyl group of the sugar ligand.
|
15. |
Bouchard JD,
Dion E,
Bissonnette F,
Moineau S,
( 2002 ) Characterization of the two-component abortive phage infection mechanism AbiT from Lactococcus lactis. PMID : 12399502 : DOI : 10.1128/jb.184.22.6325-6332.2002 PMC : PMC151939 Abstract >>
During the production of fermented dairy products, virulent bacteriophages infecting Lactococcus lactis can delay or stop the milk acidification process. A solution to this biological problem consists of introducing natural phage barriers into the strains used by the dairy industry. One such hurdle is called abortive infection (Abi) and causes premature cell death with no or little phage progeny. Here, we describe the isolation and characterization of a novel Abi mechanism encoded by plasmid pED1 from L. lactis. The system is composed of two constitutively cotranscribed genes encoding putative proteins of 127 and 213 amino acids, named AbiTi and AbiTii, respectively. Site-directed mutagenesis indicated that a hydrophobic region at the C-terminal extremity of AbiTi is essential to the antiphage phenotype. The AbiT system is effective against phages of the 936 and P335 species (efficiency of plaquing between 10(-5) and 10(-7)) and causes a 20-fold reduction in the efficiency to form centers of infection as well as a 10- to 12-fold reduction in the burst size. Its efficacy could be improved by raising the plasmid copy number, but changing the intrinsic ratio of AbiTi and AbiTii did not greatly affect the antiphage activity. The monitoring of the intracellular phage infection process by DNA replication, gene expression, and electron microscopy as well as the study of phage mutants by genome mapping indicated that AbiT is likely to act at a later stage of the phage lytic cycle.
|
16. |
Schwarz FV,
Perreten V,
Teuber M,
( 2001 ) Sequence of the 50-kb conjugative multiresistance plasmid pRE25 from Enterococcus faecalis RE25. PMID : 11735367 : DOI : 10.1006/plas.2001.1544 Abstract >>
The complete 50,237-bp DNA sequence of the conjugative and mobilizing multiresistance plasmid pRE25 from Enterococcus faecalis RE25 was determined. The plasmid had 58 putative open reading frames, 5 of which encode resistance to 12 antimicrobials. Chloramphenicol acetyltransferase and the 23S RNA methylase are identical to gene products of the broad-host-range plasmid pIP501 from Streptococcus agalactiae. In addition, a 30.5-kb segment is almost identical to pIP501. Genes encoding an aminoglycoside 6-adenylyltransferase, a streptothricin acetyltransferase, and an aminoglycoside phosphotransferase are arranged in tandem on a 7.4-kb fragment as previously reported in Tn5405 from Staphylococcus aureus and in pJH1 from E. faecalis. One interrupted and five complete IS elements as well as three replication genes were also identified. pRE25 was transferred by conjugation to E. faecalis, Listeria innocua, and Lactococcus lactis by means of a transfer region that appears similar to that of pIP501. It is concluded that pRE25 may contribute to the further spread of antibiotic-resistant microorganisms via food into the human community.
|
17. |
Nomura M,
Kobayashi M,
Okamoto T,
( 2002 ) Rapid PCR-based method which can determine both phenotype and genotype of Lactococcus lactis subspecies. PMID : 11976090 : DOI : 10.1128/aem.68.5.2209-2213.2002 PMC : PMC127530 Abstract >>
A highly efficient, rapid, and reliable PCR-based method for distinguishing Lactococcus lactis subspecies (L. lactis subsp. lactis and L. lactis subsp. cremoris) is described. Primers complementary to positions in the glutamate decarboxylase gene have been constructed. PCR analysis with extracted DNA or with cells of different L. lactis strains resulted in specific fragments. The length polymorphism of the PCR fragments allowed a clear distinction of the L. lactis subspecies. The amplified fragment length polymorphism with the primers and the restriction fragment length polymorphism of the amplified products agreed perfectly with the identification based on genotypic and phenotypic analyses, respectively. Isolates from cheese starters were investigated by this method, and amplified fragments of genetic variants were found to be approximately 40 bp shorter than the typical L. lactis subsp. cremoris fragments.
|
18. |
Thoden JB,
Holden HM,
( 2002 ) High resolution X-ray structure of galactose mutarotase from Lactococcus lactis. PMID : 11907040 : DOI : 10.1074/jbc.M201415200 Abstract >>
Galactose mutarotase plays a key role in normal galactose metabolism by catalyzing the interconversion of beta-D-galactose and alpha-D-galactose. Here we describe the three-dimensional architecture of galactose mutarotase from Lactococcus lactis determined to 1.9-A resolution. Each subunit of the dimeric enzyme displays a distinctive beta-sandwich motif. This tertiary structural element was first identified in beta-galactosidase and subsequently observed in copper amine oxidase, hyaluronate lyase, chondroitinase, and maltose phosphorylase. Two cis-peptides are found in each subunit, namely Pro(67) and Lys(136). The active site is positioned in a rather open cleft, and the electron density corresponding to the bound galactose unequivocally demonstrates that both anomers of the substrate are present in the crystalline enzyme. Those residues responsible for anchoring the sugar to the protein include Arg(71), His(96), His(170), Asp(243), and Glu(304). Both His(96) and His(170) are strictly conserved among mutarotase amino acid sequences determined thus far. The imidazole nitrogens of these residues are located within hydrogen bonding distance to the C-5 oxygen of galactose. Strikingly, the carboxylate group of Glu(304) is situated at approximately 2.7 A from the 1'-hydroxyl group of galactose, thereby suggesting its possible role as a general acid/base group.
|
19. |
Skinner MM,
Trempy JE,
( 2001 ) Expression of clpX, an ATPase subunit of the Clp protease, is heat and cold shock inducible in Lactococcus lactis. PMID : 11518300 : DOI : 10.3168/jds.S0022-0302(01)74615-2 Abstract >>
In this study, the clpX gene and surrounding sequences were cloned and sequenced from Lactococcus lactis. The putative clpX gene encodes a 411 amino acid polypeptide with a predicted molecular weight of 45.8 kDa. Analysis of the relative levels of clpX transcript revealed that in addition to a role in proteolysis of heat damaged proteins, ClpX may also be involved in cryoprotection.
|
20. |
Jones CH,
Bolken TC,
Jones KF,
Zeller GO,
Hruby DE,
( 2001 ) Conserved DegP protease in gram-positive bacteria is essential for thermal and oxidative tolerance and full virulence in Streptococcus pyogenes. PMID : 11500427 : DOI : 10.1128/iai.69.9.5538-5545.2001 PMC : PMC98667 Abstract >>
The DegP protease, a multifunctional chaperone and protease, has been shown to be essential for virulence in gram-negative pathogens such as Salmonella enterica serovar Typhimurium, Brucella abortus, Yersinia enterocolitica, and Pseudomonas aeruginosa. The function of DegP in pathogenesis appears to be the degradation of damaged proteins that accumulate as a result of the initial host response to infection, which includes the release of reactive oxygen intermediates. Additionally, the DegP protease plays a major role in monitoring and maintaining the Escherichia coli periplasm and influences E. coli pilus biogenesis. We report here the identification of highly homologous enzymes in Streptococcus pyogenes, Streptococcus gordonii, Streptococcus mutans, Staphylococcus aureus, and Enterococcus faecalis. Moreover, the phenotype of an insertionally inactivated degP allele in S. pyogenes is similar to that reported for E. coli, with temperature sensitivity for growth and enhanced sensitivity to reactive oxygen intermediates. Virulence studies in a mouse model of streptococcal infection indicate that a functional DegP protease is required for full virulence. These results suggest DegP as an attractive broad-spectrum target for future anti-infective drug development.
|
21. |
Boucher I,
Emond E,
Parrot M,
Moineau S,
( 2001 ) DNA sequence analysis of three Lactococcus lactis plasmids encoding phage resistance mechanisms. PMID : 11467810 : DOI : 10.3168/jds.S0022-0302(01)74595-X Abstract >>
The three Lactococcus lactis plasmids pSRQ700, pSRQ800, and pSRQ900 encode the previously described anti-phage resistance mechanisms LlaDCHI, AbiK, and AbiQ, respectively. Since these plasmids are likely to be introduced into industrial Lactococcus lactis strains used to manufacture commercial fermented dairy products, their complete DNA sequences were determined and analyzed. The plasmids pSRQ700 (7784 bp), pSRQ800 (7858 bp), and pSRQ900 (10,836 bp) showed a similar genetic organization including a common lactococcal theta-type replicon. A second replication module showing features of the pMV158 family of rolling circle replicons was also found on pSRQ700. The theta replication regions of the three plasmids were associated with two additional coding regions, one of which encodes for HsdS, the specificity subunit of the type I restriction/modification system. When introduced into L. lactis IL1403, the HsdS of pSRQ800 and pSRQ900 conferred a weak resistance against phage P008 (936 species). These results indicated that both HsdS subunits can complement the chromosomally encoded type I restriction/modification system in IL1403. The genes involved in the phage resistance systems LlaDCHI, AbiK, and AbiQ were found in close proximity to and downstream of the replication modules. In pSRQ800 and pSRQ900, transfer origins and putative tyrosine recombinases were found upstream of the theta replicons. Genes encoding recombination proteins were also found on pSRQ700. Finally, open reading frames associated with bacteriocin production were found on pSRQ900, but no anti-lactococcal activity was detected. Based on our current knowledge, these three plasmids are safe and suitable for food-grade applications.
|
22. |
Madsen A,
Josephsen J,
( 2001 ) The LlaGI restriction and modification system of Lactococcus lactis W10 consists of only one single polypeptide. PMID : 11410355 : DOI : 10.1111/j.1574-6968.2001.tb10698.x Abstract >>
The naturally occurring 12.1-kb plasmid, pEW104, in Lactococcus lactis ssp. cremoris W10 was found to confer decreased bacteriophage sensitivity to its host. Plasmid pEW104 encodes a non-classic restriction and modification (R/M) system, named LlaGI, consisting of only one single polypeptide. Analysis of the amino acid sequence revealed the presence of a catalytic motif and seven helicase-like motifs (DEAD-box motifs) characteristic of type I and III endonucleases, followed by four conserved methylase motifs characteristic of adenine-methylases. A comparison between LlaGI and the very similar R/M system, LlaBIII, suggests that the C-terminal region of LlaGI, apparently containing no known motifs, could possibly specify target DNA recognition. Conceivably, the LlaGI gene is included in the operon of the plasmid replication machinery. Finally, it is proposed that LlaGI represents a variant of the type I R/M systems.
|
23. |
Perreten V,
Schwarz FV,
Teuber M,
Levy SB,
( 2001 ) Mdt(A), a new efflux protein conferring multiple antibiotic resistance in Lactococcus lactis and Escherichia coli. PMID : 11257023 : DOI : 10.1128/AAC.45.4.1109-1114.2001 PMC : PMC90432 Abstract >>
The mdt(A) gene, previously designated mef214, from Lactococcus lactis subsp. lactis plasmid pK214 encodes a protein [Mdt(A) (multiple drug transporter)] with 12 putative transmembrane segments (TMS) that contain typical motifs conserved among the efflux proteins of the major facilitator superfamily. However, it also has two C-motifs (conserved in the fifth TMS of the antiporters) and a putative ATP-binding site. Expression of the cloned mdt(A) gene decreased susceptibility to macrolides, lincosamides, streptogramins, and tetracyclines in L. lactis and Escherichia coli, but not in Enterococcus faecalis or in Staphylococcus aureus. Glucose-dependent efflux of erythromycin and tetracycline was demonstrated in L. lactis and in E. coli.
|
24. |
Martinussen J,
Schallert J,
Andersen B,
Hammer K,
( 2001 ) The pyrimidine operon pyrRPB-carA from Lactococcus lactis. PMID : 11292797 : DOI : 10.1128/JB.183.9.2785-2794.2001 PMC : PMC99494 Abstract >>
The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp. lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible for the regulation of the expression of the pyrimidine biosynthetic genes leading to UMP formation. The second gene encodes a membrane-bound high-affinity uracil permease, required for utilization of exogenous uracil. The last two genes in the operon, pyrB and carA, encode pyrimidine biosynthetic enzymes; aspartate transcarbamoylase (pyrB) is the second enzyme in the pathway, whereas carbamoyl-phosphate synthetase subunit A (carA) is the small subunit of a heterodimeric enzyme, catalyzing the formation of carbamoyl phosphate. The carA gene product is shown to be required for both pyrimidine and arginine biosynthesis. The expression of the pyrimidine biosynthetic genes including the pyrRPB-carA operon is subject to control at the transcriptional level, most probably by an attenuator mechanism in which PyrR acts as the regulatory protein.
|
25. |
Kraus J,
Geller BL,
( 2001 ) Cloning of genomic DNA of Lactococcus lactis that restores phage sensitivity to an unusual bacteriophage sk1-resistant mutant. PMID : 11157245 : DOI : 10.1128/AEM.67.2.791-798.2001 PMC : PMC92649 Abstract >>
An unusual, spontaneous, phage sk1-resistant mutant (RMSK1/1) of Lactococcus lactis C2 apparently blocks phage DNA entry into the host. Although no visible plaques formed on RMSK1/1, this host propagated phage at a reduced efficiency. This was evident from center-of-infection experiments, which showed that 21% of infected RMSK1/1 formed plaques when plated on its phage-sensitive parental strain, C2. Moreover, viable cell counts 0 and 4 h after infection were not significantly different from those of an uninfected culture. Further characterization showed that phage adsorption was normal, but burst size was reduced fivefold and the latent period was increased from 28.5 to 36 min. RMSK1/1 was resistant to other, but not all, similar phages. Phage sensitivity was restored to RMSK1/1 by transformation with a cloned DNA fragment from a genomic library of a phage-sensitive strain. Characterization of the DNA that restored phage sensitivity revealed an open reading frame with similarity to sequences encoding lysozymes (beta-1,4-N-acetylmuramidase) and lysins from various bacteria, a fungus, and phages of Lactobacillus and Streptococcus and also revealed DNA homologous to noncoding sequences of temperate phage of L. lactis, DNA similar to a region of phage sk1, a gene with similarity to tRNA genes, a prophage attachment site, and open reading frames with similarities to sun and to sequences encoding phosphoprotein phosphatases and protein kinases. Mutational analyses of the cloned DNA showed that the region of homology with lactococcal temperate phage was responsible for restoring the phage-sensitive phenotype. The region of homology with DNA of lactococcal temperate phage was similar to DNA from a previously characterized lactococcal phage that suppresses an abortive infection mechanism of phage resistance. The region of homology with lactococcal temperate phage was deleted from a phage-sensitive strain, but the strain was not phage resistant. The results suggest that the cloned DNA with homology to lactococcal temperate phage was not mutated in the phage-resistant strain. The cloned DNA apparently suppressed the mechanism of resistance, and it may do so by mimicking a region of phage DNA that interacts with components of the resistance mechanism.
|
26. |
Ke D,
Boissinot M,
Huletsky A,
Picard FJ,
Frenette J,
Ouellette M,
Roy PH,
Bergeron MG,
( 2000 ) Evidence for horizontal gene transfer in evolution of elongation factor Tu in enterococci. PMID : 11092850 : DOI : 10.1128/jb.182.24.6913-6920.2000 PMC : PMC94815 Abstract >>
The elongation factor Tu, encoded by tuf genes, is a GTP binding protein that plays a central role in protein synthesis. One to three tuf genes per genome are present, depending on the bacterial species. Most low-G+C-content gram-positive bacteria carry only one tuf gene. We have designed degenerate PCR primers derived from consensus sequences of the tuf gene to amplify partial tuf sequences from 17 enterococcal species and other phylogenetically related species. The amplified DNA fragments were sequenced either by direct sequencing or by sequencing cloned inserts containing putative amplicons. Two different tuf genes (tufA and tufB) were found in 11 enterococcal species, including Enterococcus avium, Enterococcus casseliflavus, Enterococcus dispar, Enterococcus durans, Enterococcus faecium, Enterococcus gallinarum, Enterococcus hirae, Enterococcus malodoratus, Enterococcus mundtii, Enterococcus pseudoavium, and Enterococcus raffinosus. For the other six enterococcal species (Enterococcus cecorum, Enterococcus columbae, Enterococcus faecalis, Enterococcus sulfureus, Enterococcus saccharolyticus, and Enterococcus solitarius), only the tufA gene was present. Based on 16S rRNA gene sequence analysis, the 11 species having two tuf genes all have a common ancestor, while the six species having only one copy diverged from the enterococcal lineage before that common ancestor. The presence of one or two copies of the tuf gene in enterococci was confirmed by Southern hybridization. Phylogenetic analysis of tuf sequences demonstrated that the enterococcal tufA gene branches with the Bacillus, Listeria, and Staphylococcus genera, while the enterococcal tufB gene clusters with the genera Streptococcus and Lactococcus. Primary structure analysis showed that four amino acid residues encoded within the sequenced regions are conserved and unique to the enterococcal tufB genes and the tuf genes of streptococci and Lactococcus lactis. The data suggest that an ancestral streptococcus or a streptococcus-related species may have horizontally transferred a tuf gene to the common ancestor of the 11 enterococcal species which now carry two tuf genes.
|
27. |
Romeo Y,
Fourçans A,
Bordes P,
Bouvier J,
( 2000 ) Characterization of OpuA, a glycine-betaine uptake system of Lactococcus lactis. PMID : 10939245 : Abstract >>
A Lactococcus lactis glycine-betaine transport system was identified by functional complementation of an Escherichia coli proP proU mutant with a gene library from L. lactis sbsp. cremoris. The cloned locus forms an operon highly homologous to opuA, encoding a glycine-betaine uptake system of Bacillus subtilis. Disruption of opuA in L. lactis abolished protection by glycine-betaine against elevated osmolarity. OpuA belongs to the so-called "ABC transporters" family, which comprise an extracellularly localized substrate-binding protein. In B. subtilis OpuA system, this binding protein is a lipoprotein, attached to the external face of the cytoplasmic membrane by its lipidic moiety. In contrast, in the L. lactis opuA operon, and in other gram-positive homologues as well, a fusion between the gene encoding the integral membrane protein and the substrate-binding protein components gave rise to a hybrid protein presumably attaching the substrate-binding protein to the surface of the cell via its covalent link to the integral membrane component. Mapping of L. lactis opuA transcription start identified one mRNA, more abundant in cells grown at elevated osmolarity. Construction of an opuA-gusA fusion confirmed that opuA transcription is directed by a promoter osmotically inducible in L. lactis. When recombined upstream from a lac transcriptional fusion in the chromosome of E. coli, the opuA promoter appeared as very strong, and only poorly stimulated by elevated osmotic pressure, suggesting the existence of a specific machinery involved in the osmotic signal transduction in L. lactis.
|
28. |
Goh SH,
Facklam RR,
Chang M,
Hill JE,
Tyrrell GJ,
Burns EC,
Chan D,
He C,
Rahim T,
Shaw C,
Hemmingsen SM,
( 2000 ) Identification of Enterococcus species and phenotypically similar Lactococcus and Vagococcus species by reverse checkerboard hybridization to chaperonin 60 gene sequences. PMID : 11060051 : PMC : PMC87524 Abstract >>
Data from four recent studies (S. H. Goh et al., J. Clin. Microbiol. 36:2164-2166, 1998; S. H. Goh et al., J. Clin. Microbiol. 34:818-823, 1996; S. H. Goh et al., J. Clin. Microbiol. 35:3116-3121, 1997; A. Y. C. Kwok et al., Int. J. Syst. Bacteriol. 49:1181-1192, 1999) suggest that an approximately 600-bp region of the chaperonin 60 (Cpn60) gene, amplified by PCR with a single pair of degenerate primers, has utility as a potentially universal target for bacterial identification (ID). This Cpn60 gene ID method correctly identified isolates representative of numerous staphylococcal species and Streptococcus iniae, a human and animal pathogen. We report herein that this method enabled us to distinguish clearly between 17 Enterococcus species (Enterococcus asini, Enterococcus rattus, Enterococcus dispar, Enterococcus gallinarum, Enterococcus hirae, Enterococcus durans, Enterococcus cecorum, Enterococcus faecalis, Enterococcus mundtii, Enterococcus casseliflavus, Enterococcus faecium, Enterococcus malodoratus, Enterococcus raffinosus, Enterococcus avium, Enterococcus pseudoavium, Enterococcus new sp. strain Facklam, and Enterococcus saccharolyticus), and Vagococcus fluvialis, Lactococcus lactis, and Lactococcus garvieae. From 123 blind-tested samples, only two discrepancies were observed between the Facklam and Collins phenotyping method (R. R. Facklam and M. D. Collins, J. Clin. Microbiol. 27:731-734, 1989) and the Cpn60 ID method. In each case, the discrepancies were resolved in favor of the Cpn60 ID method. The species distributions of the 123 blind-tested isolates were Enterococcus new sp. strain Facklam (ATCC 700913), 3; E. asini, 1; E. rattus, 4; E. dispar, 2; E. gallinarum, 20; E. hirae, 9; E. durans, 9; E. faecalis, 12; E. mundtii, 3; E. casseliflavus, 8; E. faecium, 25; E. malodoratus, 3; E. raffinosus, 8; E. avium, 4; E. pseudoavium, 1; an unknown Enterococcus clinical isolate, sp. strain R871; Vagococcus fluvialis, 4; Lactococcus garvieae, 3; Lactococcus lactis, 3; Leuconostoc sp., 1; and Pediococcus sp., 1. The Cpn60 gene ID method, coupled with reverse checkerboard hybridization, is an effective method for the identification of Enterococcus and related organisms.
|
29. |
van der Heide T,
( 2000 ) Osmoregulated ABC-transport system of Lactococcus lactis senses water stress via changes in the physical state of the membrane. PMID : 10860977 : DOI : 10.1073/pnas.97.13.7102 PMC : PMC16506 Abstract >>
An osmoregulated ABC transporter (OpuA) with novel structural features has been identified that responds to water stress. This glycine betaine transport system consists of an ATP-binding/hydrolyzing subunit (OpuAA) and a protein (OpuABC) that contains both the translocator and the substrate-binding domain. The components of OpuA have been overexpressed, purified, and functionally incorporated into liposomes with an ATP-regenerating system in the vesicle lumen. A transmembrane osmotic gradient (outside hyperosmotic relative to the inside) of both ionic and nonionic compounds was able to osmotically activate OpuA in the proteoliposomal system. Hypoosmotic medium conditions inhibited the basal activity of the system. The data show that OpuAA and OpuABC are sufficient for osmoregulated transport, indicating that OpuA can act both as osmosensor and osmoregulator. Strikingly, OpuA could also be activated by low concentrations of cationic and anionic amphipaths, which interact with the membrane. This result indicates that activation by a transmembrane osmotic gradient is mediated by changes in membrane properties/protein-lipid interactions.
|
30. |
Dudley EG,
Atiles MW,
( 2000 ) Gene cloning, sequencing, and inactivation of the branched-chain aminotransferase of Lactococcus lactis LM0230. PMID : 10831406 : DOI : 10.1128/aem.66.6.2325-2329.2000 PMC : PMC110523 Abstract >>
A branched-chain aminotransferase gene (ilvE) from Lactococcus lactis LM0230 was identified on a 9-kb chromosomal insert by complementation in Escherichia coli DL39. Sequencing of a 2.0-kbp fragment resulted in the identification of a 1,023-bp open reading frame that could encode a 340-amino-acid protein. Sequence analysis of the deduced amino acid sequence revealed 62% identity to IlvE of Haemophilus influenzae and high similarity to IlvEs from a variety of organisms found in GenBank classified as class IV aminotransferases. Under logarithmic growth in complex medium, ilvE is transcribed monocistronically as a 1.1-kb transcript. Hydrophobicity plot analysis of the deduced amino acid sequence and the lack of a signal peptide sequence suggest IlvE is a cytosolic protein. A derivative of LM0230 lacking IlvE activity was constructed by gene replacement. Comparison of the IlvE-deficient strain's ability to grow in defined media lacking an amino acid but containing its alpha-keto acid biosynthetic precursor to that of the wild-type strain indicated that IlvE is the only enzyme capable of synthesis of Ile and Val from their biosynthetic precursors. Comparison of the aminotransferase activity of the IlvE mutant to LM0230 revealed that the mutant retained <2, 4.5, 43, 40, and 76% of its aminotransferase activity with Ile, Val, Leu, Met, and Phe, respectively. No difference in growth or acidification rate between LM0230 and the IlvE-deficient strain was observed in milk.
|
31. |
Twomey DP,
Coffey A,
O'Sullivan D,
( 2000 ) Novel type I restriction specificities through domain shuffling of HsdS subunits in Lactococcus lactis. PMID : 10844674 : DOI : 10.1046/j.1365-2958.2000.01901.x Abstract >>
This study identifies a natural system in Lactococcus lactis, in which a restriction modification specificity subunit resident on a 6159 bp plasmid (pAH33) alters the specificity of a functional R/M mechanism encoded by a 20.3 kb plasmid, pAH82. The new specificity was identified after phenotypic and molecular analysis of a 26.5 kb co-integrate plasmid (pAH90), which was detected after bacteriophage challenge of the parent strain. Analysis of the regions involved in the co-integration revealed that two novel hybrid hsdS genes had been formed during the co-integration event. The HsdS chimeras had interchanged the C- and N-terminal variable domains of the parent subunits, generating two new restriction specificities. Comparison of the parent hsdS genes with other type I specificity determinants revealed that the region of the hsdS genes responsible for the co-integration event is highly conserved among lactococcal type I hsdS determinants. Thus, as hsdS determinants are widespread in the genus Lactococcus, new restriction specificities may evolve rapidly after homologous recombination between these genes. This study demonstrates that, similar to previous observations in Gram-negative bacteria, a Gram-positive bacterium can acquire novel restriction specificities naturally through domain shuffling of resident HsdS subunits.
|
32. |
Ingmer H,
Varmanen P,
( 2000 ) ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. PMID : 10846223 : DOI : 10.1099/00221287-146-6-1447 Abstract >>
Bacteria undergo a complex programme of differential gene expression in response to stress. In Bacillus subtilis, it was recently shown that CtsR, a negative transcriptional regulator, mediates stress-induced expression of components of the Clp protease complex. In this study, a gene was identified in the Gram-positive bacterium Lactococcus lactis that encodes a 17 kDa product with 38% identity to the CtsR protein of B. subtilis. By Northern analyses it was found that in a L. lactis strain carrying a large internal deletion of ctsR, including the region encoding a putative helix-turn-helix motif, the amounts of clpC, clpP, clpB and clpE mRNAs were increased 3-8-fold compared to those present in wild-type L. lactis MG1363. In another ctsR mutant strain in which only one-third of CtsR was deleted, leaving the putative DNA-binding domain and the C-terminal 29 amino acids intact, only minor derepression of clp gene expression was observed and, furthermore, all the clp genes were still induced by heat. These results indicate that the amino acids of CtsR involved in temperature sensing are located either close to the DNA-binding domain or in the C-terminal part of the protein. Thus, in L. lactis in addition to B. subtilis, CtsR is a key regulator of heat-shock-induced gene expression, suggesting that the presence of CtsR-homologous DNA-binding sites observed in many Gram-positive bacteria reflects functional heat-shock regulatory systems.
|
33. |
Bouchard JD,
( 2000 ) Homologous recombination between a lactococcal bacteriophage and the chromosome of its host strain. PMID : 10772980 : DOI : 10.1006/viro.2000.0226 Abstract >>
Genetic exchanges constitute a significant means by which bacteriophages acquire novel characteristics. Phages of Lactococcus lactis occupy a particular niche, the dairy factory environment, where their populations are subjected to constant changes. Little is known about the mechanisms of evolution that lead to the genetic diversity of lactococcal phages. In this study, we described two DNA exchanges involving the lytic phage ul36, a member of the P335 species, and its L. lactis host. They occurred by homologous recombination with phage-related sequences present in the host chromosome. Both mutants generated by these recombination events are insensitive to the phage resistance mechanism AbiK and one has a reduced burst size as well as a new origin of replication. We propose that this type of DNA exchange with prophages or remnants of prophages occurs frequently within the P335 species as supported by DNA-DNA comparisons between P335-like phages.
|
34. |
Martínez-Cuesta MC,
Buist G,
Kok J,
Hauge HH,
Nissen-Meyer J,
Peláez C,
Requena T,
( 2000 ) Biological and molecular characterization of a two-peptide lantibiotic produced by Lactococcus lactis IFPL105. PMID : 10971756 : Abstract >>
The lactic acid bacterium Lactococcus lactis IFPL105 secretes a broad spectrum bacteriocin produced from the 46 kb plasmid pBAC105. The bacteriocin was purified to homogeneity by ionic and hydrophobic exchange and reverse-phase chromatography. Bacteriocin activity required the complementary action of two distinct peptides (alpha and beta) with average molecular masses of 3322 and 2848 Da, respectively. The genes encoding the two peptides were cloned and sequenced and were found to be identical to the ltnAB genes from plasmid pMRC01 of L. lactis DPC3147. LtnA and LtnB contain putative leader peptide sequences similar to the known 'double glycine' type. The predicted amino acid sequence of mature LtnA and LtnB differed from the amino acid content determined for the purified alpha and beta peptides in the residues serine, threonine, cysteine and alanine. Post-translational modification, and the formation of lanthionine or methyllanthionine rings, could partly explain the difference. Hybridization experiments showed that the organization of the gene cluster in pBAC105 responsible for the production of the bacteriocin is similar to that in pMRC01, which involves genes encoding modifying enzymes for lantibiotic biosynthesis and dual-function transporters. In both cases, the gene clusters are flanked by IS946 elements, suggesting an en bloc transposition. The findings from the isolation and molecular characterization of the bacteriocin provide evidence for the lantibiotic nature of the two peptides.
|
35. |
Kobayashi M,
Nomura M,
( 2000 ) Inactivation of the glutamate decarboxylase gene in Lactococcus lactis subsp. cremoris. PMID : 10788408 : DOI : 10.1128/aem.66.5.2235-2237.2000 PMC : PMC101481 Abstract >>
Lactococcus lactis subsp. lactis strains show glutamate decarboxylase activity, whereas L. lactis subsp. cremoris strains do not. The gadB gene encoding glutamate decarboxylase was detected in the L. lactis subsp. cremoris genome but was poorly expressed. Sequence analysis showed that the gene is inactivated by the frameshift mutation and encoded in a nonfunctional protein.
|
36. |
Arnau J,
Madsen SM,
Ravn P,
( 2000 ) The development of TnNuc and its use for the isolation of novel secretion signals in Lactococcus lactis. PMID : 10721729 : DOI : 10.1016/s0378-1119(99)00530-2 Abstract >>
We have previously used Tn917 for the identification and characterization of regulated promoters from Lactococcus lactis [Israelsen et al., Appl. Environ. Microbiol. 61 (1995) 2540-2547]. We describe here the construction of a new Tn917-transposon derivative, termed TnNuc, which includes the Staphylococcus aureus nuclease gene (nuc) as a reporter for secretion. Transposition of TnNuc into the L. lactis chromosome allows the generation of fusions in-frame with the nuc gene. TnNuc includes also lacZ, a reporter used for identification of relevant clones from the library, i.e. clones with Lac+ phenotype result from transposition of TnNuc into a functional gene on the L. lactis chromosome. The presence of a functional signal sequence at the upstream flanking region of the left repeat of the transposed element results in the detection of nuclease activity using a sensitive plate assay. TnNuc was used for the identification of novel secretion signals from L. lactis. The sequences identified included known and unknown lactococcal-secreted proteins containing either a signal peptidase-I or -II recognition sequence. In one case, the gene identified codes for a transmembrane protein. The sequences identified were used to study functionality when located in a plasmid under the control of the pH and growth phase-dependent promoter P170 [Madsen et al., Mol. Microbiol. 32 (1999) 75-87]. In all cases, concurrent secretion of nuclease was observed during induction of P170 in a fermentor.
|
37. |
van Sinderen D,
Seegers JF,
( 2000 ) Molecular characterization of the lactococcal plasmid pCIS3: natural stacking of specificity subunits of a type I restriction/modification system in a single lactococcal strain. PMID : 10708382 : DOI : 10.1099/00221287-146-2-435 Abstract >>
A 6.1 kb plasmid from the Lactococcus lactis subsp. cremoris strain UC509.9, named pCIS3, was found to mediate a restriction/modification (R/M) phenotype. Nucleotide sequence analysis of pCIS3 revealed the presence of an hsdS gene, typical of type I R/M systems. The presence of this plasmid resulted in a 10(4)-fold reduction in the efficiency of plating (e.o.p.) of unmodified phage. In addition to the hsdS gene of pCIS3, two more hsdS genes were identified in strain UC509.9, one located on the chromosome downstream of a gene highly homologous to hsdM genes and a third on the smallest (4 kb) plasmid, named pCIS1. The replication region of pCIS3 was highly similar to that of a large family of lactococcal theta replicons. In addition, pCIS3 was found to encode a member of the CorA family of magnesium transporters.
|
38. |
Emond E,
Dion E,
Boucher I,
( 2000 ) Microbiological and molecular impacts of AbiK on the lytic cycle of Lactococcus lactis phages of the 936 and P335 species. PMID : 10708383 : DOI : 10.1099/00221287-146-2-445 Abstract >>
The lactococcal abortive infection mechanism AbiK was previously shown to be highly effective against the small isometric-headed bacteriophage ul36 of the P335 species, as evidenced by an efficiency of plaquing (e.o.p.) of 10(-6), a 14-fold reduction in the burst size and an efficiency at which centres of infection form (e.c.o.i.) of 0.5%. No phage DNA was detected in the infected AbiK+ cells [Emond, E., Holler, B. J., Boucher, I., Vandenbergh, P. A., Vedamuthu, E. R., Kondo, J. K. & Moineau, S. (1997). Appl Environ Microbiol 63, 1274-1283]. Here, the effects of AbiK are compared on the small isometric-headed phages p2 and P008 (936 species) and on the phage P335 (P335 species). The microbiological impacts of AbiK on p2 were relatively similar to those reported for ul36, with an e.o.p. of 10(6), an 11-fold reduction in the burst size and an e.c.o.i. of 5%. Contrary to phage ul36, replication of phage p2 DNA was observed in the AbiK+ cells. Only immature forms (concatemeric and circular DNA) of phage p2 DNA were found, indicating that the presence of AbiK prevented phage DNA maturation. These distinct molecular consequences of AbiK were also observed for phages P335 and P008, two phages that propagate on the same host. To the knowledge of the authors, this is the first time that different phage responses towards an Abi system have been reported.
|
39. |
Lanfermeijer FC,
Sanz Y,
( 2000 ) Kinetics and structural requirements for the binding protein of the Di-tripeptide transport system of Lactococcus lactis. PMID : 10769143 : DOI : 10.1021/bi992720s Abstract >>
The gene (dppA) encoding the binding protein of the di-tripeptide ABC transporter of Lactococcus lactis (DppA) was cloned under the control of the nisin promoter. Amplified expression (approximately 200-fold increase) of the protein fused to a carboxyl-terminal six-histidine tag allowed the purification of DppA-(His)(6) by nickel-chelate affinity and anion-exchange chromatography. Ligand binding to DppA-(His)(6) elicited an electrophoretic mobility shift, a decrease in the intrinsic fluorescence, and a blue shift of the emission maximum. Each of these parameters detected conformational changes in the protein that reflect ligand binding, and these were used to determine the structural requirements of DppA-(His)(6) for binding peptides. The major features of peptide binding include (i) high affinity for di- and tripeptides, (ii) requirement of a free N-terminal alpha-amino group and an alpha-peptide bound contiguous with the N-terminal amino group, (iii) stereospecificity for L-isomers, and (iv) preference for dipeptides containing methionine or arginine, followed by hydrophobic tripeptides consisting of leucine or valine residues. Maximal binding affinity was detected at pH 6.0, and the K(d) for binding increased 1 order of magnitude for every unit increase in pH. This suggests that the ionization of protein residues (pK > 6.0) in or in close proximity to the binding site is critical in the binding mechanism.
|
40. |
Gruss A,
Rallu F,
( 2000 ) Acid- and multistress-resistant mutants of Lactococcus lactis : identification of intracellular stress signals. PMID : 10672175 : DOI : 10.1046/j.1365-2958.2000.01711.x Abstract >>
Lactococcus lactis growth is accompanied by lactic acid production, which results in acidification of the medium and arrest of cell multiplication. Despite growth limitation at low pH, there is evidence that lactococci do have inducible responses to an acid pH. In order to characterize the genes involved in acid tolerance responses, we selected acid-resistant insertional mutants of the L. lactis strain MG1363. Twenty-one independent characterized mutants were affected in 18 different loci, some of which are implicated in transport systems or base metabolism. None of these genes was identified previously as involved in lactococcal acid tolerance. The various phenotypes obtained by acid stress selection allowed us to define four classes of mutants, two of which comprise multistress-resistant strains. Our results reveal that L. lactis has several means of protecting itself against low pH, at least one of which results in multiple stress resistance. In particular, intracellular phosphate and guanine nucleotide pools, notably (p)ppGpp, are likely to act as signals that determine the level of lactococcal stress response induction. Our results provide a link between the physiological state of the cell and the level of stress tolerance and establish a role for the stringent response in acid stress response regulation.
|
41. |
Griffin HG,
Aungpraphapornchai P,
( 1999 ) Cloning, DNA sequence analysis, and deletion of a gene encoding diacetyl-acetoin reductase from Lactococcus lactis. PMID : 10647818 : Abstract >>
Diacetyl is produced by strains of lactic acid bacteria used in the dairy industry. Production of this important flavour compound could be increased by genetic manipulation of genes encoding enzymes involved in diacetyl metabolism. This paper reports the cloning and sequencing of the gene (dar) encoding diacetyl-acetoin reductase from Lactococcus lactis. Analysis of the DNA sequence of the dar gene and surrounding area revealed the presence of a putative operon with similarity to the family of ABC transporter systems. The dar gene has been deleted from the chromosome by double cross-over homologous recombination.
|
42. |
Curley P,
( 2000 ) Identification and characterisation of a gene encoding aminoacylase activity from Lactococcus lactis MG1363. PMID : 10650223 : DOI : 10.1111/j.1574-6968.2000.tb08954.x Abstract >>
Analysis of the sequence of a randomly cloned chromosomal DNA fragment (3.2 kb) from Lactococcus lactis revealed the presence of part of an open reading frame, designated amd1, which specifies a protein displaying significant similarity to aminoacylases from various bacteria. The presence of an immobilised copy of an IS982 element immediately upstream of the coding region of amd1 has probably resulted in the displacement of amd1's native promoter. This genetic organisation was shown to be retained in seven other dairy strains, one of which was only slightly different. The amd1 gene was overexpressed in L. lactis NZ9800 under the control of the inducible nisA promoter and the deacetylating capacity of its gene product was measured on a number of substrates.
|
43. |
Guillot A,
Gripon JC,
Renault P,
Obis D,
( 1999 ) Genetic and biochemical characterization of a high-affinity betaine uptake system (BusA) in Lactococcus lactis reveals a new functional organization within bacterial ABC transporters. PMID : 10515910 : PMC : PMC103755 Abstract >>
The cytoplasmic accumulation of exogenous betaine stimulates the growth of Lactococcus lactis cultivated under hyperosmotic conditions. We report that L. lactis possesses a single betaine transport system that belongs to the ATP-binding cassette (ABC) superfamily of transporters. Through transposon mutagenesis, a mutant deficient in betaine transport was isolated. We identified two genes, busAA and busAB, grouped in an operon, busA (betaine uptake system). The transcription of busA is strongly regulated by the external osmolality of the medium. The busAA gene codes for the ATP-binding protein. busAB encodes a 573-residue polypeptide which presents two striking features: (i) a fusion between the regions encoding the transmembrane domain (TMD) and the substrate-binding domain (SBD) and (ii) a swapping of the SBD subdomains when compared to the Bacillus subtilis betaine-binding protein, OpuAC. BusA of L. lactis displays a high affinity towards betaine (K(m) = 1.7 microM) and is an osmosensor whose activity is tightly regulated by external osmolality, leading the betaine uptake capacity of L. lactis to be under dual control at the biochemical and genetic levels. A protein presenting the characteristics predicted for BusAB was detected in the membrane fraction of L. lactis. The fusion between the TMD and the SBD is the first example of a new organization within prokaryotic ABC transporters.
|
44. |
Malarme K,
Ehrlich SD,
Mauger S,
Bolotin A,
( N/A ) Low-redundancy sequencing of the entire Lactococcus lactis IL1403 genome. PMID : 10532372 : Abstract >>
Lactococcus lactis is an AT-rich gram positive bacterium phylogenetically close to the genus Streptococcus. Various strains of L. lactis are used in dairy industry as starters for cheese making. L. lactis is also one of the well characterized laboratory microorganisms, widely used for studies on physiology of lactic acid bacteria. We describe here a low redundancy sequence of the genome of the strain L. lactis IL1403. The strategy which we followed to determine the sequence consists of two main steps. First, a limited number of plasmids and lambda-phages that carry random segments of the genome were sequenced. Second, sequences of the inserts were used for production of novel sequencing templates by applying Multiplex Long Accurate PCR protocols. Using of these PCR products allowed to determine the sequence of the entire 2.35 Mb genome with a very low redundancy, close to 2. The error rate of the sequence is estimated to be below 1%. The correctness of the sequence assembly was confirmed by PCR amplification of the entire L. lactis IL1403 genome, using a set of 266 oligonucleotides. Anotation of the sequence was undertaken by using automatic gene prediction computer tools. This allowed to identify 1495 protein-encoding genes, to locate them on the genome map and to classify their functions on the basis of homology to known proteins. The function of about 700 genes expected to encode proteins that lack homologs in data bases cannot be reliably predicted in this way. The approach which we used eliminates high redundancy sequencing and mapping efforts, needed to obtain detailed and comprehensive genetic and physical maps of a bacterium. Availability of detailed genetic and physical maps of the L. lactis IL1403 genome provides many entries to study metabolism and physiology of bacteria from this group. The presence of 42 copies of five different IS elements in the IL1403 genome confirms the importance of these elements for genetic exchange in Lactococci. These include two previously unknown elements, present at seven and fifteen copies and designated IS1077 and IS983, respectively. Five potential or rudimentary prophages were identified in the genome by detecting clusters of phage-related genes. The metabolic and regulatory potential of L. lactis was evaluated by inspecting gene sets classified into different functional categories. L. lactis has the genetic potential to synthesise 20 standard amino acids, purine and pyrimidine nucleotides and at least four cofactors. Some of these metabolites, which are usually present in chemically defined media, can probably be omitted. About twenty compounds can be used by L. lactis as a sole carbon source. Some 83 regulators were revealed, indicating a regulatory potential close to that of Haemophilus influenzae, a bacterium with a similar genome size. Unexpectedly, L. lactis has a complete set of late competence genes, which may have concerted transcriptional regulation and unleadered polycistronic mRNAs. These findings open new possibilities for developing genetic tools, useful for studies of gene regulation in AT-rich gram positive bacteria and for engineering of new strains for the diary industry.
|
45. |
Immonen T,
( 1998 ) Characterization of the nisFEG operon of the nisin Z producing Lactococcus lactis subsp. lactis N8 strain. PMID : 10524754 : Abstract >>
Biosynthesis of the food additive nisin, a posttranslationally modified peptide antibiotic existing as two natural variants (A and Z), requires eleven genes (nisA/ZBTCIPRKFEG) involved in modification, secretion, regulation and self-immunity. The suggested self-immunity genes (nisFEG) of the nisin Z producer Lactococcus lactis subsp. lactis N8 were cloned and sequenced. Putative binding sites of the NisR transcription factor were recognized upstream of the nisF promoter. The hydrophilic NisF protein was expressed in Escherichia coli and shown to be associated with the membrane. Expression of the nisF gene from a plasmid in L. lactis MG1614, a strain lacking the nisin operons, did not increase the nisin resistance of the cells. This showed that NisF alone does not protect against nisin. Overexpression of the nisF gene in the N8 nisin producer did not affect the level of nisin immunity, indicating that the wild-type amount of NisF is not limiting the level of nisin immunity. Production of antisense-nisEG or antisense-nisG RNA in L. lactis N8 resulted in severe reduction in the level of nisFEG mRNA and a clearly reduced immunity showing that the nisFEG transcript is important for development of nisin self-immunity.
|
46. |
Ingmer H,
Kilstrup M,
Hammer K,
( 1999 ) Disruption and analysis of the clpB, clpC, and clpE genes in Lactococcus lactis: ClpE, a new Clp family in gram-positive bacteria. PMID : 10094684 : PMC : PMC93619 Abstract >>
In the genome of the gram-positive bacterium Lactococcus lactis MG1363, we have identified three genes (clpC, clpE, and clpB) which encode Clp proteins containing two conserved ATP binding domains. The proteins encoded by two of the genes belong to the previously described ClpB and ClpC families. The clpE gene, however, encodes a member of a new Clp protein family that is characterized by a short N-terminal domain including a putative zinc binding domain (-CX2CX22CX2C-). Expression of the 83-kDa ClpE protein as well as of the two proteins encoded by clpB was strongly induced by heat shock and, while clpC mRNA synthesis was moderately induced by heat, we were unable to identify the ClpC protein. When we analyzed mutants with disruptions in clpB, clpC, or clpE, we found that although the genes are part of the L. lactis heat shock stimulon, the mutants responded like wild-type cells to heat and salt treatments. However, when exposed to puromycin, a tRNA analogue that results in the synthesis of truncated, randomly folded proteins, clpE mutant cells formed smaller colonies than wild-type cells and clpB and clpC mutant cells. Thus, our data suggest that ClpE, along with ClpP, which recently was shown to participate in the degradation of randomly folded proteins in L. lactis, could be necessary for degrading proteins generated by certain types of stress.
|
47. |
Israelsen H,
Givskov M,
Madsen SM,
( 1999 ) Molecular characterization of the pH-inducible and growth phase-dependent promoter P170 of Lactococcus lactis. PMID : 10216861 : DOI : 10.1046/j.1365-2958.1999.01326.x Abstract >>
In a previous study, we described the use of transposon Tn917-LTV1 for identification of environmentally regulated promoters in Lactococcus lactis. Here, we report the molecular analysis of one of these promoters, P170, that is upregulated at low pH during the transition to stationary phase. The minimal DNA region required for both promoter activity and pH regulation was mapped to a 51 bp fragment located 7 bp upstream of the transcriptional start site. This fragment lacked the consensus -35 promoter region, but it contained an 'extended' -10 promoter region. When a 28 bp segment, containing the consensus -35 region and 22 bp upstream of this in a constitutive promoter, was replaced with the corresponding sequence of P170, the hybrid promoter became regulated by pH and growth phase. This demonstrates that the P170 segment contains a cis-acting sequence involved in the control of promoter regulation. Transcriptional analysis showed that P170 is responsible for the transcription of a monocistronic gene orfX encoding a polypeptide homologous to a hypothetical protein from Bacillus subtilis. Analysis of total RNA from L. lactis grown at constant pH confirmed that transcription from P170 was induced between pH 6.5 and pH 6.0, but only when the culture entered stationary phase. Deletion analysis and chemical mutagenesis of P170 defined a specific region within the untranslated mRNA leader that is able to modulate the expression level directed by the P170 promoter. Deletion of a 72 bp HaeIII fragment from this leader region resulted in a 150- to 200-fold increase in the level of gene expression, without affecting the regulation. The functionality was confirmed by introducing this modulating element downstream of other lactococcal promoters.
|
48. |
Gasson MJ,
Shearman CA,
Green J,
( 1999 ) Two operons that encode FNR-like proteins in Lactococcus lactis. PMID : 10200970 : DOI : 10.1046/j.1365-2958.1999.01298.x Abstract >>
Global regulatory circuits of the type mediated by CRP and FNR in Escherichia coli were sought in Lactococcus lactis to provide a basis for redirecting carbon metabolism to specific fermentation products. Using a polymerase chain reaction (PCR) approach, two genes (flpA and flpB) encoding FNR-like proteins (FlpA and FlpB) with the potential for mediating a dithiol-disulphide-dependent regulatory switch, were identified. Transcript analysis indicated that they are distal genes of two paralogous operons, orfX-orfY-flp, in which the orfX and orfY genes were predicted to encode binding domain components of cation ATPases and storage proteins respectively. The corresponding promoters were each associated with a potential FNR site (TTGAT----ATCAA) at positions +4.5 (flpA operon) and -42.5 (flpB operon), suggesting that the respective operons might be negatively and positively autoregulated. The incomplete open reading frames (orfWA/B) located upstream of each operon were predicted to encode additional components of paralogous cation ATPases. No phenotypic effects were detected in flpA and flpB single mutants, but the double mutant had a lower intracellular zinc content, an increased sensitivity to hydrogen peroxide and an altered polypeptide profile (as determined by two-dimensional gel electrophoresis): formate production was not affected. It was concluded tentatively that FlpA and FlpB regulate overlapping modulons, including systems concerned with zinc uptake, in response to metal ion or oxidative stress.
|
49. |
Ehrlich SD,
Gruss A,
( 1999 ) Effects of metabolic flux on stress response pathways in Lactococcus lactis. PMID : 10048028 : DOI : 10.1046/j.1365-2958.1999.01222.x Abstract >>
Studies of cellular responses to stress conditions such as heat, oxygen or starvation have revealed the existence of numerous specific or interactive response pathways. We previously observed in Lactococcus lactis that inactivation of the recA gene renders the lactococcal strain sensitive not only to DNA-damaging agents but also to oxygen and heat. To further examine the stress response pathways in L. lactis, we isolated thermoresistant insertional mutants (Trm) of the recA strain. Eighteen independent trm mutations were identified and characterized. We found that mutations map in only seven genes, implicated in purine metabolism (deoB, guaA and tktA), phosphate uptake (pstB and pstS), mRNA stability (pnpA) and in one uncharacterized gene (trmA). All the trm mutations, with the exception of trmA, confer multiple stress resistance to the cell. Some of the mutations confer improved heat stress resistance not only in the recA but also in the wild-type context. Our results reveal that cellular metabolic pathways are intimately related to stress response and that the flux of particular metabolites, notably guanine and phosphate, may be implicated in stress response in lactococci.
|
50. |
Khunajakr N,
Dunn NW,
( 1999 ) A plasmid-encoded two-component regulatory system involved in copper-inducible transcription in Lactococcus lactis. PMID : 10095123 : DOI : 10.1016/s0378-1119(98)00395-3 Abstract >>
Two regulatory genes (lcoR and lcoS) were identified from a plasmid-borne lactococcal copper resistance determinant and characterized by transcriptional fusion to the promoterless chloramphenicol acetyltransferase gene (cat). RT-PCR analysis indicates that lcoR and lcoS are organized within an operon, controlling the transcription of cat in a copper-inducible manner. The amino acid sequences deduced from lcoR and lcoS show homology to the response and sensor proteins of known two-component regulatory systems. Deletion within either lcoS or both genes inactivated the copper-dependent activity, suggesting the presence of no trans-acting lcoR and lcoS homologs in the lactococcal host chromosome. The transcription start site involved in copper induction was mapped by primer extension.
|
51. |
Luesink EJ,
de Vos WM,
Kuipers OP,
( 1999 ) Characterization of the divergent sacBK and sacAR operons, involved in sucrose utilization by Lactococcus lactis. PMID : 10074089 : PMC : PMC93595 Abstract >>
The divergently transcribed sacBK and sacAR operons, which are involved in the utilization of sucrose by Lactococcus lactis NZ9800, were examined by transcriptional and gene inactivation studies. Northern analyses of RNA isolated from cells grown at the expense of different carbon sources revealed three sucrose-inducible transcripts: one of 3.2 kb containing sacB and sacK, a second of 3.4 kb containing sacA and sacR, and a third of 1.8 kb containing only sacR. The inactivation of the sacR gene by replacement recombination resulted in the constitutive transcription of the sacBK and sacAR operons in the presence of different carbon sources, indicating that SacR acts as a repressor of transcription.
|
52. |
Peltonen T,
Mäntsälä P,
( 1999 ) Isolation and characterization of a purC(orf)QLF operon from Lactococcus [correction of Lactobacillus] lactis MG1614. PMID : 10071207 : DOI : 10.1007/s004380050938 Abstract >>
We have isolated genes encoding enzymes of the de novo purine nucleotide biosynthesis pathway from Lactococcus lactis MG1614 by colony hybridization using DIG-labeled DNA probes. The organization of the genes needed for the de novo biosynthesis of purine nucleotides in L. lactis differs from that found in other organisms. In L. lactis there is a gene cluster, which contains five out of the 11 genes needed for the de novo biosynthesis of IMP, namely purC, orf, purQ, purL and purF. These genes were shown to be transcribed as a single transcription unit by Northern hybridization analysis. The 5' end of the transcript of the purC(orf)QLF operon was determined by primer extension analysis using fluorescently end-labeled probes. The purC(orf)QLF operon of L. lactis is transcribed in Escherichia coli, and the gene product of the purF gene, glutamine phosphoribosylpyrophosphate amidotransferase (glutamine PRPP ATase, EC 2.4.2.14), can functionally complement the E. coli purF mutant strain TX158. We also show that the promoter of the purC(orf)QLF operon is regulated in response to exogenously added purines.
|
53. |
Iwatani S,
Zendo T,
Yoneyama F,
Nakayama J,
Sonomoto K,
( 2007 ) Characterization and structure analysis of a novel bacteriocin, lacticin Z, produced by Lactococcus lactis QU 14. PMID : 17690480 : DOI : 10.1271/bbb.70169 Abstract >>
A novel bacteriocin, lacticin Z, produced by Lactococcus lactis QU 14 isolated from a horse's intestinal tract was identified. Lacticin Z was purified through a three step procedure comprised of hydrophobic-interaction, cation-exchange chromatography, and reverse-phase HPLC. ESI-TOF MS determined the molecular mass of lacticin Z to be 5,968.9 Da. The primary structure of lacticin Z was found to consist of 53 amino acid residues without any leader sequence or signal peptide. Lacticin Z showed homology to lacticin Q from L. lactis QU 5, aureocin A53 from Staphylococcus aureus A53, and mutacin BHT-B from Streptococcus rattus strain BHT. It exhibited a nanomolar range of MICs against various Gram-positive bacteria, and the activity was completely stable up to 100 degrees C. Unlike many of other LAB bacteriocins, the stability of lacticin Z was emphasized under alkaline conditions rather than acidic conditions. All the results indicated that lacticin Z belongs to a novel type of bacteriocin.
|
54. |
Van der Meulen R,
Grosu-Tudor S,
Mozzi F,
Vaningelgem F,
Zamfir M,
de Valdez GF,
De Vuyst L,
( 2007 ) Screening of lactic acid bacteria isolates from dairy and cereal products for exopolysaccharide production and genes involved. PMID : 17716765 : DOI : 10.1016/j.ijfoodmicro.2007.07.014 Abstract >>
A total of 174 lactic acid bacteria (LAB) strains isolated from dairy and cereal products were screened for the production of exopolysaccharides (EPS). Therefore, a rapid screening method was developed based on ultrafiltration and gel permeation chromatography. Furthermore, a screening through the polymerase chain reaction (PCR) was performed with primer pairs targeting different genes involved in EPS production. Nine isolates produced a homopolysaccharide of the glucan type, whereas only one strain produced a heteropolysaccharide. The production of a glucan by a strain of Lactococcus lactis and the production of a heteropolysaccharide by a strain of Lactobacillus curvatus are reported for the first time. The PCR screening revealed many positive strains. For three of the ten EPS-producing strains, no corresponding genes could be detected. Furthermore, a lot of strains possessed one or more eps genes but did not produce an EPS. Therefore, a screening on the molecular level should always be accompanied by another screening method that is able to distinguish true EPS producer strains from non-producing ones. Statistical analysis did not reveal any relationship between the type and origin of the strains, the presence or absence of a capsular polysaccharide or EPS, and the presence or absence of eps genes.
|
55. |
Tanous C,
Chambellon E,
Yvon M,
( 2007 ) Sequence analysis of the mobilizable lactococcal plasmid pGdh442 encoding glutamate dehydrogenase activity. PMID : 17464081 : DOI : 10.1099/mic.0.2006/002246-0 Abstract >>
A novel plasmid named pGdh442 had previously been isolated from a plant Lactococcus lactis strain. This plasmid encodes two interesting properties with applications in the dairy industry: a glutamate dehydrogenase activity that stimulates amino acid conversion to aroma compounds, and cadmium/zinc resistance that can be used as a selectable marker. Moreover, this plasmid can be transferred naturally to other strains, but appears to be incompatible with certain other lactococcal plasmids. During this study, the complete sequence of pGdh442 (68 319 bp) was determined and analysed. This plasmid contains 67 ORFs that include 20 IS elements that may have mediated transfer events between L. lactis and other genera living in the same biotope, such as Streptococcus, Pediococcus and Lactobacillus. Even though it is a low-copy-number plasmid, it is relatively stable due to a theta replication mode and the presence of two genes involved in its maintenance system. However, pGdh442 is incompatible with pSK08-derived protease/lactose plasmids because both possess the same replication and partition system. pGdh442 is not self-transmissible, but can be naturally transmitted via mobilization by conjugative elements carried by the chromosome or by other plasmids, such as the 712-type sex factor, which is widely distributed in L. lactis. In addition to several genes already found on other L. lactis plasmids, such as the oligopeptide transport and utilization genes, pGdh442 also carries several genes not yet identified in L. lactis. Finally, it does not carry genes that would trigger concern over its presence in human food.
|
56. |
Fujita K,
Ichimasa S,
Zendo T,
Koga S,
Yoneyama F,
Nakayama J,
Sonomoto K,
( 2007 ) Structural analysis and characterization of lacticin Q, a novel bacteriocin belonging to a new family of unmodified bacteriocins of gram-positive bacteria. PMID : 17351096 : DOI : 10.1128/AEM.02286-06 PMC : PMC1892864 Abstract >>
Lactococcus lactis QU 5 isolated from corn produces a novel bacteriocin, termed lacticin Q. By acetone precipitation, cation-exchange chromatography, and reverse-phase high-performance liquid chromatography, lacticin Q was purified from the culture supernatant of this organism, and its molecular mass was determined to be 5,926.50 Da by mass spectrometry. Subsequent analyses of amino acid and DNA sequences revealed that lacticin Q comprised 53 amino acid residues and that its N-terminal methionine residue was formylated. In contrast to most bacteriocins produced by gram-positive bacteria, lacticin Q had no N-terminal extensions such as leader or signal sequences. It showed 66% and 48% identity to AucA, a hypothetical protein from Corynebacterium jeikeium plasmid pA501, and aureocin A53, a bacteriocin from Staphylococcus aureus A53, respectively. The characteristics of lacticin Q were determined and compared to those of nisin A. Similar to nisin A, lacticin Q exhibited antibacterial activity against various gram-positive bacteria. Lacticin Q was very stable against heat treatment and changes in pH; in particular, it was stable at alkaline pH values, while nisin A was inactivated. Moreover, lacticin Q induced ATP efflux from a Listeria sp. strain in a shorter time and at a lower concentration than nisin A, indicating that the former affected indicator cells in a different manner from that of the latter. The results described here clarified the fact that lacticin Q belongs to a new family of class II bacteriocins and that it can be employed as an alternative to or in combination with nisin A.
|
57. |
Broadbent JR,
Rodríguez BT,
Joseph P,
Smith EA,
Steele JL,
( 2006 ) Conversion of Lactococcus lactis cell envelope proteinase specificity by partial allele exchange. PMID : 16696678 : DOI : 10.1111/j.1365-2672.2006.02860.x Abstract >>
To determine whether conversion of lactocepin substrate binding regions by gene replacement can alter lactocepin specificity in Lactococcus lactis starter bacteria without affecting other important strain properties. We utilized two-step gene replacement to convert substrate-binding determinants in the L. lactis prtP genes encoding group h (bitter) lactocepin in two industrial strains into the corresponding group b (nonbitter) variant. Analysis of lactocepin activity toward alpha(s1)-casein (f 1-23) by reversed-phase high-pressure liquid chromatography demonstrated enzyme specificity among isogenic derivatives had been altered in a manner that was consistent with predicted amino acid substitutions in substrate binding regions. Milk acidification properties of some mutants were not statistically different (P > 0.05) from wild-type parent strains, and strain propensity for autolysis was also not significantly (P > 0.05) changed. Conversion of lactocepin substrate binding regions by allele exchange can effectively alter lactocepin specificity in industrial strains of L. lactis without significantly affecting other important strain properties. Methodology outlined in this study can be used to alter lactocepin specificity in commercial starter cultures with a propensity for bitter flavour defect, and prtP derivatives developed by this approach should be suitable for commercial application.
|
58. |
O'Driscoll J,
Glynn F,
Fitzgerald GF,
van Sinderen D,
( 2006 ) Sequence analysis of the lactococcal plasmid pNP40: a mobile replicon for coping with environmental hazards. PMID : 16952955 : DOI : 10.1128/JB.00672-06 PMC : PMC1595478 Abstract >>
The conjugative lactococcal plasmid pNP40, identified in Lactococcus lactis subsp. diacetylactis DRC3, possesses a potent complement of bacteriophage resistance systems, which has stimulated its application as a fitness-improving, food-grade genetic element for industrial starter cultures. The complete sequence of this plasmid allowed the mapping of previously known functions including replication, conjugation, bacteriocin resistance, heavy metal tolerance, and bacteriophage resistance. In addition, functions for cold shock adaptation and DNA damage repair were identified, further confirming pNP40's contribution to environmental stress protection. A plasmid cointegration event appears to have been part of the evolution of pNP40, resulting in a "stockpiling" of bacteriophage resistance systems.
|
59. |
Cluzel PJ,
Chopin A,
Ehrlich SD,
Chopin MC,
( 1991 ) Phage abortive infection mechanism from Lactococcus lactis subsp. lactis, expression of which is mediated by an Iso-ISS1 element. PMID : 1664711 : PMC : PMC184010 Abstract >>
A 5-kb DNA fragment conferring a phage abortive infection phenotype (Abi+) has been cloned from Lactococcus lactis subsp. lactis IL416. The Abi+ determinant was subcloned on a 2-kb fragment which carried an Iso-ISS1 element and an open reading frame of 753 bp designated ORFX. Deletion within ORFX entailed the loss of the Abi+ phenotype, establishing that ORFX is the structural abi-416 gene. The expression of abi-416 was shown to be mediated by the Iso-ISS1 element, which contains a sequence fitting the consensus sequence for gram-positive promoters.
|
60. |
Zendo T,
Koga S,
Shigeri Y,
Nakayama J,
Sonomoto K,
( 2006 ) Lactococcin Q, a novel two-peptide bacteriocin produced by Lactococcus lactis QU 4. PMID : 16672481 : DOI : 10.1128/AEM.72.5.3383-3389.2006 PMC : PMC1472383 Abstract >>
A bacteriocin-producing strain, Lactococcus lactis QU 4, was isolated from corn. The bacteriocin, termed lactococcin Q, showed antibacterial activity only against L. lactis strains among a wide range of gram-positive indicator strains tested. Lactococcin Q was purified by acetone precipitation, cation exchange chromatography, and reverse-phase chromatography. Lactococcin Q consisted of two peptides, alpha and beta, whose molecular masses were determined to be 4,260.43 Da and 4,018.36 Da, respectively. Amino acid and DNA sequencing analyses revealed that lactococcin Q was a novel two-peptide bacteriocin, homologous to lactococcin G. Comparative study using chemically synthesized lactococcin Q (Qalpha plus Qbeta) and lactococcin G (Galpha plus Gbeta) clarified that hybrid combinations (Qalpha plus Gbeta and Galpha plus Qbeta) as well as original combinations showed antibacterial activity, although each single peptide showed no significant activity. These four pairs of lactococcin peptides acted synergistically at a 1:1 molar ratio and exhibited identical antibacterial spectra but differed in MIC. The MIC of Qalpha plus Gbeta was 32 times higher than that of Qalpha plus Qbeta, suggesting that the difference in beta peptides was important for the intensity of antibacterial activity.
|
61. |
Polzin KM,
McKay LL,
( 1991 ) Identification, DNA sequence, and distribution of IS981, a new, high-copy-number insertion sequence in lactococci. PMID : 1645511 : PMC : PMC182788 Abstract >>
An insertion in the lactococcal plasmid pGBK17, which inactivated the gene(s) encoding resistance to the prolate-headed phage c2, was cloned, sequenced, and identified as a new lactococcal insertion sequence (IS). IS981 was 1,222 bp in size and contained two open reading frames, one large enough to encode a transposase. IS981 ended in imperfect inverted repeats of 26 of 40 bp and generated a 5-bp direct repeat of target DNA at the site of insertion. IS981 was present on the chromosome of Lactococcus lactis subsp. lactis LM0230 from where it transposed to pGBK17 during transformation. Twenty-three strains of lactococci examined for the presence of IS981 by Southern hybridization showed 4 to 26 copies per genome, with L. lactis subsp. cremoris strains containing the highest number of copies. Comparison of the DNA sequence and the amino acid sequence of the long open reading frame to other known sequences showed that IS981 is related to a family of IS elements that includes IS2, IS3, IS51, IS150, IS600, IS629, IS861, IS904, and ISL1.
|
62. |
Gautier M,
Chopin MC,
( 1987 ) Plasmid-Determined Systems for Restriction and Modification Activity and Abortive Infection in Streptococcus cremoris. PMID : 16347351 : PMC : PMC203787 Abstract >>
Streptococcus cremoris strain IL964 possessed a restriction and modification (R/M) activity which resulted in a bacteriophage efficiency of plating of 5 x 10. Phage sensitivity of protoplast-induced plasmid-cured derivatives indicated that two plasmids called pIL103 (5.7 kilobases) and pIL107 (15.2 kilobases) were each coding for one R/M system. Plasmid pIL103-encoded R/M was ascertained by transfer into the plasmid-free, R/M strain IL1403 of S. lactis, using protoplast cotransformation. This procedure failed for pIL107 because of some degree of incompatibility between pIL107 and the indicator plasmid pHV1301 used in cotransformation experiments. We also observed that plasmid pIL105 (8.7 kilobases) which showed no incidence on phage sensitivity in the parental strain IL964, mediated abortive infection in strain IL1403. In 97% of the infected cells, the phage infection was abortive, while in the remaining 3% phages were produced with a decreased burst size (50 instead of 180).
|
63. |
Siezen RJ,
Renckens B,
van Swam I,
Peters S,
van Kranenburg R,
Kleerebezem M,
de Vos WM,
( 2005 ) Complete sequences of four plasmids of Lactococcus lactis subsp. cremoris SK11 reveal extensive adaptation to the dairy environment. PMID : 16332824 : DOI : 10.1128/AEM.71.12.8371-8382.2005 PMC : PMC1317451 Abstract >>
Lactococcus lactis strains are known to carry plasmids encoding industrially important traits. L. lactis subsp. cremoris SK11 is widely used by the dairy industry in cheese making. Its complete plasmid complement was sequenced and found to contain the plasmids pSK11A (10,372 bp), pSK11B (13,332 bp), pSK11L (47,165 bp), and pSK11P (75,814 bp). Six highly homologous repB-containing replicons were found, all belonging to the family of lactococcal theta-type replicons. Twenty-three complete insertion sequence elements segment the plasmids into numerous modules, many of which can be identified as functional units or containing functionally related genes. Plasmid-encoded functions previously known to reside on L. lactis SK11 plasmids were now mapped in detail, e.g., lactose utilization (lacR-lacABCDFEGX), the proteolytic system (prtM-prtP, pepO, pepF), and the oligopeptide permease system (oppDFBCA). Newly identified plasmid-encoded functions could facilitate the uptake of various cations, while the pabA and pabB genes could be essential for folate biosynthesis. A competitive advantage could be obtained by using the putative flavin adenine dinucleotide-dependent d-lactate dehydrogenase and oxalate:formate antiporter for enhanced ATP synthesis, while the activity of the predicted alpha-acetolactate decarboxylase may contribute to the formation of an additional electron sink. Various stress response proteins are plasmid encoded, which could enhance strain robustness. A substantial number of these "adaptation" genes have not been described before on L. lactis plasmids. Moreover, several genes were identified for the first time in L. lactis, possibly reflecting horizontal gene transfer.
|
64. |
Trotter M,
McAuliffe O,
Callanan M,
Edwards R,
Fitzgerald GF,
Coffey A,
Ross RP,
( 2006 ) Genome analysis of the obligately lytic bacteriophage 4268 of Lactococcus lactis provides insight into its adaptable nature. PMID : 16325353 : DOI : 10.1016/j.gene.2005.09.022 Abstract >>
Analysis of the complete nucleotide sequence of the lactococcal phage 4268, which is lytic for the cheese starter Lactococcus lactis DPC4268, is presented. Phage 4268 has a linear genome of 36,596 bp, which is modularly organised and encompasses 49 open reading frames. Putative functions were assigned to approximately 45% of the predicted products of these open reading frames based on sequence similarity with known proteins, N-terminal sequence analysis and identification of conserved domains. Significantly, a segment of the genome has homology to the recently sequenced lysogenic module in lactococcal phage phi31 that contains a lytic switch but no phage integrase or attachment site. This suggests that it is derived from a prophage. A phage 4268-encoded and a host-encoded methylase were found to be highly similar, having only two nucleotide mismatches, suggesting that the phage acquired the methylase gene to protect it from a host endonuclease. Comparative genomic analysis revealed significant homology between phage 4268 and the lactococcal phage BK5-T. The comparative analysis also supported the classification of phage 4268 and other BK5-T-related phage as separate from the proposed P335 species of lactococcal phage.
|
65. |
Law J,
Vos P,
Hayes F,
Daly C,
de Vos WM,
Fitzgerald G,
( 1992 ) Cloning and partial sequencing of the proteinase gene complex from Lactococcus lactis subsp. lactis UC317. PMID : 1588305 : DOI : 10.1099/00221287-138-4-709 Abstract >>
The proteinase genes from Lactococcus lactis subsp. lactis UC317 were identified on a plasmid, pCI310, which is a deletion derivative of a cointegrate between pCI301, the 75 kb Lac Prt plasmid from UC317 and the 38.5 kb cryptic plasmid from that strain. The prt genes were cloned using a replacement cloning strategy whereby fragments from pCI310 were exchanged with the equivalent fragments in pNZ521, which contains the cloned proteinase genes from L. lactis subsp. lactis SK112. This generated two plasmids which encoded a cell-envelope-associated and a secreted proteinase, respectively. Specific regions of the UC317 structural prtP gene known to encode seven of the amino acids essential for substrate cleavage specificity were sequenced and compared with the known sequences of prt genes from L. lactis strains SK112, Wg2 and NCDO763. In spite of various differences that were detected in the nucleotide sequence of this region, it appears that these seven amino acids in strains UC317 and NCDO763 are identical, and represent a combination of three of the amino acids from SK112 and four from Wg2. These results indicate that the UC317 proteinase is a natural hybrid of the SK112 and Wg2 proteinases.
|
66. |
Madsen SM,
Hindré T,
Le Pennec JP,
Israelsen H,
Dufour A,
( 2005 ) Two acid-inducible promoters from Lactococcus lactis require the cis-acting ACiD-box and the transcription regulator RcfB. PMID : 15819628 : DOI : 10.1111/j.1365-2958.2005.04572.x Abstract >>
We previously characterized three Lactococcus lactis promoters, P170, P1 and P3, which are induced by low pH. Here, we identified a novel 14 bp regulatory DNA region centred at around -41.5 and composed of three tetranucleotide sequences, boxes A, C and D. Boxes A and C contribute to P1 activity, whereas box D and the position of boxes ACD (renamed ACiD-box) are essential to P1 activity and acid response. We also identified a trans -acting protein, RcfB, which is involved in P170 and P1 basal activity and is essential for their pH induction. The regulator belongs to the Crp-Fnr family of transcription regulators. Overexpression of rcfB resulted in increased beta-galactosidase activities and lantibiotic lacticin 481 production from P170- and P1-controlled genes, respectively, in acid condition. RcfB is thus probably activated when cells encounter an acid environment. rcfB is co-transcribed with genes encoding an universal stress-like protein and a multidrug transporter. RcfB plays a role in acid adaptation, as the survival rate of an rcfB mutant after a lethal acid challenge was 130-fold lower than that of the wild-type strain, when the bacteria were first grown in acidic medium. The groESL promoter includes a sequence resembling an ACiD-box and the chaperone GroEL production is partly RcfB dependent in acid condition. Our results suggest that the ACiD-box could be the DNA target site of RcfB.
|
67. |
Stoddard GW,
Petzel JP,
van Belkum MJ,
Kok J,
McKay LL,
( 1992 ) Molecular analyses of the lactococcin A gene cluster from Lactococcus lactis subsp. lactis biovar diacetylactis WM4. PMID : 1622271 : PMC : PMC195709 Abstract >>
The genes responsible for bacteriocin production and immunity in Lactococcus lactis subsp. lactis biovar diacetylactis WM4 were localized and characterized by DNA restriction fragment deletion, subcloning, and nucleotide sequence analysis. The nucleotide sequence of a 5.6-kb AvaII restriction fragment revealed a cluster with five complete open reading frames (ORFs) in the same orientation. DNA and protein homology analyses, combined with deletion and Tn5 insertion mutagenesis, implicated four of the ORFs in the production of and immunity to lactococcin A. The last two ORFs in the cluster were the lactococcin A structural and immunity genes, lcnA and lciA. The two ORFs immediately upstream of lcnA and lciA were designated lcnC and lcnD, and the proteins that they encoded showed similarities to proteins of signal sequence-independent secretion systems. lcnC encodes a protein of 716 amino acids that could belong to the HlyB family of ATP-dependent membrane translocators. LcnC contains an ATP binding domain in a conserved C-terminal stretch of approximately 200 amino acids and three putative hydrophobic segments in the N terminus. The lcnD product, LcnD, of 474 amino acids, is essential for lactococcin A expression and shows structural similarities to HlyD and its homologs. On the basis of these results, a secretion apparatus that is essential for the full expression of active lactococcin A is postulated.
|
68. |
Dabour N,
LaPointe G,
( 2005 ) Identification and molecular characterization of the chromosomal exopolysaccharide biosynthesis gene cluster from Lactococcus lactis subsp. cremoris SMQ-461. PMID : 16269783 : DOI : 10.1128/AEM.71.11.7414-7425.2005 PMC : PMC1287649 Abstract >>
The exopolysaccharide (EPS) capsule-forming strain SMQ-461 of Lactococcus lactis subsp. cremoris, isolated from raw milk, produces EPS with an apparent molecular mass of >1.6 x 10(6) Da. The EPS biosynthetic genes are located on the chromosome in a 13.2-kb region consisting of 15 open reading frames. This region is flanked by three IS1077-related tnp genes (L. lactis) at the 5' end and orfY, along with an IS981-related tnp gene, at the 3' end. The eps genes are organized in specific regions involved in regulation, chain length determination, biosynthesis of the repeat unit, polymerization, and export. Three (epsGIK) of the six predicted glycosyltransferase gene products showed low amino acid similarity with known glycosyltransferases. The structure of the repeat unit could thus be different from those known to date for Lactococcus. Reverse transcription-PCR analysis revealed that the eps locus is transcribed as a single mRNA. The function of the eps gene cluster was confirmed by disrupting the priming glycosyltransferase gene (epsD) in Lactococcus cremoris SMQ-461, generating non-EPS-producing reversible mutants. This is the first report of a chromosomal location for EPS genetic elements in Lactococcus cremoris, with novel glycosyltransferases not encountered before in lactic acid bacteria.
|
69. |
Tanous C,
Chambellon E,
Sepulchre AM,
Yvon M,
( 2005 ) The gene encoding the glutamate dehydrogenase in Lactococcus lactis is part of a remnant Tn3 transposon carried by a large plasmid. PMID : 15995220 : DOI : 10.1128/JB.187.14.5019-5022.2005 PMC : PMC1169520 Abstract >>
The gene responsible for the uncommon glutamate dehydrogenase (GDH) activity of Lactococcus lactis was identified and characterized. It encodes a GDH of family I that is mainly active in glutamate biosynthesis, is carried by a large plasmid, and is included, with functional cadmium resistance genes, in a remnant Tn3-like transposon.
|
70. |
Klaus SM,
Wegkamp A,
Sybesma W,
Hugenholtz J,
Gregory JF,
Hanson AD,
( 2005 ) A nudix enzyme removes pyrophosphate from dihydroneopterin triphosphate in the folate synthesis pathway of bacteria and plants. PMID : 15611104 : DOI : 10.1074/jbc.M413759200 Abstract >>
Removal of pyrophosphate from dihydroneopterin triphosphate (DHNTP) is the second step in the pterin branch of the folate synthesis pathway. There has been controversy over whether this reaction requires a specific pyrophosphohydrolase or is a metal ion-dependent chemical process. The genome of Lactococcus lactis has a multicistronic folate synthesis operon that includes an open reading frame (ylgG) specifying a putative Nudix hydrolase. Because many Nudix enzymes are pyrophosphohydrolases, YlgG was expressed in Escherichia coli and characterized. The recombinant protein showed high DHNTP pyrophosphohydrolase activity with a K(m) value of 2 microM, had no detectable activity against deoxynucleoside triphosphates or other typical Nudix hydrolase substrates, required a physiological level (approximately 1 mM) of Mg(2+), and was active as a monomer. Essentially no reaction occurred without enzyme at 1 mM Mg(2+). Inactivation of ylgG in L. lactis resulted in DHNTP accumulation and folate depletion, confirming that YlgG functions in folate biosynthesis. We therefore propose that ylgG be redesignated as folQ. The closest Arabidopsis homolog of YlgG (encoded by Nudix gene At1g68760) was expressed in E. coli and shown to have Mg(2+)-dependent DHNTP pyrophosphohydrolase activity. This protein (AtNUDT1) was reported previously to have NADH pyrophosphatase activity in the presence of 5 mM Mn(2+) (Dobrzanska, M., Szurmak, B., Wyslouch-Cieszynska, A., and Kraszewska, E. (2002) J. Biol. Chem. 277, 50482-50486). However, we found that this activity is negligible at physiological levels of Mn(2+) and that, with 1 mM Mg(2+), AtNUDT1 prefers DHNTP and (deoxy) nucleoside triphosphates.
|
71. |
Smit BA,
van Hylckama Vlieg JE,
Engels WJ,
Meijer L,
Wouters JT,
Smit G,
( 2005 ) Identification, cloning, and characterization of a Lactococcus lactis branched-chain alpha-keto acid decarboxylase involved in flavor formation. PMID : 15640202 : DOI : 10.1128/AEM.71.1.303-311.2005 PMC : PMC544199 Abstract >>
The biochemical pathway for formation of branched-chain aldehydes, which are important flavor compounds derived from proteins in fermented dairy products, consists of a protease, peptidases, a transaminase, and a branched-chain alpha-keto acid decarboxylase (KdcA). The activity of the latter enzyme has been found only in a limited number of Lactococcus lactis strains. By using a random mutagenesis approach, the gene encoding KdcA in L. lactis B1157 was identified. The gene for this enzyme is highly homologous to the gene annotated ipd, which encodes a putative indole pyruvate decarboxylase, in L. lactis IL1403. Strain IL1403 does not produce KdcA, which could be explained by a 270-nucleotide deletion at the 3' terminus of the ipd gene encoding a truncated nonfunctional decarboxylase. The kdcA gene was overexpressed in L. lactis for further characterization of the decarboxylase enzyme. Of all of the potential substrates tested, the highest activity was observed with branched-chain alpha-keto acids. Moreover, the enzyme activity was hardly affected by high salinity, and optimal activity was found at pH 6.3, indicating that the enzyme might be active under cheese ripening conditions.
|
72. |
Lamarque M,
Charbonnel P,
Aubel D,
Piard JC,
Atlan D,
Juillard V,
( 2004 ) A multifunction ABC transporter (Opt) contributes to diversity of peptide uptake specificity within the genus Lactococcus. PMID : 15375130 : DOI : 10.1128/JB.186.19.6492-6500.2004 PMC : PMC516603 Abstract >>
Growth of Lactococcus lactis in milk depends on the utilization of extracellular peptides. Up to now, oligopeptide uptake was thought to be due only to the ABC transporter Opp. Nevertheless, analysis of several Opp-deficient L. lactis strains revealed the implication of a second oligopeptide ABC transporter, the so-called Opt system. Both transporters are expressed in wild-type strains such as L. lactis SK11 and Wg2, whereas the plasmid-free strains MG1363 and IL-1403 synthesize only Opp and Opt, respectively. The Opt system displays significant differences from the lactococcal Opp system, which made Opt much more closely related to the oligopeptide transporters of streptococci than to the lactococcal Opp system: (i) genetic organization, (ii) peptide uptake specificity, and (iii) presence of two oligopeptide-binding proteins, OptS and OptA. The fact that only OptA is required for nutrition calls into question the function of the second oligopeptide binding protein (Opts). Sequence analysis of oligopeptide-binding proteins from different bacteria prompted us to propose a classification of these proteins in three distinct groups, differentiated by the presence (or not) of precisely located extensions.
|
73. |
O'Driscoll J,
Glynn F,
Cahalane O,
O'Connell-Motherway M,
Fitzgerald GF,
Van Sinderen D,
( 2004 ) Lactococcal plasmid pNP40 encodes a novel, temperature-sensitive restriction-modification system. PMID : 15345443 : DOI : 10.1128/AEM.70.9.5546-5556.2004 PMC : PMC520859 Abstract >>
A novel restriction-modification system, designated LlaJI, was identified on pNP40, a naturally occurring 65-kb plasmid from Lactococcus lactis. The system comprises four adjacent similarly oriented genes that are predicted to encode two m(5)C methylases and two restriction endonucleases. The LlaJI system, when cloned into a low-copy-number vector, was shown to confer resistance against representatives of the three most common lactococcal phage species. This phage resistance phenotype was found to be strongly temperature dependent, being most effective at 19 degrees C. A functional analysis confirmed that the predicted methylase-encoding genes, llaJIM1 and llaJIM2, were both required to mediate complete methylation, while the assumed restriction enzymes, specified by llaJIR1 and llaJIR2, were both necessary for the complete restriction phenotype. A Northern blot analysis revealed that the four LlaJI genes are part of a 6-kb operon and that the relative abundance of the LlaJI-specific mRNA in the cells does not appear to contribute to the observed temperature-sensitive profile. This was substantiated by use of a LlaJI promoter-lacZ fusion, which further revealed that the LlaJI operon appears to be subject to transcriptional regulation by an as yet unidentified element(s) encoded by pNP40.
|
74. |
Sanz Y,
Lanfermeijer FC,
Hellendoorn M,
Kok J,
Konings WN,
Poolman B,
( 2004 ) Two homologous oligopeptide binding protein genes (oppA) in Lactococcus lactis opp2 [corrected]. PMID : 15527913 : DOI : 10.1016/j.ijfoodmicro.2004.04.003 Abstract >>
In previous studies, it has been shown that inactivation of opp or even oppA abolishes the capacity of Lactococcus lactis to utilize oligopeptides. We now show that the opp operon has been duplicated in L. lactis MG1363. The nucleotide sequence of the oppA and oppC homologues (appA and appC) and most of the oppB homologue (appB) indicate that the corresponding protein sequences are 83%, 92% and 91% identical, respectively. Inactivation of appA, via homologous recombination, as well as complementation studies were carried out to determine the possible function of appA in peptide utilization. As anticipated from studies with an oppA knock-out, peptide utilization was not impaired in an appA disruption mutant. Importantly, AppA expressed from a plasmid could restore the ability of oppA deletion mutants to utilize Leu-enkephalin, albeit with a lower efficiency than OppA. The differences in the ability to utilize this pentapeptide were not due to differences in expression levels but most likely reflect a different catalytic efficiency in oligopeptide utilization when AppA is used as ligand receptor.
|
75. |
Bolotin A,
Quinquis B,
Sorokin A,
Ehrlich DS,
( 2004 ) Recent genetic transfer between Lactococcus lactis and enterobacteria. PMID : 15375152 : DOI : 10.1128/JB.186.19.6671-6677.2004 PMC : PMC516620 Abstract >>
The genome sequence of Lactococcus lactis revealed that the ycdB gene was recently exchanged between lactococci and enterobacteria. The present study of ycdB orthologs suggests that L. lactis was probably the gene donor and reveals three instances of gene transfer to enterobacteria. Analysis of ycdB gene transfer between two L. lactis subspecies, L. lactis subsp. lactis and L. lactis subsp. cremoris, indicates that the gene can be mobilized, possibly by conjugation.
|
76. |
Sulavik MC,
Tardif G,
Clewell DB,
( 1992 ) Identification of a gene, rgg, which regulates expression of glucosyltransferase and influences the Spp phenotype of Streptococcus gordonii Challis. PMID : 1534326 : DOI : 10.1128/jb.174.11.3577-3586.1992 PMC : PMC206044 Abstract >>
Streptococcus gordonii Challis was previously shown to give rise to phase variants expressing high (Spp+) or low (Spp-) levels of extracellular glucosyltransferase (GTF) activity. Here, shotgun cloning of an S. gordonii Spp+ chromosomal digest resulted in a chimeric plasmid (pAM5010) able to complement the Spp- phenotype. In addition, introduction of pAM5010 into an Spp+ strain resulted in a 10-fold increase in GTF expression. Deletion analysis of pAM5010 identified a 1.2-kb DNA segment which exhibited the same functional properties as pAM5010. Nucleotide sequence analysis of this region revealed a gene approximately 1 kb in size. The gene was designated rgg. Disruption of the chromosomal rgg gene open reading frame in an Spp+ strain resulted in strain DS512, which displayed an Spp(-)-like phenotype and had 3% of wild-type GTF activity. A plasmid containing the rgg gene was able to complement the DS512 phenotype and significantly increase GTF expression above wild-type levels. Sequence analysis and other data showed that the S. gordonii GTF determinant, designated gtfG, is located 66 bp downstream of the rgg gene. The sequence also revealed interesting inverted repeats which may play a role in the regulation of gtfG. We conclude that rgg positively regulates the expression of GTF and influences expression of the Spp phenotype.
|
77. |
Hill JE,
Penny SL,
Crowell KG,
Goh SH,
Hemmingsen SM,
( 2004 ) cpnDB: a chaperonin sequence database. PMID : 15289485 : DOI : 10.1101/gr.2649204 PMC : PMC509277 Abstract >>
Type I chaperonins are molecular chaperones present in virtually all bacteria, some archaea and the plastids and mitochondria of eukaryotes. Sequences of cpn60 genes, encoding 60-kDa chaperonin protein subunits (CPN60, also known as GroEL or HSP60), are useful for phylogenetic studies and as targets for detection and identification of organisms. Conveniently, a 549-567-bp segment of the cpn60 coding region can be amplified with universal PCR primers. Here, we introduce cpnDB, a curated collection of cpn60 sequence data collected from public databases or generated by a network of collaborators exploiting the cpn60 target in clinical, phylogenetic, and microbial ecology studies. The growing database currently contains approximately 2000 records covering over 240 genera of bacteria, eukaryotes, and archaea. The database also contains over 60 sequences for the archaeal Type II chaperonin (thermosome, a homolog of eukaryotic cytoplasmic chaperonin) from 19 archaeal genera. As the largest curated collection of sequences available for a protein-encoding gene, cpnDB provides a resource for researchers interested in exploiting the power of cpn60 as a diagnostic or as a target for phylogenetic or microbial ecology studies, as well as those interested in broader subjects such as lateral gene transfer and codon usage. We built cpnDB from open source tools and it is available at http://cpndb.cbr.nrc.ca.
|
78. |
Huard C,
Miranda G,
Redko Y,
Wessner F,
Foster SJ,
Chapot-Chartier MP,
( 2004 ) Analysis of the peptidoglycan hydrolase complement of Lactococcus lactis: identification of a third N-acetylglucosaminidase, AcmC. PMID : 15184148 : DOI : 10.1128/AEM.70.6.3493-3499.2004 PMC : PMC427759 Abstract >>
The peptidoglycan hydrolase (PGH) complement of Lactococcus lactis was identified by amino acid sequence similarity searching of the L. lactis IL-1403 complete genome sequence. Five PGHs that are not encoded by prophages were detected, including the previously characterized AcmA and AcmB proteins. Four of these PGHs, AcmA to AcmD, contain a catalytic domain homologous to that of enterococcal muramidase, but they have different domain structures. The fifth one (YjgB) has sequence similarity with the active-site domain of peptidoglycan-specific endopeptidases. The three new PGH-encoding genes identified in this study are all actively transcribed in L. lactis subsp. cremoris MG1363. The relative abundance of their transcripts varied during growth and was maximal during the early exponential growth phase. The three encoded proteins have peptidoglycan-hydrolyzing activities which are detected only at acidic pHs by zymography. Like AcmA and AcmB, AcmC has N-acetylglucosaminidase activity rather than the N-acetylmuramidase activity predicted by sequence similarity.
|
79. |
Engelke G,
Gutowski-Eckel Z,
Hammelmann M,
Entian KD,
( 1992 ) Biosynthesis of the lantibiotic nisin: genomic organization and membrane localization of the NisB protein. PMID : 1482192 : PMC : PMC183167 Abstract >>
Nisin produced by Lactococcus lactis 6F3 is used as a food preservative and is the most important member of a group of peptide-antibiotics containing lanthionine bridges (lantibiotics) (N. Schnell, K.-D. Entian, U. Schneider, F. G?tz, H. Z?hner, R. Kellner, and G. Jung, Nature [London] 333:276-278, 1988). Nisin is ribosomally synthesized, and its structural gene, nisA, encodes a prepeptide that is posttranslationally modified, revealing the active lantibiotic (C. Kaletta and K.-D. Entian, J. Bacteriol. 171:1597-1601, 1989). Adjacent to nisA, the additional genes nisB, nisT, and nisC were identified. Over their entire sequences, these genes were homologous to genes recently identified as important for the biosynthesis of lantibiotics, that is, subtilin from Bacillus subtilis ATCC 6633 and epidermin from Staphylococcus epidermidis T? 3298. Genes nisB, nisT, and nisC corresponded to open reading frames of 993, 600, and 418 amino acid residues, respectively. The nisT open reading frame is homologous to proteins of the HlyB (hemolysin B protein of Escherichia coli) subfamily. Proteins of this subfamily are responsible for the secretion of a variety of compounds, including large polypeptides, polysaccharides, and anti-drug tumors, indicating that NisT may be involved in nisin transport. Northern (RNA) blot analysis revealed a 0.3-kb transcript for the nisA structural gene, and the transcriptional start point of the nisA gene was determined by primer extension. Additionally, a mRNA of at least 3 kb was identified by using a hybridization probe specific to nisB. Antibodies were raised against the NisB protein, and Western blot (immunoblot) analysis revealed a molecular weight of about 115 kDa, which is in accordance with the theoretical protein size of 117.5 kDa as calculated from the nisB open reading frame. Several amphipathic transmembrane alpha-helices indicated that NisB is associated with the membrane. This was confirmed by preparing L. lactis vesicles. The NisB protein was tightly associated with the vesicle fraction and was released by sodium dodecyl sulfate treatment only. These results suggest that NisB is membrane associated and that nisin biosynthesis occurs at the cell membrane.
|
80. |
Thompson J,
Donkersloot JA,
( 1992 ) N-(carboxyalkyl)amino acids: occurrence, synthesis, and functions. PMID : 1497319 : DOI : 10.1146/annurev.bi.61.070192.002505 Abstract >>
N/A
|
81. |
Gueneau de Novoa P,
Williams KP,
( 2004 ) The tmRNA website: reductive evolution of tmRNA in plastids and other endosymbionts. PMID : 14681369 : DOI : 10.1093/nar/gkh102 PMC : PMC308836 Abstract >>
tmRNA combines tRNA- and mRNA-like properties and ameliorates problems arising from stalled ribosomes. Research on the mechanism, structure and biology of tmRNA is served by the tmRNA website (http://www.indiana.edu/~ tmrna), a collection of sequences, alignments, secondary structures and other information. Because many of these sequences are not in GenBank, a BLAST server has been added; another new feature is an abbreviated alignment for the tRNA-like domain only. Many tmRNA sequences from plastids have been added, five found in public sequence data and another 10 generated by direct sequencing; detection in early-branching members of the green plastid lineage brings coverage to all three primary plastid lineages. The new sequences include the shortest known tmRNA sequence. While bacterial tmRNAs usually have a lone pseudoknot upstream of the mRNA segment and a string of three or four pseudoknots downstream, plastid tmRNAs collectively show loss of pseudoknots at both postions. The pseudoknot-string region is also too short to contain the usual pseudoknot number in another new entry, the tmRNA sequence from a bacterial endosymbiont of insect cells, Tremblaya princeps. Pseudoknots may optimize tmRNA function in free-living bacteria, yet become dispensible when the endosymbiotic lifestyle relaxes selective pressure for fast growth.
|
82. |
Cobbe N,
Heck MM,
( 2004 ) The evolution of SMC proteins: phylogenetic analysis and structural implications. PMID : 14660695 : DOI : 10.1093/molbev/msh023 Abstract >>
The SMC proteins are found in nearly all living organisms examined, where they play crucial roles in mitotic chromosome dynamics, regulation of gene expression, and DNA repair. We have explored the phylogenetic relationships of SMC proteins from prokaryotes and eukaryotes, as well as their relationship to similar ABC ATPases, using maximum-likelihood analyses. We have also investigated the coevolution of different domains of eukaryotic SMC proteins and attempted to account for the evolutionary patterns we have observed in terms of available structural data. Based on our analyses, we propose that each of the six eukaryotic SMC subfamilies originated through a series of ancient gene duplication events, with the condensins evolving more rapidly than the cohesins. In addition, we show that the SMC5 and SMC6 subfamily members have evolved comparatively rapidly and suggest that these proteins may perform redundant functions in higher eukaryotes. Finally, we propose a possible structure for the SMC5/SMC6 heterodimer based on patterns of coevolution.
|
83. |
Smigielski AJ,
( 1990 ) Characterization of a plasmid involved with cointegrate formation and lactose metabolism in Lactococcus lactis subsp. lactis OZS1. PMID : 2177590 : DOI : 10.1007/bf00248837 Abstract >>
A 55 kilobase (kb) plasmid (pOZS550) in the non-clumping Lactococcus lactis subsp. lactis strain OZS1 carrying genes for lactose metabolism was characterised. A mobilizable cointegrate plasmid which is formed between pOZS550 and pOZS448 carries the necessary information for conjugation and transfer. Cointegrate formation was found to involve an insertional element located on pOZS550. The insertion sequence was found to be identical to ISS1 located on pSK08 in the clumping L. lactis subsp. lactis strain ML3. Restriction maps of pOZS550 and pSK08 were similar suggesting a close ancestral relationship, although pSK08, in addition to the lactose metabolism genes, expressed genes for proteinase activity and cell clumping, which were not expressed by pOZS550, and carried two copies of ISS1 compared to one on pOZS550. Furthermore, hybridization of the 18 base pair inverted repeat, of the insertion sequence, with various L. lactis subsp. lactis strains and two L. lactis subsp. cremoris strains showed moderate to strong hybridization to one plasmid in each organism.
|
84. |
de Vos WM,
Boerrigter I,
van Rooyen RJ,
Reiche B,
Hengstenberg W,
( 1990 ) Characterization of the lactose-specific enzymes of the phosphotransferase system in Lactococcus lactis. PMID : 2125052 : Abstract >>
The plasmid-encoded lactose genes of the Lactococcus lactis phosphotransferase system encoding Enzyme IIIlac (lacF) and Enzyme IIlac (lacE) have been identified and cloned in Escherichia coli and L. lactis. Nucleotide sequence and transcription analysis showed that these genes are organized into a lactose-inducible operon with the gene order lacF-lacE-lacG-lacX, the latter two genes encoding phospho-beta-galactosidase and a 34-kDa protein with an unknown function, respectively. The lac-operon is immediately followed by an IS element that is homologous to ISS1. Enzyme IIIlac was purified from L. lactis and determination of its NH2-terminal sequence demonstrated that the lacF gene starts with a TTG codon and encodes a 105 amino acid protein (Mr = 11416). Cross-linking studies with the purified enzyme showed that Enzyme IIIlac is active as a trimer. A mutant lacF gene was identified in strain YP2-5 and appeared to encode Enzyme IIIlac containing the missense mutation G18E. The lacF gene could be expressed under control of vector-located promoter sequences resulting in overproduction of Enzyme IIIlac in E. coli and complementation of the L. lactis lacF mutant YP2-5. The deduced amino acid sequence of Enzyme IIlac consists of 586 amino acids (Mr = 61562) and shows the characteristics of a hydrophobic, integral membrane protein. The deduced primary structures of the L. lactis Enzyme IIIlac and Enzyme IIlac are homologous to those of Staphylococcus aureus (72 and 71% identity, respectively) and Lactobacillus casei (48 and 47% identity, respectively). In contrast, the organization of the lactose genes differs significantly between those Gram-positive bacteria. Heterogramic homology in specific domains was observed between the derived amino acid sequences of the lactose-specific enzymes and that of E. coli Enzyme IIIcel and Enzyme IIcel, which suggest a common function in the transport and phosphorylation of these structurally related beta-glucosides.
|
85. |
Li R,
Takala TM,
Qiao M,
Xu H,
Saris PE,
( 2011 ) Nisin-selectable food-grade secretion vector for Lactococcus lactis. PMID : 21184135 : DOI : 10.1007/s10529-010-0503-6 Abstract >>
A nisin-resistant Lactococcus lactis strain TML01 was isolated from crude milk. A gene with 99% homology to the nisin-resistance gene, nsr, was identified. The food-grade secretion plasmid, pLEB690 (3746 bp), was constructed based on this novel nsr gene enabling primary selection with up to 5 �gg nisin/ml. The functionality of pLEB690 as a secretion vector was shown by expressing and secreting the pediocin AcH gene papA in L. lactis. pLEB690 is therefore, a functional food-grade secretion vector potentially useful for the food industry.
|
86. |
Dodd HM,
Horn N,
Gasson MJ,
( 1990 ) Analysis of the genetic determinant for production of the peptide antibiotic nisin. PMID : 2118169 : DOI : 10.1099/00221287-136-3-555 Abstract >>
The structural gene for the precursor of the peptide antibiotic nisin was isolated and characterized. As with other lanthionine-containing antibiotics, nisin is synthesized as a pre-propeptide which undergoes post-translational modification to generate the mature antibiotic. The sequence data obtained agreed with those of precursor nisin genes isolated by other workers from different Lactococcus lactis strains. Analysis of regions flanking the precursor nisin gene revealed the presence of a downstream open reading frame that may be involved in maturation of the precursor molecule. Nucleotide sequences characteristic of an IS element were located upstream of the nisin determinant. This element, termed IS904, is present in multiple copies in the genome of L. lactis. The nisin determinant of L. lactis is a component of a large transmissible gene block that also encodes nisin resistance and sucrose-metabolizing genes. Gene probe experiments indicated that the nisin/sucrose gene block was located in the chromosome. Furthermore, the copy of IS904 identified adjacent to the precursor nisin gene lies at, or very close to, one end of this transmissible DNA segment and may play a role in mediating its transfer between strains.
|
87. |
Pérez T,
Balcázar JL,
Peix A,
Valverde A,
Velázquez E,
de Blas I,
Ruiz-Zarzuela I,
( 2011 ) Lactococcus lactis subsp. tructae subsp. nov. isolated from the intestinal mucus of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss). PMID : 20833888 : DOI : 10.1099/ijs.0.023945-0 Abstract >>
The species Lactococcus lactis currently includes three subspecies; L. lactis subsp. lactis and L. lactis subsp. cremoris, isolated from milk sources, and L. lactis subsp. hordniae, isolated from the leafhopper Hordnia circellata. In this study, three strains, designated L105(T), I3 and L101, were isolated from the intestinal mucus of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss). These strains were closely related to members of the species Lactococcus lactis. Strain L105(T) showed 99.4 % 16S rRNA gene sequence similarity to that of the type strains L. lactis subsp. lactis NCDO 604(T) and L. lactis subsp. hordniae NCDO 2181(T) and showed 99.9 % similarity to the type strain Lactococcus lactis subsp. cremoris NCDO 607(T). Analysis of two housekeeping genes, rpoB and recA, confirmed the close relationship between the novel strains and L. lactis subsp. cremoris with similarities of 99.3 and 99.7 %, respectively. The three strains could, however, be differentiated from their closest relatives on the basis of several phenotypic characteristics, as was the case for L. lactis subsp. lactis and L. lactis subsp. hordniae, which were also closely related on the basis of 16S rRNA, rpoB and recA gene sequence similarities. The strains isolated in this study represent a new subspecies, for which the name Lactococcus lactis subsp. tructae subsp. nov. is proposed. The type strain is L105(T) (= LMG 24662(T) = DSM 21502(T)).
|
88. |
Coffey AG,
Fitzgerald GF,
Daly C,
( 1991 ) Cloning and characterization of the determinant for abortive infection of bacteriophage from lactococcal plasmid pCI829. PMID : 1919509 : DOI : 10.1099/00221287-137-6-1355 Abstract >>
The genetic determinant for abortive infection of bacteriophage (Abi) from the lactococcal plasmid pCI829 was cloned on a 6.2 kb StuI fragment in Escherichia coli using the shuttle vector pSA3. In Lactococcus lactis subsp. lactis MG1363Sm the resulting recombinant plasmid pCI816 conferred complete insensitivity to the small isometric-headed phage 712 and a reduced plaque size in the case of the prolate-headed phage c2. The determinant was further localized by subcloning and nuclease Bal31 deletion analysis; approximately 2.0 kb of DNA was essential for the expression of the Abi+ phenotype. Nucleotide sequence analysis of this region revealed a putative open reading frame of 1887 base pairs preceded by a putative promotor sequence and ribosome-binding site which exhibited similarity to consensus E. coli and Bacillus subtilis transcription/translation signals. Hybridization experiments indicated that this region was not homologous to the abi determinant from the phenotypically similar lactococcal plasmid pCI750.
|
89. |
Sun Z,
Zhong J,
Liang X,
Liu J,
Chen X,
Huan L,
( 2009 ) Novel mechanism for nisin resistance via proteolytic degradation of nisin by the nisin resistance protein NSR. PMID : 19273681 : DOI : 10.1128/AAC.01382-08 PMC : PMC2681560 Abstract >>
Nisin is a 34-residue antibacterial peptide produced by Lactococcus lactis that is active against a wide range of gram-positive bacteria. In non-nisin-producing L. lactis, nisin resistance could be conferred by a specific nisin resistance gene (nsr), which encodes a 35-kDa nisin resistance protein (NSR). However, the mechanism underlying NSR-mediated nisin resistance is poorly understood. Here we demonstrated that the protein without the predicted N-terminal signal peptide sequence, i.e., NSRSD, could proteolytically inactivate nisin in vitro by removing six amino acids from the carboxyl "tail" of nisin. The truncated nisin (nisin(1-28)) displayed a markedly reduced affinity for the cell membrane and showed significantly diminished pore-forming potency in the membrane. A 100-fold reduction of bactericidal activity was detected for nisin(1-28) in comparison to that for the intact nisin. In vivo analysis indicated that NSR localized on the cell membrane and endowed host strains with nisin resistance by degrading nisin as NSRSD did in vitro, whereas NSRSD failed to confer resistance upon the host strain. In conclusion, we showed that NSR is a nisin-degrading protease. This NSR-mediated proteolytic cleavage represents a novel mechanism for nisin resistance in non-nisin-producing L. lactis.
|
90. |
Sibakov M,
Koivula T,
von Wright A,
Palva I,
( 1991 ) Secretion of TEM beta-lactamase with signal sequences isolated from the chromosome of Lactococcus lactis subsp. lactis. PMID : 1901704 : PMC : PMC182716 Abstract >>
With TEM beta-lactamase as a reporter gene, a set of expression-secretion-promoting fragments were isolated from the chromosome of Lactococcus lactis subsp. lactis. The fact that only translocated beta-lactamase renders cells resistant to ampicillin allowed direct ampicillin selection with an Escherichia coli vector (pKTH33). The clones showing the greatest ampicillin resistance were subcloned onto a replicon capable of replication in lactic acid bacteria (pVS2), and the nucleotide sequences of the relevant fragments were determined. The structure of the secretion-promoting fragments in general resembled that of gram-positive true signal sequences, with a strongly positively charged N terminus, a long hydrophobic core, and a putative signal peptidase recognition site. The promoterlike sequences preceding the signal sequences matched well with those of previously published lactococcal promoters. In addition to E. coli, the functioning of these expression-secretion cassettes was studied in three gram-positive hosts: Bacillus subtilis, L. lactis, and Lactobacillus plantarum. Efficient expression and secretion of TEM beta-lactamase into the culture medium of each gram-positive host was obtained. Furthermore, when a strain of L. lactis subsp. lactis showing increased sensitivity to lysozyme was compared with a standard laboratory strain, threefold-higher secreted enzyme activities were detected.
|
91. |
Hill C,
Miller LA,
Klaenhammer TR,
( 1991 ) In vivo genetic exchange of a functional domain from a type II A methylase between lactococcal plasmid pTR2030 and a virulent bacteriophage. PMID : 1906061 : DOI : 10.1128/jb.173.14.4363-4370.1991 PMC : PMC208097 Abstract >>
The conjugative plasmid pTR2030 confers bacteriophage resistance to lactococci by two independent mechanisms, an abortive infection mechanism (Hsp+) and a restriction and modification system (R+/M+). pTR2030 transconjugants of lactococcal strains are used in the dairy industry to prolong the usefulness of mesophilic starter cultures. One bacteriophage which has emerged against a pTR2030 transconjugant is not susceptible to either of the two defense systems encoded by the plasmid. Phage nck202.50 (phi 50) is completely resistant to restriction by pTR2030. A region of homology between pTR2030 and phi 50 was subcloned, physically mapped, and sequenced. A region of 1,273 bp was identical in both plasmid and phage, suggesting that the fragment had recently been transferred between the two genomes. Sequence analysis confirmed that the transferred region encoded greater than 55% of the amino domain of the structural gene for a type II methylase designated LlaI. The LlaI gene is 1,869 bp in length and shows organizational similarities to the type II A methylase FokI. In addition to the amino domain, upstream sequences, possibly containing the expression signals, were present on the phage genome. The phage phi 50 fragment containing the methylase amino domain, designated LlaPI, when cloned onto the shuttle vector pSA3 was capable of modifying another phage genome in trans. This is the first report of the genetic exchange between a bacterium and a phage which confers a selective advantage on the phage. Definition of the LlaI system on pTR2030 provides the first evidence that type II systems contribute to restriction and modification phenotypes during host-dependent replication of phages in lactococci.
|
92. |
Xu FF,
Pearce LE,
Yu PL,
( 1991 ) Genetic analysis of a lactococcal plasmid replicon. PMID : 1904536 : DOI : 10.1007/bf00260703 Abstract >>
The sequence and genetic organization was determined of the 2508 bp lactococcal portion of pFX2, which was derived from a cryptic Lactococcus lactis subsp. lactis plasmid and used as the basis for construction of a series of lactococcal vectors. A lactococcal plasmid plus origin and two replication protein-coding regions (repA and repB) were located. RepA has a helix-turn-helix motif, a geometry typical of DNA-binding proteins. RepB shows a high degree of homology to the plasmid replication initiation proteins from other gram-positive bacteria and Mycoplasma. The transcribed inverted repeat sequence between repA and repB could form an attenuator to regulate pFX2 replication. Up-stream of the ori site, and in a region which was non-essential for replication, a 215 bp sequence identical to the staphylococcal plasmid pE194 and carrying the RSA site was identified. The genetic organization of this lactococcal plasmid replicon shares significant similarity with pE194 group plasmids.
|
93. |
Leenhouts KJ,
Tolner B,
Bron S,
Kok J,
Venema G,
Seegers JF,
( 1991 ) Nucleotide sequence and characterization of the broad-host-range lactococcal plasmid pWVO1. PMID : 1840693 : Abstract >>
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for replication. The ORF C product was assumed to play a regulatory role in replication. Both RepA and the ORF C product showed substantial sequence similarity with the Rep proteins of the streptococcal plasmid pLS1. In addition, the plus origin of replication was identified on the basis of strong similarity with the plus origin of pLS1. Derivatives of pWVO1 produced single-stranded (ss) DNA in Bacillus subtilis and L. lactis, suggesting that this plasmid uses the rolling-circle mode of replication. In B. subtilis, but not in L. lactis, the addition of rifampicin resulted in increased levels of ssDNA, indicating that in the former organism the host-encoded RNA polymerase is involved in the conversion of the ssDNA to double-stranded plasmid DNA (dsDNA). Apparently, in L. lactis the conversion of ss to ds pWVO1 DNA occurs by a mechanism which does not require the host RNA polymerase.
|
94. |
de Kwaadsteniet M,
Ten Doeschate K,
Dicks LM,
( 2008 ) Characterization of the structural gene encoding nisin F, a new lantibiotic produced by a Lactococcus lactis subsp. lactis isolate from freshwater catfish (Clarias gariepinus). PMID : 18039827 : DOI : 10.1128/AEM.01862-07 PMC : PMC2223265 Abstract >>
Lactococcus lactis F10, isolated from freshwater catfish, produces a bacteriocin (BacF) active against Staphylococcus aureus, Staphylococcus carnosus, Lactobacillus curvatus, Lactobacillus plantarum, and Lactobacillus reuteri. The operon encoding BacF is located on a plasmid. Sequencing of the structural gene revealed no homology to other nisin genes. Nisin F is described.
|
95. |
Berthold CL,
Gocke D,
Wood MD,
Leeper FJ,
Pohl M,
Schneider G,
( 2007 ) Structure of the branched-chain keto acid decarboxylase (KdcA) from Lactococcus lactis provides insights into the structural basis for the chemoselective and enantioselective carboligation reaction. PMID : 18084069 : DOI : 10.1107/S0907444907050433 Abstract >>
The thiamin diphosphate (ThDP) dependent branched-chain keto acid decarboxylase (KdcA) from Lactococcus lactis catalyzes the decarboxylation of 3-methyl-2-oxobutanoic acid to 3-methylpropanal (isobutyraldehyde) and CO2. The enzyme is also able to catalyze carboligation reactions with an exceptionally broad substrate range, a feature that makes KdcA a potentially valuable biocatalyst for C-C bond formation, in particular for the enzymatic synthesis of diversely substituted 2-hydroxyketones with high enantioselectivity. The crystal structures of recombinant holo-KdcA and of a complex with an inhibitory ThDP analogue mimicking a reaction intermediate have been determined to resolutions of 1.6 and 1.8 A, respectively. KdcA shows the fold and cofactor-protein interactions typical of thiamin-dependent enzymes. In contrast to the tetrameric assembly displayed by most other ThDP-dependent decarboxylases of known structure, KdcA is a homodimer. The crystal structures provide insights into the structural basis of substrate selectivity and stereoselectivity of the enzyme and thus are suitable as a framework for the redesign of the substrate profile in carboligation reactions.
|
96. |
Yang SI,
Tanaka T,
( 2008 ) Characterization of recombinant prolidase from Lactococcus lactis- changes in substrate specificity by metal cations, and allosteric behavior of the peptidase. PMID : 18070105 : DOI : 10.1111/j.1742-4658.2007.06197.x Abstract >>
The Lactococcus lactis NRRL B-1821 prolidase gene was cloned and overexpressed in Escherichia coli. Under suboptimum growth conditions, recombinant soluble and active prolidase was produced; in contrast, inclusion bodies were formed under conditions preferred for cell growth. Recombinant prolidase retained more than half its full activity between 30 and 60 degrees C, and was completely inactivated after 30 min at 70 degrees C. CD analysis confirmed that prolidase was inactivated at 67 degrees C. The enzyme was active under weak alkali to weak acidic conditions, and showed maximum activity at pH 7.0. Although these characteristics are similar to those for other reported prolidases, this prolidase was distinctive for two kinetic characteristics. Firstly, different substrate specificity was observed for its two preferred metal cations, zinc and manganese: Leu-Pro was preferred with zinc, whereas Arg-Pro was preferred with manganese. Secondly, the enzyme showed an allosteric response to changes in substrate concentrations, with Hill constants of 1.53 for Leu-Pro and 1.57 for Arg-Pro. Molecular modeling of this prolidase suggests that these unique characteristics may be attributed to a loop structure near the active site.
|
97. |
Kulkarni M,
Nirwan N,
van Aelst K,
Szczelkun MD,
Saikrishnan K,
( 2016 ) Structural insights into DNA sequence recognition by Type ISP restriction-modification enzymes. PMID : 26975655 : DOI : 10.1093/nar/gkw154 PMC : PMC4872093 Abstract >>
Engineering restriction enzymes with new sequence specificity has been an unaccomplished challenge, presumably because of the complexity of target recognition. Here we report detailed analyses of target recognition by Type ISP restriction-modification enzymes. We determined the structure of the Type ISP enzyme LlaGI bound to its target and compared it with the previously reported structure of a close homologue that binds to a distinct target, LlaBIII. The comparison revealed that, although the two enzymes use almost a similar set of structural elements for target recognition, the residues that read the bases vary. Change in specificity resulted not only from appropriate substitution of amino acids that contacted the bases but also from new contacts made by positionally distinct residues directly or through a water bridge. Sequence analyses of 552 Type ISP enzymes showed that the structural elements involved in target recognition of LlaGI and LlaBIII were structurally well-conserved but sequentially less-conserved. In addition, the residue positions within these structural elements were under strong evolutionary constraint, highlighting the functional importance of these regions. The comparative study helped decipher a partial consensus code for target recognition by Type ISP enzymes.
|
98. |
Acedo JZ,
van Belkum MJ,
Lohans CT,
Towle KM,
Miskolzie M,
Vederas JC,
( 2016 ) Nuclear Magnetic Resonance Solution Structures of Lacticin Q and Aureocin A53 Reveal a Structural Motif Conserved among Leaderless Bacteriocins with Broad-Spectrum Activity. PMID : 26771761 : DOI : 10.1021/acs.biochem.5b01306 Abstract >>
Lacticin Q (LnqQ) and aureocin A53 (AucA) are leaderless bacteriocins from Lactococcus lactis QU5 and Staphylococcus aureus A53, respectively. These bacteriocins are characterized by the absence of an N-terminal leader sequence and are active against a broad range of Gram-positive bacteria. LnqQ and AucA consist of 53 and 51 amino acids, respectively, and have 47% identical sequences. In this study, their three-dimensional structures were elucidated using solution nuclear magnetic resonance and were shown to consist of four �\-helices that assume a very similar compact, globular overall fold (root-mean-square deviation of 1.7 ?) with a highly cationic surface and a hydrophobic core. The structures of LnqQ and AucA resemble the shorter two-component leaderless bacteriocins, enterocins 7A and 7B, despite having low levels of sequence identity. Homology modeling revealed that the observed structural motif may be shared among leaderless bacteriocins with broad-spectrum activity against Gram-positive organisms. The elucidated structures of LnqQ and AucA also exhibit some resemblance to circular bacteriocins. Despite their similar overall fold, inhibition studies showed that LnqQ and AucA have different antimicrobial potency against the Gram-positive strains tested, suggesting that sequence disparities play a crucial role in their mechanisms of action.
|
99. |
Sequeiros C,
Garcés ME,
Vallejo M,
Marguet ER,
Olivera NL,
( 2015 ) Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae. PMID : 25549984 : DOI : 10.1007/s00203-014-1076-x Abstract >>
Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems.
|
100. |
Ishibashi N,
Seto H,
Koga S,
Zendo T,
Sonomoto K,
( 2015 ) Identification of Lactococcus-Specific Bacteriocins Produced by Lactococcal Isolates, and the Discovery of a Novel Bacteriocin, Lactococcin Z. PMID : 26093857 : DOI : 10.1007/s12602-015-9196-4 Abstract >>
Lactic acid bacteria that produce Lactococcus-specific bacteriocins were isolated and identified as Lactococcus lactis from fresh corn or lettuce. Among them, four isolates were identified as lactococcin Q producers. Seven isolates showed antimicrobial activity against a lactococcin Q producer, L. lactis QU 4, as well as against nisin Z and lacticin Q producers belonging to L. lactis. Strain QU 7 was selected as a standard strain and showed no cross-immunity to lactococcin Q or other lactococcal bacteriocins. The bacteriocin produced by strain QU 7 was purified in three chromatographic steps, and its molecular mass was determined to be 5041.35 Da. The amino acid sequence analysis revealed that it is a novel class IId bacteriocin, referred to as lactococcin Z. It consisted of 45 amino acid residues. The lczA gene encoding the prepeptide of lactococcin Z showed homology to lactococcins A, B, and M. Thus, this report demonstrates a new example of Lactococcus-specific bacteriocins.
|
101. |
Murphree CA,
Heist EP,
Moe LA,
( 2014 ) Antibiotic resistance among cultured bacterial isolates from bioethanol fermentation facilities across the United States. PMID : 24748439 : DOI : 10.1007/s00284-014-0583-y Abstract >>
Bacterial contamination of fuel ethanol fermentations by lactic acid bacteria (LAB) can have crippling effects on bioethanol production. Producers have had success controlling bacterial growth through prophylactic addition of antibiotics to fermentors, yet concerns have arisen about antibiotic resistance among the LAB. Here, we report on mechanisms used by 32 LAB isolates from eight different US bioethanol facilities to persist under conditions of antibiotic stress. Minimum inhibitory concentration assays with penicillin, erythromycin, and virginiamycin revealed broad resistance to each of the antibiotics as well as high levels of resistance to individual antibiotics. Phenotypic assays revealed that antibiotic inactivation mechanisms contributed to the high levels of individual resistances among the isolates, especially to erythromycin and virginiamycin, yet none of the isolates appeared to use a �]-lactamase. Biofilm formation was noted among the majority of the isolates and may contribute to persistence under low levels of antibiotics. Nearly all of the isolates carried at least one canonical antibiotic resistance gene and many carried more than one. The erythromycin ribosomal methyltransferase (erm) gene class was found in 19 of 32 isolates, yet a number of these isolates exhibit little to no resistance to erythromycin. The erm genes were present in 15 isolates that encoded more than one antibiotic resistance mechanism, suggestive of potential genetic linkages.
|
102. |
Healy B,
Field D,
O'Connor PM,
Hill C,
Cotter PD,
Ross RP,
( 2013 ) Intensive mutagenesis of the nisin hinge leads to the rational design of enhanced derivatives. PMID : 24244524 : DOI : 10.1371/journal.pone.0079563 PMC : PMC3823697 Abstract >>
Nisin A is the most extensively studied lantibiotic and has been used as a preservative by the food industry since 1953. This 34 amino acid peptide contains three dehydrated amino acids and five thioether rings. These rings, resulting from one lanthionine and four methyllanthionine bridges, confer the peptide with its unique structure. Nisin A has two mechanisms of action, with the N-terminal domain of the peptide inhibiting cell wall synthesis through lipid II binding and the C-terminal domain responsible for pore-formation. The focus of this study is the three amino acid 'hinge' region (N 20, M 21 and K 22) which separates these two domains and allows for conformational flexibility. As all lantibiotics are gene encoded, novel variants can be generated through manipulation of the corresponding gene. A number of derivatives in which the hinge region was altered have previously been shown to possess enhanced antimicrobial activity. Here we take this approach further by employing simultaneous, indiscriminate site-saturation mutagenesis of all three hinge residues to create a novel bank of nisin derivative producers. Screening of this bank revealed that producers of peptides with hinge regions consisting of AAK, NAI and SLS displayed enhanced bioactivity against a variety of targets. These and other results suggested a preference for small, chiral amino acids within the hinge region, leading to the design and creation of producers of peptides with hinges consisting of AAA and SAA. These producers, and the corresponding peptides, exhibited enhanced bioactivity against Lactococcus lactis HP, Streptococcus agalactiae ATCC 13813, Mycobacterium smegmatis MC2155 and Staphylococcus aureus RF122 and thus represent the first example of nisin derivatives that possess enhanced activity as a consequence of rational design.
|
103. |
Perin LM,
Nero LA,
( 2014 ) Antagonistic lactic acid bacteria isolated from goat milk and identification of a novel nisin variant Lactococcus lactis. PMID : 24521354 : DOI : 10.1186/1471-2180-14-36 PMC : PMC3930553 Abstract >>
The raw goat milk microbiota is considered a good source of novel bacteriocinogenic lactic acid bacteria (LAB) strains that can be exploited as an alternative for use as biopreservatives in foods. The constant demand for such alternative tools justifies studies that investigate the antimicrobial potential of such strains. The obtained data identified a predominance of Lactococcus and Enterococcus strains in raw goat milk microbiota with antimicrobial activity against Listeria monocytogenes ATCC 7644. Enzymatic assays confirmed the bacteriocinogenic nature of the antimicrobial substances produced by the isolated strains, and PCR reactions detected a variety of bacteriocin-related genes in their genomes. Rep-PCR identified broad genetic variability among the Enterococcus isolates, and close relations between the Lactococcus strains. The sequencing of PCR products from nis-positive Lactococcus allowed the identification of a predicted nisin variant not previously described and possessing a wide inhibitory spectrum. Raw goat milk was confirmed as a good source of novel bacteriocinogenic LAB strains, having identified Lactococcus isolates possessing variations in their genomes that suggest the production of a nisin variant not yet described and with potential for use as biopreservatives in food due to its broad spectrum of action.
|
104. |
Hill C,
Miller LA,
Klaenhammer TR,
( 1990 ) Nucleotide sequence and distribution of the pTR2030 resistance determinant (hsp) which aborts bacteriophage infection in lactococci. PMID : 2389939 : PMC : PMC184594 Abstract >>
The lactococcal plasmid pTR2030 encodes resistance to bacteriophage attack via two mechanisms, an abortive-infection mechanism, designated Hsp, and a restriction and modification system. We present the complete sequence of the hsp structural gene. The gene is 1,887 base pairs in length and encodes a protein with a predicted molecular mass of 73.8 kilodaltons. The upstream region was cloned in a promoter-screening vector and shown to direct the constitutive expression of the cat-86 gene. An internal probe was used to determine the distribution of the hsp sequence in industrially significant lactococcal strains and to evaluate its relatedness to another lactococcal plasmid implicated in an abortive-infection-type mechanism, pNP40. No homology was detected, suggesting that this gene is not widely distributed in lactococci. Therefore, there are at least two independent abortive-infection genotypes in lactococci.
|
105. |
Haandrikman AJ,
van Leeuwen C,
Kok J,
Vos P,
de Vos WM,
Venema G,
( 1990 ) Insertion elements on lactococcal proteinase plasmids. PMID : 2166472 : PMC : PMC184527 Abstract >>
DNA segments of 809 and 808 nucleotides, with 18-base-pair terminal inverted repeats, are present on the proteinase plasmids pWV05 from Lactococcus lactis subsp. cremoris Wg2 and pSK111 from L. lactis subsp. cremoris SK11, respectively. These DNA segments are highly similar: 77% identical nucleotides and both contain an open reading frame that can encode a protein of 226 amino acids. Furthermore, both DNA segments are located downstream of the proteinase maturation gene prtM, but they differ individually in their orientation with respect to the prtM gene. On the basis of the striking similarity between ISS1, an 808-base-pair insertion sequence (IS) from L. lactis subsp. lactis ML3 lactose plasmid pSK08, and the DNA segments of pWV05 and pSK111, we propose that these DNA segments comprise IS elements. The IS elements from strains Wg2 and SK11 were named ISS1W and ISS1N, respectively. On pWV05, ISS1W is flanked on one side by only part of a second IS element, indicating that pWV05 evolved as a deletion derivative of a precursor plasmid that carried at least two IS elements.
|
106. |
Romero DA,
Klaenhammer TR,
( 1990 ) Characterization of insertion sequence IS946, an Iso-ISS1 element, isolated from the conjugative lactococcal plasmid pTR2030. PMID : 2165471 : DOI : 10.1128/jb.172.8.4151-4160.1990 PMC : PMC213237 Abstract >>
The self-transmissible plasmid pTR2030 mobilized nonconjugative heterologous cloning vectors pGK12 (Cmr Emr) and pSA3 (Emr) at frequencies of 10(-5) to 10(-6) per input donor. Transconjugants harbored a 51- or 58-kilobase (kb) plasmid not found in the parental strains that cotransferred at high frequency with Cmr Emr and pTR2030-encoded phage resistance (Hsp+) in second-round matings (10(-1) per input donor). Restriction endonuclease mapping and DNA-DNA hybridization identified the 51- to 58-kb plasmids as pTR2030::vector cointegrates. Examination of four cointegrates indicated that pGK12 and pSA3 had inserted within two locations on pTR2030. Resolution of the cointegrates generated vector derivatives containing a 0.8-kb insert of pTR2030 DNA. Restriction analyses of several resolution plasmids indicated that the 0.8-kb element had inserted into various positions within pGK12 and pSA3 and in certain cases had inactivated the Cmr or Emr marker of pGK12. A conjugative mobilization assay demonstrated that the 0.8-kb element, designated IS946, mediated transpositional recombination. Nucleotide sequence determination identified IS946 as an 808-base-pair (bp) insertion sequence sharing ca. 96% homology with lactococcal insertion sequence ISS1. IS946 differed by 27 and 31 bp from ISS1S and ISS1T, respectively, and in 2 of 226 amino acids in the deduced sequence of the putative transposase. IS946 has perfect 18-bp terminal inverted repeats, identical to ISS1, and similarly generated 8-bp direct repeats of the target site upon insertion.
|
107. |
Rauch PJ,
Beerthuyzen MM,
de Vos WM,
( 1990 ) Nucleotide sequence of IS904 from Lactococcus lactis subsp. lactis strain NIZO R5. PMID : 2165590 : DOI : 10.1093/nar/18.14.4253 PMC : PMC331195 Abstract >>
N/A
|
108. |
( 1997 ) Autolysis of Lactococcus lactis caused by induced overproduction of its major autolysin, AcmA. PMID : 9212419 : PMC : PMC168568 Abstract >>
The optical density of a culture of lactococcus lactis MG1363 was reduced more than 60% during prolonged stationary phase. Reduction in optical density (autolysis) was almost absent in a culture of an isogenic mutant containing a deletion in the major autolysin gene, acmA. An acmA mutant carrying multiple coples of a plasmid encoding AcmA lysed to a greater extent than the wild-type strain did. Intercellular action of AcmA was shown by mixing end-exponential-phase cultures of an acmA deletion mutant and a tripeptidase (pepT) deletion mutant. PepT, produced by the acmA mutant, was detected in the supernatant of the mixed culture, but no PepT was present in the culture supernatant of the acmA mutant. A plasmid was constructed in which acmA, lacking its own promoter, was placed downstream of the inducible promoter/operator region of the temperate lactococcal bacteriophage r1t. After mitomycin induction of an exponential-phase culture of L. lactis LL302 carrying this plasmid, the cells became subject to autolysis, resulting in the release of intracellular proteins.
|
109. |
( 1997 ) Characterization of Lactococcus lactis UV-sensitive mutants obtained by ISS1 transposition. PMID : 9226255 : DOI : 10.1128/jb.179.14.4473-4479.1997 PMC : PMC179281 Abstract >>
Studies of cellular responses to DNA-damaging agents, mostly in Escherichia coli, have revealed numerous genes and pathways involved in DNA repair. However, other species, particularly those which exist under different environmental conditions than does E. coli, may have rather different responses. Here, we identify and characterize genes involved in DNA repair in a gram-positive plant and dairy bacterium, Lactococcus lactis. Lactococcal strain MG1363 was mutagenized with transposition vector pG+host9::ISS1, and 18 mutants sensitive to mitomycin and UV were isolated at 37 degrees C. DNA sequence analyses allowed the identification of 11 loci and showed that insertions are within genes implicated in DNA metabolism (polA, hexB, and deoB), cell envelope formation (gerC and dltD), various metabolic pathways (arcD, bglA, gidA, hgrP, metB, and proA), and, for seven mutants, nonidentified open reading frames. Seven mutants were chosen for further characterization. They were shown to be UV sensitive at 30 degrees C (the optimal growth temperature of L. lactis); three (gidA, polA, and uvs-75) were affected in their capacity to mediate homologous recombination. Our results indicate that UV resistance of the lactococcal strain can be attributed in part to DNA repair but also suggest that other factors, such as cell envelope composition, may be important in mediating resistance to mutagenic stress.
|
110. |
( 1997 ) Cloning and analysis of the pepV dipeptidase gene of Lactococcus lactis MG1363. PMID : 9171382 : DOI : 10.1128/jb.179.11.3410-3415.1997 PMC : PMC179130 Abstract >>
The gene pepV, encoding a dipeptidase from Lactococcus lactis subsp. cremoris MG1363, was identified in a genomic library in pUC19 in a peptidase-deficient Escherichia coli strain and subsequently sequenced. PepV of L. lactis is enzymatically active in E. coli and hydrolyzes a broad range of dipeptides but no tri-, tetra-, or larger oligopeptides. Northern (RNA) and primer extension analyses indicate that pepV is a monocistronic transcriptional unit starting 24 bases upstream of the AUG translational start codon. The dipeptidase of L. lactis was shown to be similar to the dipeptidase encoded by pepV of L. delbrueckii subsp. lactis, with 46% identity in the deduced amino acid sequences. A PepV-negative mutant of L. lactis was constructed by single-crossover recombination. Growth of the mutant strain in milk was significantly slower than that of the wild type, but the strains ultimately reached the same final cell densities.
|
111. |
( 1997 ) Replication regions of two pairs of incompatible lactococcal theta-replicating plasmids. PMID : 9339469 : Abstract >>
Incompatibility tests were performed employing 12 replicons belonging to a family of homologous lactococcal theta-replicating plasmids. Two pairs of incompatible plasmids were found, namely, pFV1001 and pFV1201, and pJW565 and pFW094. The replicons of plasmids pFV1001, pFV1201, pJW565, pJW566, and pFW094 were sequenced. Alignments were made of the replicational origins (repA) and putative replication proteins (RepB) of these and 11 related plasmid sequences. Comparison of the alignments with the incompatibility data indicated that the incompatibility determinant could be contained within the 22-bp tandem repeats DRII and/or the inverted repeat IR1 in repA. In support, the incompatibility determinant of pJW563 was localized to a 743-bp fragment encompassing repA. A stretch of 13 amino acids of RepB was proposed to be responsible for the plasmid-specific initiation of replication. This stretch is part of a domain containing features that are highly conserved within the proposed DNA binding regions of the initiation proteins from several well-characterized plasmids from Gram-negative bacteria, including pSC101, R6K, and mini-F.
|
112. |
( 1997 ) Isolation, cloning and characterisation of the abiI gene from Lactococcus lactis subsp. lactis M138 encoding abortive phage infection. PMID : 9195753 : PMC : PMC3442939 Abstract >>
Plasmid pND852 (56 kb) encodes nisin resistance and was isolated from Lactococcus lactis ssp lactis (L. lactis) M138 by conjugation to L. lactis LM0230. It conferred strong resistance to the isometric-headed phage phi 712 and partial resistance to the prolate-headed phage phi c2. A 2.6 kb HpaII fragment encoding phage resistance was cloned into the streptococcal/Bacillus hybrid vector pGB301 to generate pND817. The mechanism of phage resistance encoded by pND817 involved abortive infection and this was illustrated by a reduction in burst size from 166 to 6 at 30 degrees C and from 160 to 90 at 37 degrees C. Partial resistance was therefore retained at 37 degrees C. DNA sequencing revealed that the abortive infection was encoded by a single open reading frame (ORF), designated abiI, encoding a 332 amino acid protein. Neither abiI nor the predicted product showed significant homology to any existing sequence in the GenBank database. Frame shift mutation at the unique EcoRI site within the ORF resulted in loss of the Abi+ phenotype, confirming that the ORF is responsible for the encoded phage resistance.
|
113. |
( 1997 ) Membrane potential-generating malate (MleP) and citrate (CitP) transporters of lactic acid bacteria are homologous proteins. Substrate specificity of the 2-hydroxycarboxylate transporter family. PMID : 9218448 : DOI : 10.1074/jbc.272.29.18140 Abstract >>
Membrane potential generation via malate/lactate exchange catalyzed by the malate carrier (MleP) of Lactococcus lactis, together with the generation of a pH gradient via decarboxylation of malate to lactate in the cytoplasm, is a typical example of a secondary proton motive force-generating system. The mleP gene was cloned, sequenced, and expressed in a malolactic fermentation-deficient L. lactis strain. Functional analysis revealed the same properties as observed in membrane vesicles of a malolactic fermentation-positive strain. MleP belongs to a family of secondary transporters in which the citrate carriers from Leuconostoc mesenteroides (CitP) and Klebsiella pneumoniae (CitS) are found also. CitP, but not CitS, is also involved in membrane potential generation via electrogenic citrate/lactate exchange. MleP, CitP, and CitS were analyzed for their substrate specificity. The 2-hydroxycarboxylate motif R1R2COHCOOH, common to the physiological substrates, was found to be essential for transport although some 2-oxocarboxylates could be transported to a lesser extent. Clear differences in substrate specificity among the transporters were observed because of different tolerances toward the R substituents at the C2 atom. Both MleP and CitP transport a broad range of 2-hydroxycarboxylates with R substituents ranging in size from two hydrogen atoms (glycolate) to acetyl and methyl groups (citromalate) for MleP and two acetyl groups (citrate) for CitP. CitS was much less tolerant and transported only citrate and at a low rate citromalate. The substrate specificities are discussed in the context of the physiological function of the transporters.
|
114. |
( 1997 ) Genetic analysis of regions involved in replication and cadmium resistance of the plasmid pND302 from Lactococcus lactis. PMID : 9339465 : DOI : 10.1006/plas.1997.1301 Abstract >>
The 8.8-kb Lactococcus lactis plasmid pND302 encodes resistance to cadmium (CdR). Regions of pND302 involved in replication and CdR were subcloned and sequenced. The replication region is localized on a 1.5-kb region and consists of an open reading frame (repB) preceded by a noncoding AT-rich sequence (ori) which is highly homologous to lactococcal theta-type replicons. The CdR determinant is localized on a 2.9-kb region and encodes putative proteins similar to the Cd(2+)-specific P-type efflux ATPase (CadA) and the transcriptional regulatory repressor (CadC) identified in Staphylococcus aureus, Bacillus firmus, and Listeria monocytogenes. Similar CdR determinants were also detected by PCR in other CdR plasmids isolated from different L. lactis strains.
|
115. |
( 1997 ) Characterization of cspB, a cold-shock-inducible gene from Lactococcus lactis, and evidence for a family of genes homologous to the Escherichia coli cspA major cold shock gene. PMID : 9287018 : DOI : 10.1128/jb.179.17.5589-5593.1997 PMC : PMC179434 Abstract >>
Upon temperature downshift, the major cold shock protein CspA is highly induced in Escherichia coli. This protein being conserved in other bacteria, we used a PCR-based approach with a pair of degenerate primers derived from highly conserved regions of the CspA-related proteins to evidence the presence of at least three related genes in Lactococcus lactis. One of them, cspB, was cloned and sequenced. It encodes a 66-residue protein which possesses 60% sequence identity with E. coli CspA. Following a cold shock from 30 to 15 degrees C, the level of the cspB mRNA transcript increased, as shown by Northern blot hybridization. In addition, induction of cspB-directed beta-galactosidase activity was observed. These results indicate that the L. lactis cspB gene is cold shock inducible.
|
116. |
( 1997 ) Cloning, expression, and characterization of the Lactococcus lactis pfl gene, encoding pyruvate formate-lyase. PMID : 9294449 : DOI : 10.1128/jb.179.18.5884-5891.1997 PMC : PMC179481 Abstract >>
The Lactococcus lactis pfl gene, encoding pyruvate formate-lyase (PFL), has been cloned and characterized. The deduced amino acid sequence of the L. lactis PFL. protein showed high similarity to those of other bacterial PFL proteins and included the conserved glycine residue involved in posttranslational activation of PFL. The genetic organization of the chromosomal pfl region in L. lactis showed differences from other characterized pfl loci, with an upstream open reading frame independently transcribed in the same orientation as the pfl gene. The gene coding for PFL-activase (act), normally found downstream of pfl, was not identified in L. lactis. Analysis of pfl expression showed a strong induction under anaerobiosis at the transcriptional level independent of the growth medium used. During growth with galactose, pfl showed the highest levels of expression. Constructed L. lactis pfl strains were unable to produce formate under anaerobic growth. Higher levels of diacetyl and acetoin were produced anaerobically in the constructed Lactococcus lactis subsp. lactis biovar diacetylactis pfl strain.
|
117. |
( 1997 ) Phenotypic and genetic characterization of the bacteriophage abortive infection mechanism AbiK from Lactococcus lactis. PMID : 9097424 : PMC : PMC168421 Abstract >>
The natural plasmid pSRQ800 isolated from Lactococcus lactis subsp. lactis W1 conferred strong phage resistance against small isometric phages of the 936 and P335 species when introduced into phage-sensitive L. lactis strains. It had very limited effect on prolate phages of the c2 species. The phage resistance mechanism encoded on pSRQ800 is a temperature-sensitive abortive infection system (Abi). Plasmid pSRQ800 was mapped, and the Abi genetic determinant was localized on a 4.5-kb EcoRI fragment. Cloning and sequencing of the 4.5-kb fragment allowed the identification of two large open reading frames. Deletion mutants showed that only orf1 was needed to produce the Abi phenotype. orf1 (renamed abiK) coded for a predicted protein of 599 amino acids (AbiK) with an estimated molecular size of 71.4 kDa and a pI of 7.98. DNA and protein sequence alignment programs found no significant homology with databases. However, a database query based on amino acid composition suggested that AbiK might be in the same protein family as AbiA. No phage DNA replication nor phage structural protein production was detected in infected AbiK+ L. lactis cells. This system is believed to act at or prior to phage DNA replication. WHen cloned into a high-copy vector, AbiK efficiency increased 100-fold. AbiK provides another powerful tool that can be useful in controlling phages during lactococcal fermentations.
|
118. |
( 1997 ) Identification of a recA homolog (recALP) on the conjugative lactococcal phage resistance plasmid pNP40: evidence of a role for chromosomally encoded recAL in abortive infection. PMID : 9097419 : PMC : PMC168416 Abstract >>
The determinants for two bacteriophage resistance mechanisms, AbiE and AbiF, are separated by approximately 3,300 nucleotides on the lactococcal plasmid pNP40 (P. Garvey, G.F. Fitzgerald, and C. Hill, Appl. Environ. Microbiol. 61:4321-4328, 1995). DNA sequence analysis of the intervening region led to the identification of two open reading frames (ORFs) which are transcribed in the opposite direction to the Abi determinants. One of these ORFs encodes a recA homolog (designated recALP). This is the first report of a recA-like determinant located to a plasmid. The second ORF (orfU) shares homology with the umuC gene of the SOS response. Analysis of a number of lactococcal strains confirmed the presence of recALP-like sequences in at least two other lactococcal strains. The proximity of the recA and umuC homologs suggested a possible role in the phase resistance encoded by the Abi determinants. However, no evidence was obtained to demonstrate a function for either ORF in the expression of either AbiE or AbiF. Nor could the recALP gene restore resistance to mitomycin in a recA-deficient lactococcal strain, VEL1122. Interestingly, it was shown that the chromosomally encoded recA is necessary for complete expression of the AbiF phenotype, confirming a role for RecA in this abortive infection system.
|
119. |
( 1997 ) Dual role of alpha-acetolactate decarboxylase in Lactococcus lactis subsp. lactis. PMID : 9335274 : DOI : 10.1128/jb.179.20.6285-6293.1997 PMC : PMC179541 Abstract >>
The alpha-acetolactate decarboxylase gene aldB is clustered with the genes for the branched-chain amino acids (BCAA) in Lactococcus lactis subsp. lactis. It can be transcribed with BCAA genes under isoleucine regulation or independently of BCAA synthesis under the control of its own promoter. The product of aldB is responsible for leucine sensibility under valine starvation. In the presence of more than 10 microM leucine, the alpha-acetolactate produced by the biosynthetic acetohydroxy acid synthase IlvBN is transformed to acetoin by AldB and, consequently, is not available for valine synthesis. AldB is also involved in acetoin formation in the 2,3-butanediol pathway, initiated by the catabolic acetolactate synthase, AlsS. The differences in the genetic organization, the expression, and the kinetics parameters of these enzymes between L. lactis and Klebsiella terrigena, Bacillus subtilis, or Leuconostoc oenos suggest that this pathway plays a different role in the metabolism in these bacteria. Thus, the alpha-acetolactate decarboxylase from L. lactis plays a dual role in the cell: (i) as key regulator of valine and leucine biosynthesis, by controlling the acetolactate flux by a shift to catabolism; and (ii) as an enzyme catalyzing the second step of the 2,3-butanediol pathway.
|
120. |
( 1995 ) Nucleotide sequence of a plasmid pCL2.1 from Lactococcus lactis ssp. lactis ML8. PMID : 8825377 : DOI : 10.1006/plas.1995.0010 Abstract >>
The nucleotide sequence of a small cryptic plasmid, pCL2.1, from Lactococcus lactis ssp. lactis ML8 was determined. Sequence analysis of the pCL2.1 revealed that it contained 2112 bp, 33.9% GC, and two open reading frames that encoded polypeptides of 26 and 14 kDa. In vitro transcription-translation of the pCL2.1 confirmed the existence of two polypeptides. Based on sequence homology, it is deduced that the ORF2 product functions in plasmid replication by a rolling circle mechanism.
|
121. |
( 1993 ) Cloning, sequence and expression of the gene encoding the malolactic enzyme from Lactococcus lactis. PMID : 8405453 : DOI : 10.1016/0014-5793(93)80488-g Abstract >>
Many lactic acid bacteria can carry out malolactic fermentation. This secondary fermentation is mediated by the NAD- and Mn(2+)-dependent malolactic enzyme, which catalyses the decarboxylation of L-malate to L-lactate. The gene we call mleS, coding for malolactic enzyme, was isolated from Lactococcus lactis. The mleS gene consists of one open reading frame capable of coding for a protein with a calculated molecular mass of 59 kDa. The amino acid sequence of the predicted MleS gene product is homologous to the sequences of different malic enzymes. Bacterial and yeast cells expressing the malolactic gene convert L-malate to L-lactate.
|
122. |
( 1996 ) Splicing of a group II intron in a functional transfer gene of Lactococcus lactis. PMID : 8843433 : DOI : 10.1046/j.1365-2958.1996.00610.x Abstract >>
A chromosomally located sex factor that controls conjugation in Lactococcus lactis 712 has been cloned and sequenced, leading to the discovery of an open reading frame with homology to the maturases of group II self-splicing introns. Reverse transcriptase polymerase chain reaction amplification was used to demonstrate that the intron was spliced out of mRNA in vivo, and sequence analysis revealed the site of splicing. The intron was inserted within a sex-factor gene which encodes a protein with homology to proteins involved in rolling-circle DNA replication. Gene-disruption experiments were used to demonstrate that this mobA gene was essential for sex-factor transfer and this suggests that intron splicing is a necessary part of the conjugation process. The sequence of the intron was modelled to produce a secondary structure that exhibited several features characteristic of the IIA subgroup. Here we report the characterization of a new group II intron in the Gram-positive bacterium L. lactis and demonstrate for the first time in bacteria both splicing in vivo and an active role for the gene carrying the intron.
|
123. |
( 1993 ) Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis. PMID : 8376328 : DOI : 10.1128/jb.175.18.5806-5813.1993 PMC : PMC206659 Abstract >>
pIP501 is a streptococcal conjugative plasmid which can be transmitted among numerous gram-positive strains. To identify a minimal mobilization (mob) locus of pIP501, DNA fragments of pIP501 were cloned into nonconjugative target plasmids and tested for mobilization by pIP501. We show that nonmobilizable plasmids containing a specific fragment of pIP501 are transmitted at high frequencies between Lactococcus lactis subsp. lactis strains if transfer (tra) functions are provided in trans by a pIP501 derivative. Independent transfer of the mobilized plasmid was observed in up to 44% of transconjugants. A 2.2-kb segment containing mob was sequenced. This DNA segment is characterized by three palindromes (palI, palII, and palIII) and a 202-amino-acid open reading frame (ORFX) of unknown function. The smallest DNA fragment conferring high frequency mobilization was localized to a 1.0-kb region (extending from pIP501 coordinates 3.60 to 4.60 on the 30.2-kb map) which contains palI (delta G = -27 kcal/mol [ca. -110,000 J/mol]). A 26-bp sequence identical to palI is present on pIP501, upstream of the plasmid copy control region. Further homologies with the palI sequence are also found with the related Enterococcus faecalis conjugative plasmid pAM beta 1. The region containing mob maps outside the previously described segment mediating pIP501 conjugation. Our results with recA strains indicate that the mob site is a hot spot for cointegrate formation.
|
124. |
( 1996 ) Cloning and sequencing of the novel abortive infection gene abiH of Lactococcus lactis ssp. lactis biovar. diacetylactis S94. PMID : 8810513 : DOI : 10.1111/j.1574-6968.1996.tb08446.x Abstract >>
A gene which encodes resistance by abortive infection (Abi+) to bacteriophage was cloned from Lactococcus lactis ssp. lactis biovar. diacetylactis S94. This gene was found to confer a reduction in efficiency of plating and plaque size for prolate-headed bacteriophage phi 53 (group I of homology) and total resistance to the small isometric-headed bacteriophage phi 59 (group III of homology). The cloned gene is predicted to encode a polypeptide of 346 amino acid residues with a deduced molecular mass of 41 455 Da. No homology with any previously described genes was found. A probe was used to determine the presence of this gene in two strains on 31 tested.
|
125. |
( 1996 ) Imbalance of leucine flux in Lactococcus lactis and its use for the isolation of diacetyl-overproducing strains. PMID : 8779600 : PMC : PMC168043 Abstract >>
Diacetyl is a by-product of pyruvate metabolism in Lactococcus lactis, where pyruvate is first converted to alpha-acetolactate, which is slowly decarboxylated to diacetyl in the presence of oxygen. L. lactis usually converts alpha-acetolactate to acetoin enzymatically, by alpha-acetolactate decarboxylase encoded by the aldB gene. We took advantage of the fact that this enzyme also has a central role in the regulation of branched-chain amino acids, to select spontaneous aldB mutants in an unbalanced concentration of leucine versus those of valine and isoleucine in the medium. Industrial dairy strains of L. lactis subsp. lactis biovar diacetylactis containing point mutations and deletions of aldB were isolated and characterized. Their growth in milk was not affected, but they rapidly accumulated a large amount of alpha-acetolactate instead of acetoin from citrate in milk. Under aerated condition, strains devoid of AldB produced about 10 times more diacetyl than did the parental strains.
|
126. |
( 1996 ) Nucleotide sequence and analysis of pWC1, a pC194-type rolling circle replicon in Lactococcus lactis. PMID : 8700966 : DOI : 10.1006/plas.1996.0015 Abstract >>
A 2.8-kb cryptic plasmid showing no homology to either pFX3 (rolling circle, pE194-type) or pCI305 (theta-type) lactococcal replicons was identified in Lactococcus lactis subsp. cremoris 2204. The plasmid, pWC1, was compatible with both pCI3340 (a pCI305 derivative) and pFX3 in L. lactis subsp. cremoris 2204. Sequence analysis of pWC1 showed one major ORF encoding a protein with a deduced size of 316 amino acids (aa). Database comparisons showed that the protein was distinct from the pFX- and pCI-type replication proteins (less than 21% aa identity), but shared significant homology (up to 57% aa identity) with the replication proteins from a different group of rolling circle plasmids (pC194-type) commonly found in gram-positive bacteria. A pC194-type rolling circle plasmid has not been previously described in L. lactis. Further sequence analysis showed a conserved double-stranded origin of replication in pWC1 preceded by a large (118-bp) direct repeat. The chloramphenicol-resistance gene from pC194 was inserted into a nonessential region of pWC1 to give pCP12. The host range of pCP12 included Streptococcus thermophilus, Enterococcus faecalis, and Staphylococcus aureus, but not Escherichia coli. Both pCP12 and to a lesser extent pWC1 generated single-stranded DNA (ssDNA) in L. lactis. A possible single-stranded origin of replication was identified by sequence analysis of pWC1 and by comparing levels of ssDNA produced by pCP12 deletion derivatives. The pWC1 replicon may be a useful addition to other replicons currently available for vector construction.
|
127. |
( 1993 ) Analysis of a region from the bacteriophage resistance plasmid pCI528 involved in its conjugative mobilization between Lactococcus strains. PMID : 8376345 : DOI : 10.1128/jb.175.18.6002-6009.1993 PMC : PMC206682 Abstract >>
A 10-kb HindIII fragment of pCI528 cloned into the nonconjugative shuttle vector pCI3340 could be transferred by conjugative mobilization from Lactococcus lactis subsp. lactis MG1363, whereas other HindIII fragments of pCI528 or the vector alone were nonmobilizable. Subcloning of this 10-kb region identified a 4.4-kb BglII-EcoRI fragment which contained all the DNA essential for transfer. Sequence analysis of a 2-kb region within this 4.4 kb-segment revealed a region rich in inverted repeats and two potential overlapping open reading frames, one of which demonstrated homology to mobilization proteins of two nonconjugative staphylococcal plasmids.
|
128. |
( 1995 ) Cloning and DNA sequence analysis of two abortive infection phage resistance determinants from the lactococcal plasmid pNP40. PMID : 8534099 : PMC : PMC167743 Abstract >>
The lactococcal plasmid pNP40, from Lactococcus lactis subsp. lactis biovar diacetylactis DRC3, confers complete resistance to the prolate-headed phage phi c2 and the small isometric-headed phage phi 712 in L. lactis subsp. lactis MG1614. A 6.0-kb NcoI fragment of pNP40 cloned in the lactococcal Escherichia coli shuttle vector pAM401 was found to confer partial resistance to phi 712. Subcloning and deletion analysis of the recombinant plasmid pPG01 defined a 2.5-kb ScaIHpaI fragment as conferring phage insensitivity. Sequence analysis of this region confirmed the presence of two overlapping open reading frames (ORFs). Further subcloning of pNP40 to characterize the resistance determinant active against phi c2 identified a 5.6-kb EcoRV fragment of pNP40 which, when cloned in pAM401, conferred partial resistance to both phi c2 and phi 712. Subcloning and deletion analysis of the recombinant plasmid pCG1 defined a 3.7-kb EcoRV-XbaI fragment as encoding phage insensitivity. DNA sequence analysis of this region revealed the presence of a single complete ORF. The introduction of a frameshift mutation at the unique BglII site within this ORF disrupted the phage resistance phenotype, confirming that this ORF is responsible for the observed phage insensitivity. The mechanisms encoded by pPG01 and pCG1 in L. lactis subsp. lactis MG1614 conformed to the criteria defining abortive infection and were designated AbiE and AbiF, respectively. Analysis of the phage DNA content of phi 712-infected hosts containing AbiF demonstrated that it inhibited the rate of phage DNA replication, while AbiE had little effect on phage DNA replication, suggesting a later target of inhibition. The predicted protein product of abiF shows significant homology to the products of two other lactococcal abortive infection genes, abiD and abiD1.
|
129. |
( 1993 ) Cloning of a chromosomal gene required for phage infection of Lactococcus lactis subsp. lactis C2. PMID : 8366036 : DOI : 10.1128/jb.175.17.5510-5519.1993 PMC : PMC206607 Abstract >>
A phage-resistant mutant with a defect in a membrane component required for phage infections in Lactococcus lactis subsp. lactis C2 was transformed with a chromosomal library of the wild-type, phage-sensitive strain. Of the 4,200 transformants screened for phage sensitivity, three were positively identified as phage sensitive. A cause-and-effect relationship between the cloned chromosomal fragments and the phage-sensitive phenotype was established on the basis of the following two criteria: (i) the frequency of loss of the cloned fragments in the absence of antibiotic selection pressure correlated with the frequency of loss of phage sensitivity; and (ii) phage sensitivity was transferred to 100% of recipient, phage-resistant cells transformed with the cloned fragment. The cloned chromosomal DNA from the three independent isolates was physically mapped with restriction endonucleases. The sizes of the cloned fragments were 9.6, 11.8, and 9.5 kb. Each fragment contained an identical stretch of DNA common to all three, which was 9.4 kb. The gene that conferred phage sensitivity was localized by subcloning to a 4.5-kb region. Further subcloning indicated that a single EcoRI site within the 4.5-kb region must lie within the gene or its promoter. The required 4.5-kb region was sequenced and found to code for one partial and two complete open reading frames. The gene required for complementation was functionally mapped by Tn5 mutagenesis and localized to one of the two complete open reading frames, which was designated pip (an acronym for phage infection protein). pip is 2,703 bases in length. Potential promoters start 206 and 212 bases upstream of the open reading frame. A ribosome binding site and a seven-base spacer precede the GTG (Val) translation initiation codon. The amino acid sequence deduced from the gene has 901 residues and an M(r) of 99,426. Hydropathy analysis revealed four to six potential membrane-spanning regions, one near the amino terminus and the others at the extreme carboxyl terminus. The amino terminus has characteristics of a signal sequence. The putative protein would have a 650-residue, central polar domain.
|
130. |
( 1996 ) Cloning vectors for lactococci based on a plasmid encoding resistance to cadmium. PMID : 8661686 : Abstract >>
An 8.8-kb plasmid (pND302) was identified in Lactococcus lacti spp lactis M71 which encodes cadmium resistance (CdR). Most of the commercial lactococcal strains tested were sensitive to cadmium. Therefore, CdR should provide a useful selectable marker for constructing cloning vectors in lactococci. pND302 was mapped with a number of restriction enzymes and found to contain a unique EcoRI site suitable for cloning. Two E. coli/L lactis shuttle cloning vectors, pND304 and pND624, were constructed by subcloning of the E. coli plasmids pBR322 and pGEM-7Zf(+) containing a 1.6-kb gene encoding nisin resistance (NisR) of lactococcal origin into the EcoRI site of pND302, separately. The E. coli DNA component of pND624 was removed and the resulting plasmid, pND625, consisted of only lactococcal DNA, expressing NisR and CdR, with two synthetic polylinkers that contain multiple restriction sites for versatile cloning. Both pND302 and pND625 can be transformed by electroporation into L. lactis LMO230 at 10(3)/micrograms DNA and maintained stably in LMO230. The results indicated that pND302 and pND625 are potential food-grade cloning vectors for lactococci.
|
131. |
( 1996 ) Sequence of a Lactococcus lactis DNA fragment homologous to the recF gene of Bacillus subtilis. PMID : 8621080 : DOI : 10.1016/0378-1119(96)81421-1 Abstract >>
The recF gene of Lactococcus lactis ATCC 7962 is located 3 kb downstream from the lacZ gene and is transcribed in the opposite orientation. The recF gene is immediately preceded by a 121-codon ORF, and both recF and orf121 may be transcribed from the same promoter. The deduced RecF amino-acid sequence shows high homology to that of the Bacillus subtilis and Streptococcus pyogenes RecF proteins.
|
132. |
( 1993 ) Gene inactivation in Lactococcus lactis: branched-chain amino acid biosynthesis. PMID : 8331070 : DOI : 10.1128/jb.175.14.4383-4390.1993 PMC : PMC204878 Abstract >>
The Lactococcus lactis subsp. lactis strains isolated from dairy products are auxotrophs for branched-chain amino acids (leucine, isoleucine, and valine), while most strains isolated from nondairy media are prototrophs. We have cloned and sequenced the leu genes from one auxotroph, IL1403. The sequence is 99% homologous to that of the prototroph NCDO2118, which was determined previously. Two nonsense mutations and two small deletions were found in the auxotroph sequence, which might explain the branched-chain amino acid auxotrophy. Nevertheless, the leu genes from the auxotroph appear to be transcribed and regulated similarly to those from the prototroph.
|
133. |
( 1993 ) Isolation and sequence analysis of the pmi gene encoding phosphomannose isomerase of Streptococcus mutans. PMID : 8293960 : DOI : 10.1111/j.1574-6968.1993.tb06551.x Abstract >>
A gene encoding a phosphomannose isomerase from Streptococcus mutans GS-5 was identified immediately downstream from the fructokinase gene, scrK. Nucleotide sequence analysis of this region revealed an open reading frame (ORF) specifying a putative protein of 316 amino acids. The gene cloned in Escherichia coli expressed strong phosphomannose isomerase activity. The deduced amino acid sequence of the pmi gene has no significant similarity with any of the previously reported phosphomannose isomerase enzymes. Insertional inactivation of the upstream gene, scrK, in S. mutans also drastically reduced phosphomannose isomerase activity and the ability of the organism to utilize mannose as a sole carbon source. These results suggest that the S. mutans pmi gene constitutes an operon with the scrK gene.
|
134. |
( 1994 ) The Lactococcus lactis sex-factor aggregation gene cluA. PMID : 7934889 : DOI : 10.1111/j.1365-2958.1994.tb01053.x Abstract >>
A gene, cluA, was cloned from the chromosomally located sex factor of Lactococcus lactis MG1363. Sequence analysis revealed significant homology with previously described aggregation proteins in Enterococcus and Streptococcus species. The possibility that cluA was an equivalent protein involved in cell aggregation between donor and recipient bacteria during lactococcal conjugation was confirmed by its expression under the control of a heterologous promoter in L. lactis. Analysis of the homology between the CluA protein and the related proteins of Enterococcus and Streptococcus allowed a common structure for these proteins to be postulated. This consisted of five domains. Functionally conserved domains I and V act respectively as a secretory leader and C-terminal membrane anchor. Domains II and IV are conserved at the amino acid level and probably have common structural roles whereas domain III is variable and may control binding specificity.
|
135. |
( 1994 ) Use of the Escherichia coli beta-glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria. PMID : 8135517 : PMC : PMC201353 Abstract >>
A transcriptional fusion vector, designated pNZ272, based on the promoterless beta-glucuronidase gene (gusA) of Escherichia coli as a reporter gene, has been constructed for lactic acid bacteria. The replicon of pNZ272 was derived from the Lactococcus lactis plasmid pSH71, allowing replication in a wide range of gram-positive bacteria and E. coli. The applicability of pNZ272 and the expression of the gusA gene in L. lactis was demonstrated in shotgun cloning experiments with lactococcal chromosomal and bacteriophage DNA. In addition, three defined lactococcal promoters were inserted in pNZ272: the plasmid-derived lacA promoter, the chromosomal usp45 promoter, and a promoter from bacteriophage phi SK11G. The three resulting plasmids showed beta-glucuronidase activity in a gusA-deficient E. coli strain and in four species of lactic acid bacteria belonging to the genera Lactobacillus, Lactococcus, and Leuconostoc. The copy numbers of the gusA-expressing plasmids were similar within a single species of lactic acid bacteria. However, the specific beta-glucuronidase activity and the gusA mRNA levels varied considerably both within a single species and among different species of lactic acid bacteria. The transcriptional start site of all three promoters was determined and found to be identical in the different species. The results of this comparative promoter analysis indicate that the requirements for efficient transcription initiation differ among the lactic acid bacteria studied.
|
136. |
( 1995 ) A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. PMID : 8522504 : DOI : 10.1128/jb.177.24.7011-7018.1995 PMC : PMC177576 Abstract >>
A system for generating chromosomal insertions in lactococci is described. It is based on the conditional replication of lactococcal pWV01-derived Ori+ RepA- vector pORI19, containing lacZ alpha and the multiple cloning site of pUC19. Chromosomal AluI fragments of Lactococcus lactis were cloned in pORI19 in RepA+ helper strain Escherichia coli EC101. The frequency of Campbell-type recombinants, following introduction of this plasmid bank into L. lactis (RepA-), was increased by combining the system with temperature-sensitive pWV01 derivative pVE6007. Transformation of L. lactis MG1363 (pVE6007) with the pORI19 bank of lactococcal chromosomal fragments at the permissive temperature allowed replication of several copies of a recombinant plasmid from the bank within a cell because of the provision in trans of RepA-Ts from pVE6007. A temperature shift to 37 degrees C resulted in loss of pVE6007 and integration of the pORI19 derivatives at high frequencies. A bank of lactococcal mutants was made in this way and successfully screened for the presence of two mutations: one in the monocistronic 1.3-kb peptidoglycan hydrolase gene (acmA) and one in the hitherto uncharacterized maltose fermentation pathway. Reintroduction of pVE6007 into the Mal- mutant at 30 degrees C resulted in excision of the integrated plasmid and restoration of the ability of ferment maltose. The integration plasmid (pMAL) was rescued by using the isolated plasmid content of a restored Mal+ colony to transform E. coli EC101. Nucleotide sequencing of the 564-bp chromosomal fragment in pMAL revealed an internal part of an open reading frame of which the translated product showed significant homology with ATP-binding proteins MalK of E. coli, Salmonella typhimurium, and Enterobacter aerogenes and MsmK of Streptococcus mutans. This combined use of two types of conditional replicating pWV01-derived vectors represents a novel, powerful tool for chromosomal gene inactivation, targeting, cloning, and sequencing of the labelled gene.
|
137. |
( 1993 ) Characterization of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. PMID : 8478324 : DOI : 10.1128/jb.175.9.2578-2588.1993 PMC : PMC204559 Abstract >>
Biosynthesis of the lantibiotic peptide nisin by Lactococcus lactis NIZO R5 relies on the presence of the conjugative transposon Tn5276 in the chromosome. A 12-kb DNA fragment of Tn5276 including the nisA gene and about 10 kb of downstream DNA was cloned in L. lactis, resulting in the production of an extracellular nisin precursor peptide. This peptide reacted with antibodies against either nisin A or the synthetic leader peptide, suggesting that it consisted of a fully modified nisin with the nisin leader sequence still attached to it. This structure was confirmed by N-terminal sequencing and 1H-nuclear magnetic resonance analysis of the purified peptide. Deletion studies showed that the nisR gene is essential for the production of this intermediate. The deduced amino acid sequence of the nisR gene product indicated that the protein belongs to the family of two-component regulators. The deduced amino acid sequence of NisP, the putative product of the gene upstream of nisR, showed an N-terminal signal sequence, a catalytic domain with a high degree of similarity to those of subtilisin-like serine proteases, and a putative C-terminal membrane anchor. Cell extracts of Escherichia coli overexpressing nisP were able to cleave the nisin precursor peptide, producing active, mature nisin. A similar activation was obtained with whole cells but not with membrane-free extracts of L. lactis strains carrying Tn5276 in which the nisA gene had been inactivated. The results indicate that the penultimate step in nisin biosynthesis is secretion of precursor nisin without cleavage of the leader peptide, whereas the last step is the cleavage of the leader peptide sequence from the fully maturated nisin peptide.
|
138. |
( 1994 ) BglR protein, which belongs to the BglG family of transcriptional antiterminators, is involved in beta-glucoside utilization in Lactococcus lactis. PMID : 8083160 : DOI : 10.1128/jb.176.18.5681-5685.1994 PMC : PMC196771 Abstract >>
A fragment of the Lactococcus lactis chromosome containing an open reading frame of 265 codons, denoted bglR, has been characterized. The polypeptide encoded by bglR shares 36 to 30% sequence identity with a family of regulatory proteins including ArbG from Erwinia chrysanthemi, BglG from Escherichia coli, and SacT and SacY from Bacillus subtilis. These regulatory proteins are involved in positive control of the utilization of different sugars by transcription antitermination. For some of these regulatory proteins it has been demonstrated that antitermination is exerted by binding to a conserved RNA sequence, partially overlapping the transcription terminator and thus preventing transcription termination. Upstream of bglR, we identified a transcription terminator whose 5' end was overlapped by a 32-bp sequence, highly homologous to the RNA-binding site that is conserved in other regulatory systems. Constitutive expression of bglR in E. coli increased the expression of a bglG::lacZ transcriptional fusion. The fact that that the expression of BglG is autoregulated in E. coli suggests that BglG and BglR are functionally equivalent. In L. lactis, we observed that (i) the expression of a bglR::lacZ fusion is increased by beta-glucoside sugars, (ii) disruption of bglR impairs growth on some beta-glucosides, and (iii) the expression of bglR is positively autoregulated. Because of these structural and functional similarities between BglR and the transcription antiterminators of the BglG family, we propose that BglR may be the lactococcal counterpart of the E. coli BglG regulator of beta-glucoside utilization.
|
139. |
( 1995 ) A non-essential glutamyl aminopeptidase is required for optimal growth of Lactococcus lactis MG1363 in milk. PMID : 8535515 : DOI : 10.1099/13500872-141-11-2873 Abstract >>
Degenerate PCR primers were designed from the N-terminal amino acid sequence of a glutamyl aminopeptidase (PepA) from Lactococcus lactis. These primers were used to screen a lambda library for clones containing the gene (pepA) encoding PepA. The DNA sequence of a 2.1 kb fragment containing pepA was determined. The sequence revealed the presence of one complete and two incomplete open reading frames (ORFs). The complete ORF encodes a putative protein of 353 amino acids with a predicted N-terminal sequence identical to that determined for purified PepA. The pepA gene was subcloned on an Escherichia coli plasmid vector and production of active PepA was confirmed by means of a zymogram. Mutants of L. lactis in which the pepA gene was inactivated grew to normal cell densities in milk but exhibited a reduced growth rate during the exponential phase. Thus whilst PepA is required for optimal growth it is not essential.
|
140. |
( 1994 ) Identification and characterization of genes involved in excision of the Lactococcus lactis conjugative transposon Tn5276. PMID : 8157585 : DOI : 10.1128/jb.176.8.2165-2171.1994 PMC : PMC205335 Abstract >>
The 70-kb transposon Tn5276, originally detected in Lactococcus lactis NIZO R5 and carrying the genes for nisin production and sucrose fermentation, can be conjugally transferred to other L. lactis strains. Sequence analysis and complementation studies showed that the right end of Tn5276 contains two genes, designated xis and int, which are involved in excision. The 379-amino-acid int gene product shows high (up to 50%) similarity with various integrases, including that of the Tn916-related conjugative transposons. The xis gene product, like almost all known excisionase (Xis) proteins, is a small (68-residue), basic protein. Expression of both the Tn5276 int and xis genes is required for efficient excision of the ends of Tn5276 in Escherichia coli that appeared to be circularized in the excision process. Mutational analysis of the xis and int genes showed that excision efficiency is dependent on the integrity of the int gene but that an intact xis gene is also required for efficient excision.
|
141. |
( 1994 ) Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis. PMID : 8017926 : PMC : PMC201490 Abstract >>
The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region.
|
142. |
( 1993 ) Nucleotide sequence of the Lactococcus lactis NCDO 763 (ML3) rpoD gene. PMID : 8218400 : DOI : 10.1016/0167-4781(93)90045-f Abstract >>
The complete nucleotide sequence of rpoD gene from Lactococcus lactis has been determined. The nucleotide data have indicated the presence of an open reading frame of 1020 base pairs encoding a polypeptide which shares the framework structure for principal sigma factors of eubacteria strains.
|
143. |
( 1994 ) A Lactococcus lactis gene encodes a membrane protein with putative ATPase activity that is homologous to the essential Escherichia coli ftsH gene product. PMID : 8000529 : DOI : 10.1099/00221287-140-10-2601 Abstract >>
A gene, encoding a protein homologous to an essential Escherichia coli protein, FtsH, was identified adjacent to the hpt gene and the trnA operon in the Gram-positive bacterium Lactococcus lactis. The deduced amino acid sequence of the gene product showed full-length similarity to FtsH of E. coli, Yme1p of Saccharomyces cerevisiae and a conserved region found in a new family of putative ATPases. In-frame fusions of L. lactis ftsH and phoA1 in E. coli, and immunodetection of the L. lactis FtsH protein in cell fractions using anti-E. coli FtsH serum showed that L. lactis ftsH was expressed and encodes a membrane protein. When contained on a high copy number plasmid, the L. lactis ftsH gene complemented the lethality of a delta ftsH3::kan mutation in E. coli at 37 degrees C and below, indicating that the L. lactis ftsH gene can functionally replace the E. coli ftsH gene to some extent. The resulting E. coli strain showed temperature sensitivity and salt sensitivity. A L. lactis mutant with an insertion into ftsH was salt-, heat- and cold-sensitive. These results suggest that FtsH is somehow involved in stress responses. Southern hybridization analysis indicated that genes homologous to ftsH of L. lactis were also present in Bacillus subtilis, and several Lactobacillus and Leuconostoc species, suggesting high conservation of ftsH in bacterial species.
|
144. |
( 1994 ) Similarity between putative ATP-binding sites in land plant plastid ORF2280 proteins and the FtsH/CDC48 family of ATPases. PMID : 8082182 : Abstract >>
Plastid ORF2280 proteins from five species of land plant are shown to have limited amino-acid sequence similarity to a family of proteins that includes the yeast CDC48, SEC18, PAS1 and SUG1 proteins, three subunits of the mammalian 26S protease, and the Escherichia coli FtsH protein. These proteins all contain one or two ATPase domains and many are involved in cell division, transport of proteins across membranes, or proteolysis. Similarity with the ORF2280 proteins is restricted to a single region of about 130 amino acids that contains: (1) sequences resembling a nucleotide binding site but lacking two normally conserved residues, and (2) a downstream conserved motif with the consensus sequence VIX2TX2PX3DPALX2P. Most of the rest of ORF2280 is very poorly conserved among land plants, even though other family members such as CDC48 have slow rates of protein sequence evolution. In contrast, a protein encoded by plastid DNA of the rhodophyte alga Porphyra purpurea is very similar to E. coli FtsH. Phylogenetic analysis suggests that the red and green plastid genes are not true homologues (orthologues) but distinct members of an ancient gene family.
|
145. |
( 1995 ) Characterization of the replicon from the lactococcal theta-replicating plasmid pJW563. PMID : 8559799 : Abstract >>
The replication region of the lactococcal plasmid pJW563 was localized to a 2.3-kb EcoRI fragment. This DNA fragment was sequenced ans a 1155-bp open reading frame, repB563, encoding a putative protein RepB563 of 385 amino acids was found. An AT-rich noncoding region, repA563, was found upstream of repB563. This segment included several direct and inverted repeats. A downstream 591-bp open reading frame, ORF X, which was not necessary for replication, was putatively translationally coupled to repB563, RepB563 supplied in trans could support replication of a plasmid containing repA563 and a truncated repB563. This observation suggests that RepB563 is a trans-acting replication protein, and repA563 the cis-acting origin of replication, repA563, repB563, and the beginning of ORF X showed high homology to similar regions in a family of lactococcal theta-replicating plasmids. The repA DNA sequences and the RepB amino acid sequences of the plasmids were aligned and the consensus sequences generated. The comparison revealed highly conserved areas among this family of plasmids. In addition, variable domains emerged, presumably having a plasmid specific function, pVS40 and pC1305 were plasmids with replication proteins showing high homology to RepB563. Despite this homology, replication from repA563 could not be supported by the pVS40 or pC1305 replication protein supplied in trans. Likewise the pJW563 protein could not support replication from the pVS40 origin. pJW563 was found to be compatible with the pVS40 and pC1305 replicons. The results indicate that pJW563 belongs to the widespread family of lactococcal theta-replicating pladmids. Despite the high homology between their replicons, the interaction between the replication origin and the protein is highly specific in many cases rendering the plasmids compatible.
|
146. |
( 1994 ) A conserved sequence in tRNA and rRNA promoters of Lactococcus lactis. PMID : 8086451 : DOI : 10.1016/0167-4781(94)90256-9 Abstract >>
A tRNA operon (trnA) from Lactococcus lactis consisting of seven tRNA genes and a 5S rRNA gene was cloned and sequenced. Promoter-fusion of the trnA promoter to a promoter-less beta-galactosidase gene of Leuconostoc mesenteroides resulted in high levels of beta-galactosidase activity in L. lactis. Searching for sequences with similarity to the sequence of the promoter region revealed a consensus sequence of promoters preceeding rRNA operons and tRNA operons from Lactococcus species including a not previously described conserved sequence (AGTT).
|
147. |
( 1994 ) The majority of lactococcal plasmids carry a highly related replicon. PMID : 8081493 : DOI : 10.1099/00221287-140-6-1291 Abstract >>
DNA sequence analysis and Southern hybridizations, together with complementation experiments, were used to study relationships between lactococcal plasmid replicons. pWVO2, pWVO4 and pWVO5, which co-exist in Lactococcus lactis subsp. cremoris Wg2, and pIL7 (isolated from another strain) all contained a functional replication region which appeared to be very similar to that of some known lactococcal plasmids. They contain a gene encoding a highly conserved RepB protein (60-80% amino acid identity between pWVO2, pWVO4 and pWVO5), which is essential for replication. When supplied in trans, repB of pWVO2 complemented a repB deficiency of pWVO5. Upstream of the repB gene, all these plasmids contain a strongly conserved region including a 22 bp sequence tandemly repeated three-and-a-half times, and an A/T-rich region. The similarity with pWVO2, which is known to replicate via a theta mechanism, suggests that all plasmids of this family are capable of theta replication. Southern hybridizations revealed that many lactococcal strains contain plasmids of this family.
|
148. |
Moineau S,
Walker SA,
Vedamuthu ER,
Vandenbergh PA,
( 1995 ) Cloning and sequencing of LlaDCHI [corrected] restriction/modification genes from Lactococcus lactis and relatedness of this system to the Streptococcus pneumoniae DpnII system. PMID : 7793939 : PMC : PMC167490 Abstract >>
The natural 7.8-kb plasmid pSRQ700 was isolated from Lactococcus lactis subsp. cremoris DCH-4. It encodes a restriction/modification system named LlaDCHI [corrected]. When introduced into a phage-sensitive L. lactis strain, pSRQ700 confers strong phage resistance against the three most common lactococcal phage species, namely, 936, c2, and P335. The LlaDCHI [corrected] endonuclease was purified and found to cleave the palindromic sequence 5'-GATC-3'. It is an isoschizomer of Streptococcus pneumoniae DpnII. The plasmid pSRQ700 was mapped, and the genetic organization of LlaDCHI [corrected] was localized. Cloning and sequencing of the entire LlaDCHI [corrected] system allowed the identification of three open reading frames. The three genes (llaIIA, llaIIB, and llaIIC) overlapped and are under one putative promoter. A putative terminator was found at the end of llaIIC. The genes llaIIA and llaIIB coded for m6A methyltransferases, and llaIIC coded for an endonuclease. The LlaDCHI [corrected] system shares strong genetic similarities with the DpnII system. The deduced amino acid sequence of M.LlaIIA was 75% identical with that of M.DpnII, whereas M.LlaIIB was 88% identical with M.DpnA. However, R.LlalII shared only 31% identity with R.DpnII.
|
149. |
( 1994 ) Distribution and evolution of nisin-sucrose elements in Lactococcus lactis. PMID : 8031080 : PMC : PMC201564 Abstract >>
The distribution, architecture, and conjugal capacity of nisin-sucrose elements in wild-type Lactococcus lactis strains were studied. Element architecture was analyzed with the aid of hybridizations to different probes derived from the nisin-sucrose transposon Tn5276 of L. lactis NIZO R5, including its left and right ends, the nisA gene, and IS1068 (previously designated iso-IS904), located between the left end and the nisA gene. Three classes of nisin-sucrose elements could be distinguished in the 13 strains investigated. Classes I and II consist of conjugative transposons containing a nisA gene and a nisZ gene, respectively. Representative conjugative transposons of these classes include Tn5276 (class I) from L. lactis NIZO R5 and Tn5278 (class II) from L. lactis ILC11. The class II transposon found in L. lactis NCK400 and probably all class II elements are devoid of IS1068-like elements, which eliminates the involvement of an iso-IS1068 element in conjugative transposition. Members of class III contain a nisZ gene, are nonconjugative, and do not contain sequences similar to the left end of Tn5276 at the appropriate position. The class III element from L. lactis NIZO 22186 was found to contain an iso-IS1068 element, termed IS1069, at a position corresponding to that of IS1068 in Tn5276 but in the inverted orientation. The results suggest that an iso-IS1068-mediated rearrangement is responsible for the dislocation of the transposon's left end in this strain. A model for the evolution of nisin-sucrose elements is proposed, and the practical implications for transferring nisin A or nisin Z production and immunity are discussed.
|
150. |
von Wright A,
Räty K,
( 1993 ) The nucleotide sequence for the replication region of pVS40, a lactococcal food grade cloning vector. PMID : 7763788 : Abstract >>
The replication region of a limited host range lactococcal vector, pVS40, was located within a 2359 bp EcoRI--ClaI fragment. Within this fragment a sequence for a 1197 bp reading frame coding for a 46,826 Da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. Immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (TATAGCGTATGAAAAAACTGTG), suggesting an origin of replication. The protein has considerable homologies to certain lactococcal plasmid replication proteins.
|
151. |
Delorme C,
Godon JJ,
Ehrlich SD,
Renault P,
( 1993 ) Gene inactivation in Lactococcus lactis: histidine biosynthesis. PMID : 7687248 : DOI : 10.1128/jb.175.14.4391-4399.1993 PMC : PMC204879 Abstract >>
Lactococcus lactis strains from dairy and nondairy sources were tested for the ability to grow in the absence of histidine. Among 60 dairy strains tested, 56 required histidine, whereas only 1 of 11 nondairy strains had this requirement. Moreover, 10 of the 56 auxotrophic strains were able to grow in the presence of histidinol (Hol+), the immediate histidine precursor. This indicates that adaptation to milk often results in histidine auxotrophy. The histidine operon was detected by Southern hybridization in eight dairy auxotrophic strains tested. A large part of the histidine operon (8 kb, containing seven histidine biosynthetic genes and three unrelated open reading frames [ORFs]) was cloned from an auxotroph, which had an inactive hisD gene, as judged by its inability to grow on histidinol. Complementation analysis of three genes, hisA, hisB, and hisG, in Escherichia coli showed that they also were inactive. Sequence analysis of the cloned histidine region, which revealed 98.6% overall homology with that of the previously analyzed prototrophic strain, showed the presence of frameshift mutations in three his genes, hisC, hisG, and hisH, and two genes unrelated to histidine biosynthesis, ORF3 and ORF6. In addition, several mutations were detected in the promoter region of the operon. Northern (RNA) hybridization analysis showed a much lower amount of the his transcript in the auxotrophic strain than in the prototrophic strain. The mutations detected account for the histidine auxotrophy of the analyzed strain. Certain other dairy auxotrophic strains carry a lower number of mutations, since they were able to revert either to a Hol+ phenotype or to histidine prototrophy.
|
152. |
( 1993 ) Molecular analysis of the Lactococcus lactis subspecies lactis CNRZ270 bidirectional theta replicating lactose plasmid pUCL22. PMID : 7934861 : DOI : 10.1111/j.1365-2958.1993.tb00981.x Abstract >>
pUCL22 is the lactose protease plasmid of Lactococcus lactis ssp. lactis CNRZ270. The nucleotide sequence of its replication region Rep22 contains a non-transcribed region, the replication origin, followed by a gene encoding a putative 388-amino-acid protein named Rep22A. The promoter regions of the rep22A and pC194 cat genes share strong similarities and the pUCL22 replicon exerted trans or cis negative control on the pC194 cat gene expression in L. lactis. We suggest that Rep22A binds to its own promoter as well as to the pC194 cat promoter and thus is autoregulated. We show that pUCL22 replicates mainly by a bidirectional theta mechanism in L. lactis, and is representative of a widely distributed replicon family, members of which could be co-resident. We propose that compatibility between these closely related replicons results from minor replication protein modifications coupled with base changes in their respective binding sites, supporting the co-existence of numerous related replicons in lactococcal strains.
|
153. |
( 1994 ) Cloning and characterization of upp, a gene encoding uracil phosphoribosyltransferase from Lactococcus lactis. PMID : 7961396 : DOI : 10.1128/jb.176.21.6457-6463.1994 PMC : PMC196998 Abstract >>
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced, and the putative amino acid sequence was deduced. The promoter was mapped by both primer extension and analysis of beta-galactosidase expressed from strains carrying fusion between upp promoter fragments and the lacLM gene. The results showed that the upp gene was expressed from its own promoter. After in vitro construction of an internal deletion, a upp mutant was constructed by a double-crossover event. This implicated the utilization of a plasmid with a thermosensitive origin of replication and a new and easy way to screen for double crossover events in both gram-positive and gram-negative bacterial strains. The phenotype of the uracil phosphoribosyltransferase-deficient strain was established. Surprisingly, the upp strain is resistant only to very low concentrations of 5-fluorouracil. Secondary mutants in thymidine phosphorylase and thymidine kinase were isolated by selection for resistance to high concentrations of 5-fluorouracil.
|
154. |
( 1993 ) Theta replication of the lactococcal plasmid pWVO2. PMID : 7934823 : Abstract >>
pWVO2 is a 3.8 kb narrow-host-range plasmid from Lactococcus lactis ssp. cremoris Wg2, which does not replicate in Bacillus subtilis or Escherichia coli. Single-stranded pWVO2 DNA was not observed in lactococcal cells, indicating that this plasmid does not replicate via a rolling-circle mechanism. The sequence of pWVO2 neither showed the structural organization typical for rolling-circle plasmids, nor were sequence similarities with known rolling-circle plasmids present. By 2-D agarose gel electrophoresis of replication intermediates, it was shown that pWVO2 replicates via a theta mechanism. This is the first proof for the existence of theta-replicating plasmids in lactococci. The pWVO2 minimal replicon is strongly related to that of several other lactococcal plasmid replicons. It contains one open reading frame encoding the replication protein, which is preceded by a 22 bp sequence tandemly repeated three and a half times. Further upstream is another 10 bp direct repeat present in an A/T-rich sequence. This structural organization resembles that of several iteron-containing theta-type plasmids from E. coli. Derivatives of pWVO2 were stably maintained in L. lactis and are good candidates for the development of stable food-grade cloning vectors for this organism.
|
155. |
Immonen T,
Ye S,
Ra R,
Qiao M,
Paulin L,
Saris PE,
( 1995 ) The codon usage of the nisZ operon in Lactococcus lactis N8 suggests a non-lactococcal origin of the conjugative nisin-sucrose transposon. PMID : 7626780 : Abstract >>
An 11.6 kb area downstream from the structural gene of nisin Z in the conjugative nisin-sucrose transposon of Lactococcus lactis subsp. lactis N8 was cloned and sequenced. Analysis of the sequence revealed eight open reading frames, nisZBTClPRK, followed by a putative rho-independent terminator (delta G degrees = -4.7 kcal/mol). The C-terminal hydrophilic domain of the NisK protein is homologous to the C-termini of several histidine kinases of bacterial two-component regulator systems, such as SpaK from Bacillus subtilis and KdpD and RcsC of Escherichia coli. The nisin Z biosynthetic genes were highly similar with the genes of the nisin A operons having, however, a 0-3% difference in the amino acid sequences of the individual proteins. The codon usage of eleven genes within the same conjugative transposon was calculated and found to be strikingly different from that of other lactococcal genes. This, together with the low GC-content (32%) compared to the 38% (G+C) of the lactococcal chromosome in general strongly suggests a non-lactococcal origin of this transposon.
|
156. |
Siegers K,
Entian KD,
( 1995 ) Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3. PMID : 7793910 : PMC : PMC167363 Abstract >>
The lantibiotic nisin is produced by several strains of Lactococcus lactis. The complete gene cluster for nisin biosynthesis in L. lactis 6F3 comprises 15 kb of DNA. As described previously, the structural gene nisA is followed by the genes nisB, nisT, nisC, nisI, nisP, nisR, and nisK. Further analysis revealed three additional open reading frames, nisF, nisE, and nisG, adjacent to nisK. Approximately 1 kb downstream of the nisG gene, three open reading frames in the opposite orientation have been identified. One of the reading frames, sacR, belongs to the sucrose operon, indicating that all genes belonging to the nisin gene cluster of L. lactis 6F3 have now been identified. Proteins NisF and NisE show strong homology to members of the family of ATP-binding cassette (ABC) transporters, and nisG encodes a hydrophobic protein which might act similarly to the immunity proteins described for several colicins. Gene disruption mutants carrying mutations in the genes nisF, nisE, and nisG were still able to produce nisin. However, in comparison with the wild-type strain, these mutants were more sensitive to nisin. This indicates that besides nisI the newly identified genes are also involved in immunity to nisin. The NisF-NisE ABC transporter is homologous to an ABC transporter of Bacillus subtilis and the MbcF-MbcE transporter of Escherichia coli, which are involved in immunity to subtilin and microcin B17, respectively.
|
157. |
Buist G,
Kok J,
Leenhouts KJ,
Dabrowska M,
Venema G,
Haandrikman AJ,
( 1995 ) Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidase needed for cell separation. PMID : 7883712 : DOI : 10.1128/jb.177.6.1554-1563.1995 PMC : PMC176772 Abstract >>
A gene of Lactococcus lactis subsp. cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells. In cell extracts of L. lactis MG1363 and several halo-producing E. coli transformants, lytic bands of similar sizes were identified by denaturing sodium dodecyl sulfate (SDS)-polyacrylamide gels containing L. lactis or M. lysodeikticus cell walls. Of these clearing bands, corresponding to the presence of lytic enzymes with sizes of 46 and 41 kDa, the 41-kDa band was also present in the supernatant of an L. lactis culture. Deletion analysis of one of the recombinant plasmids showed that the information specifying lytic activity was contained within a 2,428-bp EcoRV-Sau3A fragment. Sequencing of part of this fragment revealed a gene (acmA) that could encode a polypeptide of 437 amino acid residues. The calculated molecular mass of AcmA (46,564 Da) corresponded to that of one of the lytic activities detected. Presumably, the enzyme is synthesized as a precursor protein which is processed by cleavage after the Ala at position 57, thus producing a mature protein with a size of 40,264 Da, which would correspond to the size of the enzyme whose lytic activity was present in culture supernatants of L. lactis. The N-terminal region of the mature protein showed 60% identity with the N-terminal region of the mature muramidase-2 of Enterococcus hirae and the autolysin of Streptococcus faecalis. Like the latter two enzymes, AcmA contains C-terminal repeated regions. In AcmA, these three repeats are separated by nonhomologous intervening sequences highly enriched in serine, threonine, and asparagine. Genes specifying identical activities were detected in various strains of L. lactis subsp. lactis and L. lactis subsp. cremoris by the SDS-polyacrylamide gel electrophoresis detection assay and PCR experiments. By replacement recombination, an acmA deletion mutant which grew as long chains was constructed, indicating that AcmA is required for cell separation.
|
158. |
Donkersloot JA,
Thompson J,
( 1995 ) Cloning, expression, sequence analysis, and site-directed mutagenesis of the Tn5306-encoded N5-(carboxyethyl)ornithine synthase from Lactococcus lactis K1. PMID : 7744873 : DOI : 10.1074/jbc.270.20.12226 Abstract >>
The gene (ceo) encoding N5-(carboxyethyl)ornithine synthase (EC 1.5.1.24) has been isolated from the sucrose-nisin transposon Tn5306 of Lactococcus lactis K1, sequenced, and expressed at high level in Escherichia coli. The cloned enzyme has allowed the synthesis of the novel N omega-carboxypropyl amino acids N5-(1-carboxypropyl)-L-ornithine and N6-(1-carboxypropyl)-L-lysine. Comparison of the deduced amino acid sequence of N5-(1-carboxyethyl)-L-ornithine synthase (M(r) = 35,323) to the functionally analogous octopine and nopaline synthases from crown gall tumors showed surprisingly little similarity. However, N5-(1-carboxyethyl)-L-ornithine synthase and yeast saccharopine dehydrogenase exhibit homology at their N and C termini, which suggests that these two proteins constitute a distinct branch of the amino acid dehydrogenase superfamily. A centrally located 9-amino acid segment (GSGNVAQGA) in N5-(1-carboxyethyl)-L-ornithine synthase is virtually identical with a sequence present in the beta alpha beta-fold of the nucleotide binding domain of several microbial NADPH-dependent glutamate dehydrogenases. A much longer sequence of approximately 80 residues has significant similarity to alanine dehydrogenase. Substitution of arginine 15 of N5-(1-carboxyethyl)-L-ornithine synthase by lysine resulted in loss of enzyme activity.
|
159. |
Sacerdot C,
Dessen P,
Hershey JW,
Plumbridge JA,
Grunberg-Manago M,
( 1984 ) Sequence of the initiation factor IF2 gene: unusual protein features and homologies with elongation factors. PMID : 6096856 : DOI : 10.1073/pnas.81.24.7787 PMC : PMC392237 Abstract >>
The gene for protein synthesis initiation factor IF2 in Escherichia coli, infB, is located downstream from nusA on the same operon. We sequenced about 3 kilobases of DNA beginning within nusA and including the entire infB structural gene plus another 392 bases downstream. This region contains no obvious strong promoter signals, but a possible transcriptional termination or pausing site occurs downstream from infB. The putative initiator codon for IF2 alpha (97,300 daltons) is AUG; that for IF2 beta (79,700 daltons) is GUG, located 471 bases downstream in the same reading frame. The codon usage for IF2 is typical of other highly expressed proteins in E. coli and suggests that IF2 mRNA is efficiently translated. IF2 alpha contains two adjacent regions (residues 104-155 and 167-214) that are rich in alanine and charged amino acids and that show striking periodicities in their sequences. These regions may alternate between flexible and helical conformations, thereby drawing together the NH2-terminal and COOH-terminal globular domains of the factor as IF2 interacts with ribosomes or tRNA. Certain regions of the DNA and protein sequences of IF2 share strong homologies with elongation factor EF-Tu and lesser homology with EF-G. In particular, a region of EF-Tu implicated in GTP binding contains sequences and secondary structure that are conserved in IF2. The homologies indicate that the genes for IF2 and the elongation factors are derived at least in part from a common ancestor.
|
160. |
Anba J,
Bidnenko E,
Hillier A,
Ehrlich D,
Chopin MC,
( 1995 ) Characterization of the lactococcal abiD1 gene coding for phage abortive infection. PMID : 7601848 : DOI : 10.1128/jb.177.13.3818-3823.1995 PMC : PMC177101 Abstract >>
Lactococcal phage abortive infection (AbiD1) determined by plasmid pIL105 is active on both prolate- and small-isometric-head phages of the C6A and 936 phage groups, respectively, which are considered two different species. The Abi phenotype was found to be encoded by a single gene, designated abiD1. The abiD1-encoded protein (351 amino acids) does not show homology with any known protein and has a deduced isoelectric point of 10. It also possesses two helix-turn-helix structures and an unusually high content of asparagine, isoleucine, and lysine. A consensual promoter with a TGy extension to the -10 box was mapped 76 bp upstream of the start codon. Transcription initiated at this strong promoter stops at a terminator located 48 bp downstream from the promoter. The termination process is very efficient, and transcripts corresponding to the abiD1 gene were not visible in our experimental conditions with or without phage infection. Expression of abiD1 under the control of a T7 promoter induced a lag phase in Lactococcus lactis cell growth, suggesting that overproduction of AbiD1 could be toxic for the cells. AbiD1 protein was visualized in Escherichia coli by using a tightly controlled expression system.
|
161. |
Sanders JW,
Leenhouts KJ,
Haandrikman AJ,
Venema G,
Kok J,
( 1995 ) Stress response in Lactococcus lactis: cloning, expression analysis, and mutation of the lactococcal superoxide dismutase gene. PMID : 7665513 : DOI : 10.1128/jb.177.18.5254-5260.1995 PMC : PMC177316 Abstract >>
In an analysis of the stress response of Lactococcus lactis, three proteins that were induced under low pH culture conditions were detected. One of these was identified as the lactococcal superoxide dismutase (SodA) by N-terminal amino acid sequence analysis. The gene encoding this protein, designated sodA, was cloned by the complementation of a sodA sodB Escherichia coli strain. The deduced amino acid sequence of L. lactis SodA showed the highest degree of similarity to the manganese-containing Sod (MnSod) of Bacillus stearothermophilus. A promoter upstream of the sodA gene was identified by primer extension analysis, and an inverted repeat surrounding the -35 hexanucleotide of this promoter is possibly involved in the regulation of the expression of sodA. The expression of sodA was analyzed by transcriptional fusions with a promoterless lacZ gene. The induction of beta-galactosidase activity occurred in aerated cultures. Deletion experiments revealed that a DNA fragment of more than 130 bp surrounding the promoter was needed for the induction of lacZ expression by aeration. The growth rate of an insertion mutant of sodA did not differ from that of the wild type in standing cultures but was decreased in aerated cultures.
|
162. |
O'Sullivan DJ,
Zagula K,
Klaenhammer TR,
( 1995 ) In vivo restriction by LlaI is encoded by three genes, arranged in an operon with llaIM, on the conjugative Lactococcus plasmid pTR2030. PMID : 7528201 : DOI : 10.1128/jb.177.1.134-143.1995 PMC : PMC176565 Abstract >>
The LlaI restriction and modification (R/M) system is encoded on pTR2030, a 46.2-kb conjugative plasmid from Lactococcus lactis. The llaI methylase gene, sequenced previously, encodes a functional type IIS methylase and is located approximately 5 kb upstream from the abiA gene, encoding abortive phage resistance. In this study, the sequence of the region between llaIM and abiA was determined and revealed four consecutive open reading frames (ORFs). Northern (RNA) analysis showed that the four ORFs were part of a 7-kb operon with llaIM and the downstream abiA gene on a separate transcriptional unit. The deduced protein sequence of ORF2 revealed a P-loop consensus motif for ATP/GTP-binding sites and a three-part consensus motif for GTP-binding proteins. Data bank searches with the deduced protein sequences for all four ORFs revealed no homology except for ORF2 with MerB, in three regions that coincided with the GTP-binding motifs in both proteins. To phenotypically analyze the llaI operon, a 9.0-kb fragment was cloned into a high-copy-number lactococcal shuttle vector, pTRKH2. The resulting construct, pTRK370, exhibited a significantly higher level of in vivo restriction and modification in L. lactis NCK203 than the low-copy-number parental plasmid, pTR2030. A combination of deletion constructions and frameshift mutations indicated that the first three ORFs were involved in LlaI restriction, and they were therefore designated llaI.1, llaI.2, and llaI.3. Mutating llaI.1 completely abolished restriction, while disrupting llaI.2 or llaI.3 allowed an inefficient restriction of phage DNA to occur, manifested primarily by a variable plaque phenotype. ORF4 had no discernible effect on in vivo restriction. A frameshift mutation in llaIM proved lethal to L. lactis NCK203, implying that the restriction component was active without the modification subunit. These results suggested that the LlaI R/M system is unlike any other R/M system studied to date and has diverged from the type IIS class of restriction enzymes by acquiring some characteristics reminiscent of type I enzymes.
|
163. |
Dammel CS,
Noller HF,
( 1995 ) Suppression of a cold-sensitive mutation in 16S rRNA by overexpression of a novel ribosome-binding factor, RbfA. PMID : 7535280 : DOI : 10.1101/gad.9.5.626 Abstract >>
A novel 15-kDa protein, RbfA, has been identified by virtue of its ability to act as a high copy suppressor of a previously characterized dominant cold-sensitive mutation (C23U) in 16S rRNA. RbfA is found associated with free 30S ribosomal subunits, but not with 70S ribosomes or polysomes, and is essential for maximal cell growth, particularly at low temperatures. Cells lacking RbfA in a wild-type rRNA background exhibit a cold-sensitive phenotype that is strikingly similar to that of the cold-sensitive C23U rRNA mutant. The observed patterns of allele specificity of suppression and synthetic lethality in cells containing an RbfA knockout in combination with various 16S rRNA mutations suggests that RbfA interacts with the 5'-terminal helix region of 16S rRNA, possibly during a late step of 30S maturation.
|
164. |
Bolhuis H,
Poelarends G,
van Veen HW,
Poolman B,
Driessen AJ,
Konings WN,
( 1995 ) The Lactococcal lmrP gene encodes a proton motive force-dependent drug transporter. PMID : 7592810 : DOI : 10.1074/jbc.270.44.26092 Abstract >>
To genetically dissect the drug extrusion systems of Lactococcus lactis, a chromosomal DNA library was made in Escherichia coli and recombinant strains were selected for resistance to high concentrations of ethidium bromide. Recombinant strains were found to be resistant not only to ethidium bromide but also to daunomycin and tetraphenylphosphonium. The drug resistance is conferred by the lmrP gene, which encodes a hydrophobic polypeptide of 408 amino acid residues with 12 putative membrane-spanning segments. Some sequence elements in this novel membrane protein share similarity to regions in the transposon Tn10-encoded tetracycline resistance determinant TetA, the multidrug transporter Bmr from Bacillus subtilis, and the bicyclomycin resistance determinant Bcr from E. coli. Drug resistance associated with lmrP expression correlated with energy-dependent extrusion of the molecules. Drug extrusion was inhibited by ionophores that dissipate the proton motive force but not by the ATPase inhibitor ortho-vanadate. These observations are indicative for a drug-proton antiport system. A lmrP deletion mutant was constructed via homologous recombinant using DNA fragments of the flanking region of the gene. The L. lactis (delta lmrP) strain exhibited residual ethidium extrusion activity, which in contrast to the parent strain was inhibited by ortho-vanadate. The results indicate that in the absence of the functional drug-proton anti-porter LmrP, L. lactis is able to overexpress another, ATP-dependent, drug extrusion system. These findings substantiate earlier studies on the isolation and characterization of drug-resistant mutants of L. lactis (Bolhuis, H., Molenaar, D., Poelarends, G., van Veen, H. W., Poolman, B., Driessen, A. J. M., and Konings, W. N. (1994) J. Bacteriol. 176, 6957-6964).
|
165. |
Yu W,
Mierau I,
Mars A,
Johnson E,
Dunny G,
McKay LL,
( 1995 ) Novel insertion sequence-like element IS982 in lactococci. PMID : 7568469 : DOI : 10.1006/plas.1995.1023 Abstract >>
A novel insertion sequence-like (IS) element, designated IS982, was found on the lactose plasmid, pSK11L, from Lactococcus lactis subsp. cremoris SK11 and was located between the origin of replication and the oligopeptide transport gene cluster. The 1003-base pair (bp) IS982 was flanked by 18-bp perfect inverted repeats. IS982 contained an open reading frame encoding a putative transposase of 296 amino acids. An almost identical IS-like element (99% DNA sequence identity) was cloned and partially sequenced from the chromosome of Lactococcus lactis subsp. cremoris Wg2 with 17-bp perfect inverted repeats. Southern analysis indicated that in 12 lactococcal strains examined, IS982 was present with copy numbers ranging from 1 to at least 20. IS982 displayed sequence homology to the putative IS element RSBst-alpha from Bacillus stearothermophilus CU21, IS982 and RSBst-alpha were not related to other known insertion sequences and may represent a new family of IS elements.
|
166. |
Poyart C,
Berche P,
Trieu-Cuot P,
( 1995 ) Characterization of superoxide dismutase genes from gram-positive bacteria by polymerase chain reaction using degenerate primers. PMID : 7557308 : DOI : 10.1016/0378-1097(95)00232-t Abstract >>
An internal fragment representing approximately 85% of sod genes from seven Gram-positive bacteria was amplified by using degenerate primers in a polymerase chain reaction assay. The DNA sequences of sod polymerase chain reaction products from Clostridium perfringens, Enterococcus faecalis, Enterococcus faecium, Lactococcus lactis, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus pneumoniae, and Streptococcus pyogenes were determined. Comparisons of their deduced amino acid sequences with those of the corresponding regions of the SOD proteins from Bacillus stearothermophilus, Listeria monocytogenes, and Streptococcus mutans revealed strong relatedness. Phylogenetic analysis of SOD peptides showed that members of the genera Streptococcus and those of the genera Enterococcus constitute two well-supported monophyletic groups. The method described in this study provides a means for easy recovery of sod genes and the construction of sod mutants of various Gram-positive pathogens.
|
167. |
Beresford T,
Condon S,
( 1993 ) Physiological and genetic regulation of rRNA synthesis in Lactococcus. PMID : 7504067 : DOI : 10.1099/00221287-139-9-2009 Abstract >>
The macromolecular composition of Lactococcus was regulated by growth rate in the same general way as that of less fastidious bacteria such as Escherichia coli and Salmonella typhimurium. The ratios of RNA:DNA and RNA:protein increased approximately threefold over a 13.5-fold increase in growth rate, whereas the ratio of DNA:protein remained approximately constant. Using reporter genes fused to a DNA fragment of a cloned lactococcal rRNA operon, promoter activity was located upstream of the 16S rRNA structural gene. This DNA fragment had some characteristics typical of a rrn promoter in E. coli. Two consensus promoter sequences P1 and P2 were located 296 and 157 bp, respectively, upstream of the start of the 16S rRNA gene. Between P2 and the start of the 16S rRNA gene, sequences were identified with typical anti-termination motifs characteristic of E. coli rrn promoter regions. A putative transcription terminator sequence was identified downstream of the 5S rRNA gene and putative primary RNA transcript processing sites at both ends of the lactococcal rRNA operon were also noted.
|
168. |
Chopin A,
Chopin MC,
Moillo-Batt A,
Langella P,
( 1984 ) Two plasmid-determined restriction and modification systems in Streptococcus lactis. PMID : 6087394 : Abstract >>
Two restriction and modification systems were found in Streptococcus lactis strain IL594 which was found to contain 9 plasmids designated pIL1 to pIL9. On the basis of protoplast-induced curing experiments, we showed that a restriction and modification system was related to the presence of pIL6 or pIL7. The pIL6-determined restriction and modification system was confirmed by cotransfer of the plasmid and of the restriction and modification system to a plasmid-free, nonrestricting, and nonmodifying derivative of S. lactis IL594.
|
169. |
Waterfield NR,
Le Page RW,
Wilson PW,
Wells JM,
( 1995 ) The isolation of lactococcal promoters and their use in investigating bacterial luciferase synthesis in Lactococcus lactis. PMID : 7489923 : DOI : 10.1016/0378-1119(95)00484-n Abstract >>
18 different promoter elements, encompassing a 71-fold range of activity, were isolated from the chromosome of Lactococcus lactis (Ll) MG1363 and from an uncharacterised small isometric bacteriophage of Ll. The Vibrio fischeri (Vf) luciferase-encoding gene (lux) was used as a reporter in Ll, so that the promoters could be identified strictly on the basis of their activity in the homologous host. Sequence and primer extension analysis of six of the promoters has provided a new consensus sequence for the -35 and -10 hexanucleotide motifs present upstream from lactococcal transcription start points. When the nucleotide sequence of the most active promoter (P15) was compared with that of the highly expressed Ll usp45 gene, a novel 8-bp region of homology was identified which corresponded to the newly derived consensus -35 sequence element; this element may therefore be of general importance in Ll gene expression. The isolation of these promoters has also enabled us to investigate the characteristics of the Vf Lux activity in Ll under different physiological conditions using promoters of different strengths. Lux activity in Ll is critically dependent upon the phase of cell growth. Luminescence falls sharply in stationary phase, possibly due to a lack of FMNH2. In contrast to the kinetics of Lux function in Escherichia coli (Ec), Lux activity in Ll declines rapidly after addition of the substrate; the rate of decay is dependent both on the growth phase and on the strength of the promoter. It is apparent that the previously reported thermal instability of Lux is in fact a function of the host organism in which Lux is expressed.(ABSTRACT TRUNCATED AT 250 WORDS)
|
170. |
López de Felipe F,
Magni C,
de Mendoza D,
López P,
( 1995 ) Citrate utilization gene cluster of the Lactococcus lactis biovar diacetylactis: organization and regulation of expression. PMID : 7535377 : DOI : 10.1007/bf00298965 Abstract >>
The transport of citrate in Lactococcus lactis biovar diacetylactis is mediated by the citrate permease P. This polypeptide is encoded by the citP gene carried by plasmid pCIT264. In this report, we characterize the citP transcript, identify a cluster of two genes cotranscribed with citP and describe their post-transcriptional regulation. The transcriptional promoter is located 1500 nucleotides upstream of the citP gene and the transcriptional terminator is positioned next to the 3'-end of this gene. The DNA sequence was determined of the region upstream of the citP gene, including the promoter. Two partially overlapping open reading frames, citQ and citR were identified, which could encode polypeptides of 3.9 and 13 kDa respectively. These two genes, together with citP, constitute the cit cluster. Moreover, an IS-like element located between the cit promoter and the citQ open reading frame was identified. This element includes an open reading frame ORF1, which could encode a 33 kDa polypeptide. A translational fusion between the citP and a cat reporter gene showed that translation of citR and citP is coupled, and regulated by CitR. The cit mRNA was subjected to specific cleavage after addition of rifampicin to the bacterial cultures. We propose that expression of the cit cluster is controlled at the post-transcriptional level by mRNA processing at a putative complex secondary structure and by translational repression mediated by CitR.
|
171. |
Henner DJ,
Band L,
Shimotsu H,
( 1985 ) Nucleotide sequence of the Bacillus subtilis tryptophan operon. PMID : 3924737 : DOI : 10.1016/0378-1119(85)90125-8 Abstract >>
In Bacillus subtilis, tryptophan biosynthesis is one of the most thoroughly characterized biosynthetic pathways. Recombinant DNA methodology has permitted a rapid characterization of the tryptophan (trp) gene cluster at the molecular level. In this report the nucleotide sequence of the six structural genes together with the intercistronic regions and flanking regulatory regions are presented.
|
172. |
Friedrich K,
Brombach M,
Pon CL,
( 1988 ) Identification, cloning and sequence of the Streptococcus faecium infB (translational initiation factor IF2) gene. PMID : 3063954 : DOI : 10.1007/bf00330501 Abstract >>
The structural gene for translational initiation factor IF2 (infB) from Streptococcus faecium was identified by cross-hybridization with DNA probes derived from the corresponding gene of Bacillus stearothermophilus. The entire infB gene (ca. 2.8 kb) was cloned and sequenced. The amino acid sequence deduced from the nucleotide sequence shows that S. faecium initiation factor IF2 (785 amino acids, Mr 86,415) displays extensive homology (ca. 69% and 53%) with the region comprising three-quarters of the molecule from the carboxy-terminus of B. stearothermophilus and Escherichia coli IF2, respectively. The region comprising one-quarter of the molecule from the amino-terminus, on the other hand, does not display any significant homology.
|
173. |
López-González MJ,
Escobedo S,
Rodríguez A,
Neves AR,
Janzen T,
Martínez B,
( 2018 ) Adaptive Evolution of Industrial Lactococcus lactis Under Cell Envelope Stress Provides Phenotypic Diversity. PMID : 30455679 : DOI : 10.3389/fmicb.2018.02654 PMC : PMC6230721 Abstract >>
Lactococcus lactis is widely used as a starter in the manufacture of cheese and fermented milk. Its main role is the production of lactic acid, but also contributes to the sensory attributes of cheese. Unfortunately, the diversity of suitable strains to be commercialized as dairy starters is limited. In this work, we have applied adaptive evolution under cell envelope stress (AE-CES) as means to provide evolved L. lactis strains with distinct physiological and metabolic traits. A total of seven strains, three of industrial origin and four wild nisin Z-producing L. lactis, were exposed to subinhibitory concentrations of Lcn972, a bacteriocin that triggers the cell envelope stress response in L. lactis. Stable Lcn972 resistant (Lcn972R) mutants were obtained from all of them and two mutants per strain were further characterized. Minimal inhibitory Lcn972 concentrations increased from 4- to 32-fold compared to their parental strains and the Lcn972R mutants retained similar growth parameters in broth. All the mutants acidified milk to a pH below 5.3 with the exception of one that lost the lactose plasmid during adaptation and was unable to grow in milk, and two others with slower acidification rates in milk. While in general phage susceptibility was unaltered, six mutants derived from three nisin Z producers became more sensitive to phage attack. Loss of a putative plasmid-encoded anti-phage mechanism appeared to be the reason for phage susceptibility. Otherwise, nisin production in milk was not compromised. Different inter- and intra-strain-dependent phenotypes were observed encompassing changes in cell surface hydrophobicity and in their autolytic profile with Lcn972R mutants being, generally, less autolytic. Resistance to other antimicrobials revealed cross-protection mainly to cell wall-active antimicrobials such as lysozyme, bacitracin, and vancomycin. Finally, distinct and shared non-synonymous mutations were detected in the draft genome of the Lcn972R mutants. Depending on the parental strain, mutations were found in genes involved in stress response, detoxification modules, cell envelope biogenesis and/or nucleotide metabolism. As a whole, the results emphasize the different strategies by which each strain becomes resistant to Lcn972 and supports the feasibility of AE-CES as a novel platform to introduce diversity within industrial L. lactis dairy starters.
|
174. |
Chopin MC,
Chopin A,
Rouault A,
Simon D,
( 1986 ) Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability. PMID : 3006588 : PMC : PMC238852 Abstract >>
Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains.
|
175. |
Daba GM,
Ishibashi N,
Zendo T,
Sonomoto K,
( 2017 ) Functional analysis of the biosynthetic gene cluster required for immunity and secretion of a novel Lactococcus-specific bacteriocin, lactococcin Z. PMID : 28815820 : DOI : 10.1111/jam.13564 Abstract >>
Characterization of the biosynthesis (secretion and immunity) of lactococcin Z. Lactococcin Z is produced by Lactococcus lactisQU 7. DNA sequence analysis revealed that the lactococcin Z gene cluster (c. 5�P1 kb) includes four genes encoding putative biosynthetic proteins, LczB (self-immunity protein), LczC (an ABC transporter) and LczD (a transport accessory protein), besides the previously identified LczA. LczB showed 25�P5% identity to LciA, the lactococcin A immunity protein, while LczC and LczD had 93�P7 and 95�P3% identities, respectively, to corresponding proteins of lactococcin A. Heterologous expression of various combinations of the four genes indicated that lczB confers self-immunity against lactococcin Z, and that the four genes are necessary to produce lactococcin Z. However, LczB and LciA showed no cross-immunity to lactococcins A and Z respectively. The results verified that LczB is the lactococcin Z immunity protein, and LczC is responsible for lactococcin Z secretion in a manner dependent on LczD expression. The biosynthesis (secretion and immunity) of a new Lactococcus-specific bacteriocin, lactococcin Z, was characterized. Moreover, the results suggested that lactococcin Z has different immunity and action mechanisms from other Lactococcus-specific bacteriocins.
|
176. |
( 1996 ) Cloning and analysis of the restriction-modification system LlaBI, a bacteriophage resistance system from Lactococcus lactis subsp. cremoris W56. PMID : 8795244 : PMC : PMC168150 Abstract >>
|
177. |
( 2013 ) The Type ISP Restriction-Modification enzymes LlaBIII and LlaGI use a translocation-collision mechanism to cleave non-specific DNA distant from their recognition sites. PMID : 23222132 : DOI : 10.1093/nar/gks1209 PMC : PMC3553950 Abstract >>
The Type ISP Restriction-Modification (RM) enzyme LlaBIII is encoded on plasmid pJW566 and can protect Lactococcus lactis strains against bacteriophage infections in milk fermentations. It is a single polypeptide RM enzyme comprising Mrr endonuclease, DNA helicase, adenine methyltransferase and target-recognition domains. LlaBIII shares >95% amino acid sequence homology across its first three protein domains with the Type ISP enzyme LlaGI. Here, we determine the recognition sequence of LlaBIII (5'-TnAGCC-3', where the adenine complementary to the underlined base is methylated), and characterize its enzyme activities. LlaBIII shares key enzymatic features with LlaGI; namely, adenosine triphosphate-dependent DNA translocation (?309 bp/s at 25�XC) and a requirement for DNA cleavage of two recognition sites in an inverted head-to-head repeat. However, LlaBIII requires K(+) ions to prevent non-specific DNA cleavage, conditions which affect the translocation and cleavage properties of LlaGI. By identifying the locations of the non-specific dsDNA breaks introduced by LlaGI or LlaBIII under different buffer conditions, we validate that the Type ISP RM enzymes use a common translocation-collision mechanism to trigger endonuclease activity. In their favoured in vitro buffer, both LlaGI and LlaBIII produce a normal distribution of random cleavage loci centred midway between the sites. In contrast, LlaGI in K(+) ions produces a far more distributive cleavage profile.
|
178. |
( 2012 ) Use of tuf as a target for sequence-based identification of Gram-positive cocci of the genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus. PMID : 23181410 : DOI : 10.1186/1476-0711-11-31 PMC : PMC3533577 Abstract >>
Accurate identification of isolates belonging to genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus at the species level is necessary to provide a better understanding of their pathogenic potential, to aid in making clinical decisions, and to conduct epidemiologic investigations,especially when large blind samples must be analyzed. It is useful to simultaneously identify species in different genera using a single primer pair. We developed a primer pair based on the tuf gene (encoding elongation factor) sequence to identify 56 Gram-positive cocci isolates. The target sequences were amplified from all 56 samples. The sequencing results and the phylogenetic tree derived from the partial tuf gene sequences identified the isolates as three enterococcal species, two lactococcal species, two staphylococcal species, and six streptococcal species, as well as eight isolates that were novel species of the genus Streptococcus. Partial gene sequence analysis of the sodA, dnaK, and 16S RNA genes confirmed the results obtained by tuf gene sequencing. Based on the uniform amplification of the tuf gene from all samples and the ability to identify all isolates at both the genus and species levels, we conclude that the primer pair developed in this research provides a powerful tool for identifying these organisms in clinical laboratories where large blind samples are used.
|
179. |
( 2012 ) Identification of the genes involved in the secretion and self-immunity of lacticin Q, an unmodified leaderless bacteriocin from Lactococcus lactis QU 5. PMID : 23103973 : DOI : 10.1099/mic.0.062943-0 Abstract >>
Lacticin Q (LnqQ) produced by Lactococcus lactis QU 5 is an unmodified linear bacteriocin, which is synthesized without an N-terminal leader peptide. In vitro synthesis and in vivo expression of LnqQ have revealed the intracellular toxicity of this leaderless peptide, as well as the necessity of a dedicated secretion and self-immunity system of producer cells. Further DNA sequencing and analysis have discovered 11 putative orf genes at the LnqQ locus. None of the orf genes showed similarities to any of the bacteriocin biosynthetic genes characterized to date; however, six orf genes (orf2q-7q), not including the structural gene (lnqQ), were highly conserved at the lacticin Z locus (orf2z-7z), which is a LnqQ homologue produced by L. lactis QU 14. ORF2q (ORF2z), the gene of which is located upstream of the structural gene, is a putative transcriptional regulator, whereas ORF6q and ORF7q (ORF6z and ORF7z) form a putative ATP-binding cassette transporter. The ORF3q-5q (ORF3z-5z) are all predicted to be membrane proteins with no clear functions. Co-expression of LnqQ and ORF3q-7q in a heterologous host allowed the extracellular production of LnqQ; additionally, the expression of ORF3q-7q rendered the host cells immune to LnqQ. This self-immunity was facilitated possibly by two means; firstly, by secreting the active LnqQ peptides, thus reducing the intracellular toxicity, and secondly, by protecting the host cells from extracellularly released LnqQ. This is the first report, to our knowledge, that describes intracellular toxicity of a leaderless bacteriocin and provides a rare example of biosynthetic genes that are required for bacteriocin secretion and immunity.
|
180. |
( 1999 ) Genetic organization and functional analysis of a novel phage abortive infection system, AbiL, from Lactococcus lactis. PMID : 9990732 : Abstract >>
A plasmid-encoded phage abortive infection mechanism (AbiL) was identified from Lactococcus lactis biovar. diacetylactis LD10-1. AbiL conferred complete resistance to the small isometric-headed phage phi 712 (936 species) and partial resistance to the prolate-headed phage phi c2 (c2 species) when introduced into L. lactis LM0230. However, AbiL was not effective against the small isometric-headed phage ul36 (P335 species). The AbiL determinant was sequenced and it consists of two open reading frames, abiLi and abiLii. Their encoded proteins did not share significant homology with any known proteins in the protein databases. Transcriptional analysis indicated that abiLi and abiLii are organized as a single operon. Deletion within abiLii abolished the phage resistance. The levels of four phi c2-specific transcripts, three within the early transcribed region and one within the late transcribed region, were examined by RT-PCR, no effect of AbiL on synthesis of these transcripts was detected, suggesting that AbiL may act at a point after the transcription of phi c2 in L. lactis.
|
181. |
( 1998 ) Cloning and expression of the Lactococcus lactis purDEK genes, required for growth in milk. PMID : 9797284 : PMC : PMC106646 Abstract >>
An operon containing the genes purD and purE and part of the purK gene was cloned from the facultative anaerobic gram-positive bacterium Lactococcus lactis by complementation of the purD mutation in Escherichia coli SO609. The genes encode enzymes in the de novo pathway of purine nucleotides. The expression of the genes was regulated approximately 35-fold at the transcription level by the availability of purines in the growth medium. Deletion analysis of the nucleotide region upstream of purD indicated that a region of 145 bp is enough to give regulated expression of the reporter lacLM genes, which encode beta-galactosidase. Deletion of a region 79 bp upstream of the transcription start point reduced the promoter activity 33-fold when incubated in a purine-free medium and to values below the detection limit when incubated in a purine-containing medium. No secondary transcription start points were mapped in or close to this region, indicating that a putative activator site and not a promoter was deleted or partly destroyed.
|
182. |
( 1998 ) Sequence and analysis of the 60 kb conjugative, bacteriocin-producing plasmid pMRC01 from Lactococcus lactis DPC3147. PMID : 9767571 : DOI : 10.1046/j.1365-2958.1998.00988.x Abstract >>
The complete sequence of pMRC01, a large conjugative plasmid from Lactococcus lactis ssp. lactis DPC3147, has been determined. Using a shotgun sequencing approach, the 60,232 bp plasmid sequence was obtained by the assembly of 1056 underlying sequences (sevenfold average redundancy). Sixty-four open reading frames (ORFs) were identified. Analysis of the gene organization of pMRC01 suggests that the plasmid can be divided into three functional domains, with each approximately 20 kb region separated by insertion sequence (IS) elements. The three regions are (i) the conjugative transfer region, including a 16-gene Tra (transfer) operon; (ii) the bacteriocin production region, including an operon responsible for the synthesis of the novel bacteriocin lacticin 3147; and (iii) the phage resistance and plasmid replication region of the plasmid. The complete sequence of pMRC01 provides important information about these industrially relevant phenotypes and gives insight into the structure, function and evolution of large gram-positive conjugative plasmids in general. The completely sequenced pMRC01 plasmid should also provide a useful framework for the design of novel plasmids to be incorporated into starter strain improvement programmes for the dairy industry.
|
183. |
( 1998 ) AbiQ, an abortive infection mechanism from Lactococcus lactis. PMID : 9835558 : PMC : PMC90918 Abstract >>
Lactococcus lactis W-37 is highly resistant to phage infection. The cryptic plasmids from this strain were coelectroporated, along with the shuttle vector pSA3, into the plasmid-free host L. lactis LM0230. In addition to pSA3, erythromycin- and phage-resistant isolates carried pSRQ900, an 11-kb plasmid from L. lactis W-37. This plasmid made the host bacteria highly resistant (efficiency of plaquing <10(-8)) to c2- and 936-like phages. pSRQ900 did not confer any resistance to phages of the P335 species. Adsorption, cell survival, and endonucleolytic activity assays showed that pSRQ900 encodes an abortive infection mechanism. The phage resistance mechanism is limited to a 2.2-kb EcoRV/BclI fragment. Sequence analysis of this fragment revealed a complete open reading frame (abiQ), which encodes a putative protein of 183 amino acids. A frameshift mutation within abiQ completely abolished the resistant phenotype. The predicted peptide has a high content of positively charged residues (pI = 10.5) and is, in all likelihood, a cytosolic protein. AbiQ has no homology to known or deduced proteins in the databases. DNA replication assays showed that phage c21 (c2-like) and phage p2 (936-like) can still replicate in cells harboring AbiQ. However, phage DNA accumulated in its concatenated form in the infected AbiQ+ cells, whereas the AbiQ- cells contained processed (mature) phage DNA in addition to the concatenated form. The production of the major capsid protein of phage c21 was not hindered in the cells harboring AbiQ.
|
184. |
( 1998 ) Cloning of the Lactococcus lactis adhE gene, encoding a multifunctional alcohol dehydrogenase, by complementation of a fermentative mutant of Escherichia coli. PMID : 9620952 : PMC : PMC107803 Abstract >>
The Lactococcus lactis adhE gene, which encodes a multifunctional alcohol dehydrogenase, has been cloned and characterized. A DNA fragment encoding the putative alcohol dehydrogenase domain of the AdhE protein was cloned by screening an L. lactis genomic library in a fermentative mutant of Escherichia coli and selecting for the ability to grow anaerobically. Further analysis of the clone obtained allowed the cloning of the entire adhE gene sequence. Analysis of adhE expression in L. lactis during anaerobiosis showed induction at the transcriptional level, especially in medium containing glucose. Constructed mutant strains produced reduced amounts of ethanol under anaerobic conditions. With the L. lactis gene as a probe, adhE homologs were found in other industrially relevant lactic acid bacteria.
|
185. |
( 1999 ) 6-Phosphogluconate dehydrogenase from Lactococcus lactis: a role for arginine residues in binding substrate and coenzyme. PMID : 9931298 : PMC : PMC1220024 Abstract >>
A gene encoding 6-phosphogluconate dehydrogenase (6-PGDH, EC 1.1.1. 44) was identified from the homofermentative lactic acid bacterium Lactococcus lactis, by complementation of Escherichia coli mutants. The cloned gene was then expressed to high levels in E. coli and the protein purified for kinetic analysis. The enzyme had a Km for 6-phosphogluconate of 15.4+/-1.4 microM and for NADP of 1.9+/-0.2 microM at pH 7.5. Sequence comparison of the L. lactis 6-PGDH with the corresponding enzyme derived from the pathogenic protozoan Trypanosoma brucei and sheep liver revealed the substrate-binding residues to be identical in all three species, although the three coenzyme-binding pockets differed slightly. A totally conserved arginine residue (Arg-447), believed to bind the 6-phosphate of substrate, was mutated to lysine, aspartate, alanine or tryptophan. In each case enzyme activity was lost, confirming an essential role for this residue on activity. A second arginine (Arg-34), believed to be critical in binding the 2'-phosphate of cofactor NADP+, was mutated to a tyrosine residue, as found in one atypical isoform of the enzyme in Bacillus subtilis. This alteration led to decrease in affinity for NADP+ of nearly three orders of magnitude. A second 6-PGDH gene has been identified from the genome of B. subtilis. This second isoform contains an arginine (Arg-34) in this position, suggesting that B. subtilis has two 6-PGDHs with different coenzyme specificities.
|
186. |
( 1998 ) Identification of a sodium chloride-regulated promoter in Lactococcus lactis by single-copy chromosomal fusion with a reporter gene. PMID : 9604892 : DOI : 10.1007/s004380050697 Abstract >>
An integration vector, pORI13, was developed to screen in Lactococcus lactis for expression signals induced by changes in the environment and to assay transcriptional activity of genes in single copy. The plasmid carries a promoterless Escherichia coli lacZ gene preceded by a start codon, a lactococcal ribosome binding site, and a multiple cloning site. Chromosomal Sau3AI fragments of L. lactis MG1363 DNA were cloned in pORI13 using a RepA+ E. coli as host. The resulting bank of plasmids was used for Campbell-type integration into the chromosome of L. lactis MG1363. The relatively large size of the chromosomal fragments used increases the chance of retaining complete genes in the targeted region. Screening of integrants in the presence of 0.3 M NaCl resulted in the isolation of a clone (NS3) in which expression of lacZ was dependent on the concentration of chloride ions.
|
187. |
( 1998 ) Molecular characterization of the Lactococcus lactis LlaKR2I restriction-modification system and effect of an IS982 element positioned between the restriction and modification genes. PMID : 9811640 : PMC : PMC107656 Abstract >>
The nucleotide sequence of the plasmid-encoded LlaKR2I restriction-modification (R-M) system of Lactococcus lactis subsp. lactis biovar diacetylactis KR2 was determined. This R-M system comprises divergently transcribed endonuclease (llaKR2IR) and methyltransferase (llaKR2IM) genes; located in the intergenic region is a copy of the insertion element IS982, whose putative transposase gene is codirectionally transcribed with llaKR2IM. The deduced sequence of the LlaKR2I endonuclease shared homology with the type II endonuclease Sau3AI and with the MutH mismatch repair protein, both of which recognize and cleave the sequence 5' GATC 3'. In addition, M. LlaKR2I displayed homology with the 5-methylcytosine methyltransferase family of proteins, exhibiting greatest identity with M. Sau3AI. Both of these proteins shared notable homology throughout their putative target recognition domains. Furthermore, subclones of the native parental lactococcal plasmid pKR223, which encode M. LlaKR2I, all remained undigested after treatment with Sau3AI despite the presence of multiple 5' GATC 3' sites. The combination of these data suggested that the specificity of the LlaKR2I R-M system was likely to be 5' GATC 3', with the cytosine residue being modified to 5-methylcytosine. The IS982 element located within the LlaKR2I R-M system contained at its extremities two 16-bp perfect inverted repeats flanked by two 7-bp direct repeats. A perfect extended promoter consensus, which represented the likely original promoter of the llaKR2IR gene, was shown to overlap the direct repeat sequence on the other side of IS982. Specific deletion of IS982 and one of these direct repeats via a PCR strategy indicated that the LlaKR2I R-M determinants do not rely on elements within IS982 for expression and that the efficiency of bacteriophage restriction was not impaired.
|
188. |
( 1998 ) Transcriptional regulation and evolution of lactose genes in the galactose-lactose operon of Lactococcus lactis NCDO2054. PMID : 9733693 : PMC : PMC107515 Abstract >>
The genetics of lactose utilization within the slow-lactose-fermenting Lactococcus lactis strain NCDO2054 was studied with respect to the organization, expression, and evolution of the lac genes. Initially the beta-galactosidase gene (lacZ) was cloned by complementation of an Escherichia coli mutant on a 7-kb HpaI fragment. Nucleotide sequence analysis of the complete fragment revealed part of a gal-lac operon, and the genes were characterized by inactivation and complementation analyses and in vitro enzyme activity measurements. The gene order is galK-galT-lacA-lacZ-galE; the gal genes encode enzymes of the Leloir pathway for galactose metabolism, and lacA encodes a galactoside acetyltransferase. The galT and galE genes of L. lactis LM0230 (a lactose plasmid-cured derivative of the fast-lactose-fermenting L. lactis C2) were highly similar at the nucleotide sequence level to their counterparts in strain NCDO2054 and, furthermore, had the same gene order except for the presence of the intervening lacA-lacZ strain NCDO2054. Analysis of mRNA for the gal and lac genes revealed an unusual transcriptional organization for the operon, with a surprisingly large number of transcriptional units. The regulation of the lac genes was further investigated by using fusions consisting of putative promoter fragments and the promoterless beta-glucuronidase gene (gusA) from E. coli, which identified three lactose-inducible intergenic promoters in the gal-lac operon. The greater similarity of the lacA and lacZ genes to homologs in gram-negative organisms than to those of gram-positive bacteria, in contrast to the homologies of the gal genes, suggests that the genes within the gal operon of L. lactis NCDO2054 have been recently acquired. Thus, the lacA-lacZ genes appear to have engaged the promoters of the gal operon in order to direct and control their expression.
|
189. |
( 1999 ) LlaFI, a type III restriction and modification system in Lactococcus lactis. PMID : 9925601 : PMC : PMC91080 Abstract >>
We describe a type III restriction and modification (R/M) system, LlaFI, in Lactococcus lactis. LlaFI is encoded by a 12-kb native plasmid, pND801, harbored in L. lactis LL42-1. Sequencing revealed two adjacent open reading frames (ORFs). One ORF encodes a 680-amino-acid polypeptide, and this ORF is followed by a second ORF which encodes an 873-amino-acid polypeptide. The two ORFs appear to be organized in an operon. A homology search revealed that the two ORFs exhibited significant similarity to type III restriction (Res) and modification (Mod) subunits. The complete amino acid sequence of the Mod subunit of LlaFI was aligned with the amino acid sequences of four previously described type III methyltransferases. Both the N-terminal regions and the C-terminal regions of the Mod proteins are conserved, while the central regions are more variable. An S-adenosyl methionine (Ado-Met) binding motif (present in all adenine methyltransferases) was found in the N-terminal region of the Mod protein. The seven conserved helicase motifs found in the previously described type III R/M systems were found at the same relative positions in the LlaFI Res sequence. LlaFI has cofactor requirements for activity that are characteristic of the previously described type III enzymes. ATP and Mg2+ are required for endonucleolytic activity; however, the activity is not strictly dependent on the presence of Ado-Met but is stimulated by it. To our knowledge, this is the first type III R/M system that has been characterized not just in lactic acid bacteria but also in gram-positive bacteria.
|
190. |
( N/A ) Characterization of LlaCI, a new restriction-modification system from Lactococcus lactis subsp. cremoris W15. PMID : 9628336 : Abstract >>
The genes encoding the restriction-modification (R/M) system LlaCI have been found on the naturally occurring 7.0 kb plasmid pAW153 in L. lactis subsp. cremoris W15. The R/M system was isolated on a chloramphenicol resistant derivative of the wild type plasmid (pAW153cat). Plasmid pAW153cat and a 2.4 kb HincII-SphI fragment cloned into a high- and a low-copy vector conferred decreased sensitivity in L. lactis LM2301 and L. lactis SMQ86 against small isometric-headed phages of the 936 or P335 species, respectively. Increased plasmid copy number enhanced the level of phage restriction. Sequencing the 2.4 kb HincII-SphI fragment revealed two open reading frames arranged convergently with a 94 bp separation. IlaCIM showed 66% identity to hindIIIM, and IlaCIR showed 45% identity to hindIIIR. The organization of the LlaCI operon differs from the HindIII operon, where the endonuclease and methylase genes overlap and are transcribed in the same direction. The LlaCI methylase is predicted to be 296 amino acids long, with 63% identity to the HindIII methylase, while the LlaCI endonuclease is predicted to consist of 324 or 332 amino acids, depending on the position of the start codon. It shows 24% identity to the HindIII endonuclease.
|
191. |
( 1998 ) Genetic characterization of pepP, which encodes an aminopeptidase P whose deficiency does not affect Lactococcus lactis growth in milk, unlike deficiency of the X-prolyl dipeptidyl aminopeptidase. PMID : 9797327 : PMC : PMC106689 Abstract >>
We sequenced the pepP gene of Lactococcus lactis, which encodes an aminopeptidase P (PepP), and demonstrated that the X-prolyl dipeptidyl aminopeptidase PepX plays a more important role than PepP in nitrogen nutrition. PepP shares homology with methionine aminopeptidases and could play a role in the maturation of nascent proteins.
|
192. |
( 1997 ) Duplication of the pepF gene and shuffling of DNA fragments on the lactose plasmid of Lactococcus lactis. PMID : 9209029 : DOI : 10.1128/jb.179.13.4164-4171.1997 PMC : PMC179235 Abstract >>
The gene corresponding to the lactococcal oligopeptidase PepF1 (formerly PepF [V. Monnet, M. Nardi, A. Chopin, M.-C. Chopin, and J.-C. Gripon, J. Biol. Chem. 269:32070-32076, 1994]) is located on the lactose-proteinase plasmid of Lactococcus lactis subsp. cremoris NCDO763. Use of the pepF1 gene as a probe with different strains showed that pepF1 is present on the chromosome of Lactococcus lactis subsp. lactis IL1403, whereas there is a second, homologous gene, pepF2, on the chromosome of strain NCDO763. From hybridization, PCR amplification, and sequencing experiments, we deduced that (i) pepF1 and pepF2 exhibit 80% identity and encode two proteins which are 84% identical and (ii) pepF2 is included in an operon composed of three open reading frames and is transcribed from two promoters. The protein, encoded by the gene located downstream of pepF2, shows significant homology with methyltransferases. Analysis of the sequences flanking pepF1 and pepF2 indicates that only a part of the pepF2 operon is present on the plasmid of strain NCDO763, while the operon is intact on the chromosome of strain IL1403. Traces of several recombination events are visible on the lactose-proteinase plasmid. This suggests that the duplication of pepF occurred by recombination from the chromosome of an L. lactis subsp. lactis strain followed by gene transfer. We discuss the possible functions of PepF and the role of its amplification.
|
193. |
( 1998 ) Combinational variation of restriction modification specificities in Lactococcus lactis. PMID : 9593305 : DOI : 10.1046/j.1365-2958.1998.00787.x Abstract >>
Three genes coding for a type I R-M system related to the class C enzymes have been identified on the chromosome of Lactococcus lactis strain IL1403. In addition, plasmids were found that encode only the HsdS subunit that directs R-M specificity. The presence of these plasmids in IL1403 conferred a new R-M phenotype on the host, indicating that the plasmid-encoded HsdS is able to interact with the chromosomally encoded HsdR and HsdM subunits. Such combinational variation of type I R-M systems may facilitate the evolution of their specificity and thus reinforce bacterial resistance against invasive foreign unmethylated DNA.
|
194. |
( 1998 ) A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. PMID : 9484886 : DOI : 10.1046/j.1365-2958.1998.00676.x Abstract >>
Previously, a promoter was identified in Lactococcus lactis that is specifically induced by chloride. Here, we describe the nucleotide sequence and functional analysis of two genes transcribed from this promoter, gadC and gadB. GadC is homologous to putative glutamate-gamma-aminobutyrate antiporters of Escherichia coli and Shigella flexneri and contains 12 putative membrane-spanning domains. GadB shows similarity to glutamate decarboxylases. A L. lactis gadB mutant and a strain that is unable to express both gadB and gadC was more sensitive to low pH than the wild type when NaCl and glutamate were present. Expression of gadCB in L. lactis in the presence of chloride was increased when the culture pH was allowed to decrease to low levels by omitting buffer from the medium, while glutamate also stimulated gadCB expression. Apparently, these genes encode a glutamate-dependent acid resistance mechanism of L. lactis that is optimally active under conditions in which it is needed to maintain viability. Immediately upstream of the chloride-dependent gadCB promoter Pgad, a third gene encodes a protein (GadR) that is homologous to the activator Rgg from Streptococcus gordonii. gadR expression is chloride and glutamate independent. A gadR mutant did not produce the 3kb gadCB mRNA that is found in wild-type cells in the presence of NaCl, indicating that GadR is an activator of the gadCB operon.
|
195. |
( 1998 ) Control of expression of LlaI restriction in Lactococcus lactis. PMID : 9535090 : DOI : 10.1046/j.1365-2958.1998.00748.x Abstract >>
The plasmid encoded LlaI R/M system from Lactococcus lactis ssp. lactis consists of a bidomain methylase, with close evolutionary ties to type IIS methylases, and a trisubunit restriction complex. Both the methylase and restriction subunits are encoded on a polycistronic 6.9 kb operon. In this study, the 5' end of the llal 6.9 kb transcript was determined by primer extension analysis to be 254 bp upstream from the first R/M gene on the operon, llalM. Deletion of this promoter region abolished LlaI restriction in L. lactis. Analysis of the intervening sequence revealed a 72-amino-acid open reading frame, designated llalC, with a conserved ribosome binding site and helix-turn-helix domain. Overexpression of llalC in Escherichia coli with a T7 expression vector produced the predicted protein of 8.2 kDa. Mutation and in trans complementation analyses indicated that C-LlaI positively enhanced LlaI restriction activity in vivo. Northern analysis and transcriptional fusions of the llal promoter to a lacZ reporter gene indicated that C x LlaI did not enhance transcription of the llal operon. Databank searches with the deduced protein sequence for llalC revealed significant homologies to the E. coli Rop regulatory and mRNA stabilizer protein. Investigation of the effect of C x LlaI on enhancement of LlaI restriction in L. lactis revealed that growth at elevated temperatures (40 degrees C) completely abolished any enhancement of restriction activity. These data provide molecular evidence for a mechanism on how the expression of a restriction system in a prokaryote can be drastically reduced during elevated growth temperatures, by a small regulatory protein.
|
196. |
( 1998 ) Nucleotide sequence and analysis of the new chromosomal abortive infection gene abiN of Lactococcus lactis subsp. cremoris S114. PMID : 9503629 : DOI : 10.1111/j.1574-6968.1998.tb12879.x Abstract >>
A 7.275-kb DNA fragment which encodes resistance by abortive infection (Abi+) to bacteriophage was cloned from Lactococcus lactis subsp. cremoris S114. The genetic determinant for abortive infection was subcloned from this fragment. This gene was found to confer a reduction in efficiency of plating and plaque size for prolate-headed bacteriophage phi 53 (group I homology) and for small isometric-headed bacteriophage phi 59 (group III homology). This new gene, termed abiN, is predicted to encode a polypeptide of 178 amino acid residues with a deduced molecular mass of 20,461 Da and an isoelectric point of 4.63. No homology with any previously described genes was found. A probe was used to determine the presence of this gene only in S114 from 31 strains tested.
|
197. |
( 1998 ) An export-specific reporter designed for gram-positive bacteria: application to Lactococcus lactis. PMID : 9537391 : PMC : PMC107106 Abstract >>
The identification of exported proteins by fusion studies, while well developed for gram-negative bacteria, is limited for gram-positive bacteria, in part due to drawbacks of available export reporters. In this work, we demonstrate the export specificity and use of the Staphylococcus aureus secreted nuclease (Nuc) as a reporter for gram-positive bacteria. Nuc devoid of its export signal (called delta(SP)Nuc) was used to create two fusions whose locations could be differentiated. Nuclease activity was shown to require an extracellular location in Lactococcus lactis, thus demonstrating the suitability of delta(SP)Nuc to report protein export. The shuttle vector pFUN was designed to construct delta(SP)Nuc translational fusions whose expression signals are provided by inserted DNA. The capacity of delta(SP)Nuc to reveal and identify exported proteins was tested by generating an L. lactis genomic library in pFUN and by screening for Nuc activity directly in L. lactis. All delta(SP)Nuc fusions displaying a strong Nuc+ phenotype contained a classical or a lipoprotein-type signal peptide or single or multiple transmembrane stretches. The function of some of the predicted signals was confirmed by cell fractionation studies. The fusions analyzed included long (up to 455-amino-acid) segments of the exported proteins, all previously unknown in L. lactis. Homology searches indicate that several of them may be implicated in different cell surface functions, such as nutrient uptake, peptidoglycan assembly, environmental sensing, and protein folding. Our results with L. lactis show that delta(SP)Nuc is well suited to report both protein export and membrane protein topology.
|
198. |
( 1998 ) Identification of the lactococcal exonuclease/recombinase and its modulation by the putative Chi sequence. PMID : 9435243 : DOI : 10.1073/pnas.95.2.626 PMC : PMC18471 Abstract >>
Studies of RecBCD-Chi interactions in Escherichia coli have served as a model to understand recombination events in bacteria. However, the existence of similar interactions has not been demonstrated in bacteria unrelated to E. coli. We developed an in vivo model to examine components of dsDNA break repair in various microorganisms. Here, we identify the major exonuclease in Lactococcus lactis, a Gram-positive organism evolutionarily distant from E. coli, and provide evidence for exonuclease-Chi interactions. Insertional mutants of L. lactis, screened as exonuclease-deficient, affected a single locus and resulted in UV sensitivity and recombination deficiency. The cloned lactococcal genes (called rexAB) restored UV resistance, recombination proficiency, and the capacity to degrade linear DNA, to an E. coli recBCD mutant. In this context, DNA degradation is specifically blocked by the putative lactococcal Chi site (5'-GCGCGTG-3'), but not by the E. coli Chi (5'-GCTGGTGG-3') site. RexAB-mediated recombination was shown to be stimulated approximately 27-fold by lactococcal Chi. Our results reveal that RexAB fulfills the biological roles of RecBCD and indicate that its activity is modulated by a short DNA sequence. We speculate that exonuclease/recombinase enzymes whose activities are modulated by short DNA sequences are widespread among bacteria.
|
199. |
( 1998 ) A type IC restriction-modification system in Lactococcus lactis. PMID : 9440532 : PMC : PMC106898 Abstract >>
Three genes coding for the endonuclease, methylase, and specificity subunits of a type I restriction-modification (R-M) system in the Lactococcus lactis plasmid pIL2614 have been characterized. Plasmid location, sequence homologies, and inactivation studies indicated that this R-M system is most probably of type IC.
|
331, Shih-Pin Rd., Hsinchu 30062, Taiwan
Phone: +886-3-5223191
E-mail: bcrcweb@firdi.org.tw
web maintainance: +886-3-5223191 ext 593
Copyright © 2018.BCRC All rights reserved.The duplication or use of information and data such as texts or images or any linkage the website at the "bcrc.firdi.org.tw" is only permitted with the indication of the source or with prior approval by the BCRC(Bioresource Collection and Research Center).