1. |
Marin R,
Tanguay RM,
Valéro J,
Letarte R,
Bellemare G,
( 1992 ) Isolation and sequence of a 2-kbp miniplasmid from Bacillus thuringiensis var. kurstaki HD-3a3b: relationship with miniplasmids of other B. thuringiensis strains. PMID : 1426990 : DOI : 10.1016/0378-1097(92)90641-z Abstract >>
The miniplasmid profiles of 18 Bacillus thuringiensis strains belonging to 8 different serotypes were determined using an alkaline hydrolysis method for isolation of low molecular mass plasmids. Nearly all the strains contained covalently closed circular (CCC) DNA species ranging from 2 to 5 species per strain and from 1.5 to 10.5 kbp in size (values corresponding to CCC forms). A 2-kbp plasmid from B. thuringiensis var. kurstaki HD-3a3b futura strain was used in Southern hybridization experiments to analyse relationships among the low molecular mass plasmids of different B. thuringiensis strains. This 2-kbp miniplasmid was present in most strains which show toxicity against lepidoptera. It was not present in those strains toxic against diptera (B. thuringiensis var. israelensis) or coleoptera (B. thuringiensis var. tenebrionis). The 2-kbp miniplasmid from B. thuringiensis var. kurstaki HD-3a3b futura was cloned and fully sequenced. Sequence analysis of the 2058 bp of the miniplasmid revealed the presence of an ORF (630 bp, 210 amino acids in size) that is preceded by a consensus sequence of B. thuringiensis crystal protein gene transcription promoters. No significant homology was observed with known B. thuringiensis toxin nucleic acid sequences or with other known sequences.
|
2. |
Yoshisue H,
Yoshida K,
Sen K,
Sakai H,
Komano T,
( 1992 ) Effects of Bacillus thuringiensis var. israelensis 20-kDa protein on production of the Bti 130-kDa crystal protein in Escherichia coli. PMID : 1368950 : Abstract >>
A 20-kDa protein of Bacillus thuringiensis var. israelensis (Bti) has been shown to be necessary for the efficient expression of the 27-kDa mosquitocidal protein gene in Escherichia coli. We have investigated the effects of this 20-kDa protein on the expression of two 130-kDa mosquitocidal protein genes (cryIVA, cryIVB) in E. coli by supplying the 20-kDa protein gene in trans. When a recombinant plasmid, pLH4BX, which was constructed to express cryIVA under the E. coli lac promoter on pUC19, coexisted with the 20-kDa protein gene, a striking increase in production of the fused CryIVA was detected. This was not accompanied by an increase in the amount of intracellular mRNA, suggesting that 20-kDa protein exerts a posttranscriptional effect. We conclude that the 20-kDa protein also stimulates the production of 130-kDa protein in E. coli.
|
3. |
Gamel PH,
Piot JC,
( 1992 ) Characterization and properties of a novel plasmid vector for Bacillus thuringiensis displaying compatibility with host plasmids. PMID : 1339372 : DOI : 10.1016/0378-1119(92)90004-9 Abstract >>
A novel plasmid vector, composed of a 1.7-kb Bacillus thuringiensis (B.t.) replicon, a multiple cloning site, and an erythromycin-resistance marker gene from Bacillus subtilis, was constructed for use in B.t. Unlike other vectors which have been reported to be acceptable for B.t., this new B.t. vector was stably maintained in the absence of Er and did not displace host plasmids, some of which carry crystal protein-encoding genes (cry genes). The compatibility of this B.t. vector with native plasmids is highly desirable when introducing new cry genes into a wild-type B.t. strain. When a cryIIIA gene of B.t. tenebrionis was cloned in this vector and introduced into B.t. kurstaki (kur) HD119, cryIIIA was highly expressed without affecting the level of expression of native cry genes. The stability of this vector and its compatibility with native B.t. plasmids were achieved by subcloning only nucleotide sequences required for the vector to replicate in B.t. The origin of replication was first cloned on a 9.6-kb Bg/II fragment from a 75-kb plasmid of B.t. kur HD73 and then localized to a 2.4-kb region within the 9.6-kb fragment. Sequencing of the 2.4-kb region revealed the presence of an open reading frame (ORF), encoding a putative 312-amino acid (aa) protein. The deduced aa sequence of the ORF showed no homology to any published aa sequences. Deletion analysis indicated that the B.t. vector required at least the ORF and up to 300 bp surrounding the ORF, in order to replicate.
|
4. |
Andrup L,
Jensen GB,
Wilcks A,
Smidt L,
Hoflack L,
Mahillon J,
( 2003 ) The patchwork nature of rolling-circle plasmids: comparison of six plasmids from two distinct Bacillus thuringiensis serotypes. PMID : 12749835 : Abstract >>
Bacillus thuringiensis, the entomopathogenic bacteria from the Bacillus cereus group, harbors numerous extrachromosomal molecules whose sizes vary from 2 to more than 200kb. Apart from the genes coding for the biopesticide delta-endotoxins located on large plasmids, little information has been obtained on these plasmids and their contribution to the biology of their host. In this paper, we embarked on a detailed comparison of six small rolling-circle replicating (RCR) plasmids originating from two major B. thuringiensis strains. The complete nucleotide sequences of plasmid pGI1, pGI2, pGI3, pTX14-1, pTX14-2, and pTX14-3 have been obtained and compared. Replication functions, comprising, for each plasmid, the gene encoding the Rep-protein, double-strand origin of replication (dso), single-strand origin of replication (sso), have been identified and analyzed. Two new families, or homology groups, of RCR plasmids originated from the studies of these plasmids (Group VI based on pGI3 and Group VII based on pTX14-3). On five of the six plasmids, loci involved in conjugative mobilization (Mob-genes and origin of transfer (oriT)) were identified. Plasmids pTX14-1, pTX14-2, and pTX14-3 each harbor an ORF encoding a polypeptide containing a central domain with repetitive elements similar to eukaryotic collagen (Gly-X-Y triplets). These genes were termed bcol for Bacillus-collagen-like genes.
|
5. |
Song F,
Zhang J,
Gu A,
Wu Y,
Han L,
He K,
Chen Z,
Yao J,
Hu Y,
Li G,
Huang D,
( 2003 ) Identification of cry1I-type genes from Bacillus thuringiensis strains and characterization of a novel cry1I-type gene. PMID : 12957903 : DOI : 10.1128/aem.69.9.5207-5211.2003 PMC : PMC194953 Abstract >>
A PCR-restriction fragment length polymorphism method for identification of cry1I-type genes from Bacillus thuringiensis was established by designing a pair of universal primers based on the conserved regions of the genes to amplify 1,548-bp cry1I-type gene fragments. Amplification products were digested with the Bsp119I and BanI enzymes, and four kinds of known cry1I-type genes were successfully identified. The results showed that cry1I-type genes appeared in 95 of 115 B. thuringiensis isolates and 7 of 13 standard strains. A novel cry1I-type gene was found in one standard strain and six isolates. The novel cry1I gene was cloned from B. thuringiensis isolate Btc007 and subcloned into vector pET-21b. Then it was overexpressed in Escherichia coli BL21(DE3). The expressed product was shown to be toxic to the diamondback moth (Plutella xylostella), Asian corn borer (Ostrinia furnacalis), and soybean pod borer (Leguminivora glycinivorella). However, it was not toxic to the cotton bollworm (Helicoverpa armigera), beet armyworm (Spodoptera exigua), or elm leaf beetle (Pyrrhalta aenescens) in bioassays. Subsequently, the Cry protein encoded by this novel cry gene was designated Cry1Ie1 by the B. thuringiensis delta-endotoxin nomenclature committee.
|
6. |
Ibarra JE,
del Rincón MC,
Ordúz S,
Noriega D,
Benintende G,
Monnerat R,
Regis L,
de Oliveira CM,
Lanz H,
Rodriguez MH,
Sánchez J,
Peña G,
Bravo A,
( 2003 ) Diversity of Bacillus thuringiensis strains from Latin America with insecticidal activity against different mosquito species. PMID : 12957913 : DOI : 10.1128/aem.69.9.5269-5274.2003 PMC : PMC194983 Abstract >>
The characterization of selected Bacillus thuringiensis strains isolated from different Latin America countries is presented. Characterization was based on their insecticidal activity against Aedes aegypti, Culex quinquefasciatus, and Anopheles albimanus larvae, scanning electron microscopy, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and plasmid profiles as well as PCR analysis using novel general and specific primers for cry and cyt genes encoding proteins active against mosquitoes (cyt1, cyt2, cry2, cry4A, cry4B, cry10, cry11, cry17, cry19, cry24, cry25, cry27, cry29, cry30, cry32, cry39, and cry40). Strains LBIT315, LBIT348, and IB604 showed threefold higher mosquitocidal activity against A. aegypti and C. quinquefasciatus larvae than B. thuringiensis subsp. israelensis and displayed high similarities with the B. thuringiensis subsp. israelensis used in this study with regard to protein and plasmid profiles and the presence of cry genes. Strain 147-8906 has activity against A. aegypti similar to that of B. thuringiensis subsp. israelensis but has different protein and plasmid profiles. This strain, harboring cry11, cry30, cyt1, and cyt2 genes, could be relevant for future resistance management interventions. Finally, the PCR screening strategy presented here led us to identify a putative novel cry11B gene.
|
7. |
Chang YH,
Shangkuan YH,
Lin HC,
Liu HW,
( 2003 ) PCR assay of the groEL gene for detection and differentiation of Bacillus cereus group cells. PMID : 12902235 : DOI : 10.1128/aem.69.8.4502-4510.2003 PMC : PMC169126 Abstract >>
Strains of species in the Bacillus cereus group are potentially enterotoxic. Thus, the detection of all B. cereus group strains is important. As 16S ribosomal DNA sequence analysis cannot adequately differentiate species of the B. cereus group, we explored the potential of the groEL gene as a phylogenetic marker. A phylogenetic analysis of the groEL sequences of 78 B. cereus group strains revealed that the B. cereus group strains were split into two major clusters, one including six B. mycoides and one B. pseudomycoides (cluster II) and the other including two B. mycoides and the rest of the B. cereus group strains (cluster I). Cluster I was further differentiated into two subclusters, Ia and Ib. The sodA gene sequences of representative strains from different clusters were also compared. The phylogenetic tree constructed from the sodA sequences showed substantial similarity to the tree constructed from the groEL sequences. Based on the groEL sequences, a PCR assay for detection and identification of B. cereus group strains was developed. Subsequent restriction fragment length polymorphism (RFLP) analysis verified the PCR amplicons and the differentiation of the B. cereus group strains. RFLP with MboI was identical for all the B. cereus group strains analyzed, while RFLP with MfeI or PstI classified all B. cereus and B. thuringiensis strains into two groups. All cluster II B. mycoides and B. pseudomycoides strains could be discriminated from other B. cereus group bacteria by restriction analysis with TspRI.
|
8. |
Arora N,
Ahmad T,
Rajagopal R,
Bhatnagar RK,
( 2003 ) A constitutively expressed 36 kDa exochitinase from Bacillus thuringiensis HD-1. PMID : 12893268 : DOI : 10.1016/s0006-291x(03)01228-2 Abstract >>
A 36 kDa chitinase was purified by ion exchange and gel filtration chromatography from the culture supernatant of Bacillus thuringiensis HD-1. The chitinase production was independent of the presence of chitin in the growth medium and was produced even in the presence of glucose. The purified chitinase was active at acidic pH, had an optimal activity at pH 6.5, and showed maximum activity at 65 degrees C. Of the various substrates, the enzyme catalyzed the hydrolysis of the disaccharide 4-MU(GlnAc)(2) most efficiently and was therefore classified as an exochitinase. The sequence of the tryptic peptides showed extensive homology with Bacillus cereus 36 kDa exochitinase. The 1083 bp open reading frame encoding 36 kDa chitinase was amplified with primers based on the gene sequence of B. cereus 36 kDa exochitinase. The deduced amino-acid sequence showed that the protein contained an N-terminal signal peptide and consisted of a single catalytic domain. The two conserved signature sequences characteristic of family 18 chitinases were mapped at positions 105-109 and 138-145 of Chi36. The recombinant chitinase was expressed in a catalytically active form in Escherichia coli in the vector pQE-32. The expressed 36 kDa chitinase potentiated the insecticidal effect of the vegetative insecticidal protein (Vip) when used against neonate larvae of Spodoptera litura.
|
9. |
Chen JW,
Tang LX,
Tang MJ,
Shi YX,
Pang Y,
( 2002 ) [Cloning and expression product of vip3A gene from Bacillus thuringiensis and analysis of inseceicidal activity]. PMID : 12674638 : Abstract >>
The vip3 A gene in a size of 2.3 kb amplified from wild-type Bacillus thuringiensis strain S184 by PCR was cloned into pGEM-T Easy vector and its sequence was analysized by DNASTAR. The plasmid pOTP was constructed by inserting vip3A-S184 gene into the expression vector pQE30 and then was transformed into E. coli M15. E. coli M15 cells harbouring the plasmid pOTP were induced with 1 mmol/L IPTG to express 89 kD protein which was confirmed to be Vip3A-S184 by Western blot. Experiments showed that about 19% of Vip3A-S184 proteins were soluble, and others were insoluble proteins and formed inclusion bodies observed by transmission electron microscopy(TEM). The target protein was purified under the native condition and the polyclonal antibody was prepared by immunizing rabbits. The polyclonal antibody was used to detect Vip3A proteins expressed in Bacillus thuringiensis. Bioassay showed that Vip3A-S184 showed a high toxicity against 3 tested insect larvae including Spodoptera exigua, Spodoptera litura and Helicoverpa armigera.
|
10. |
Ko KS,
Kim JM,
Kim JW,
Jung BY,
Kim W,
Kim IJ,
Kook YH,
( 2003 ) Identification of Bacillus anthracis by rpoB sequence analysis and multiplex PCR. PMID : 12843020 : DOI : 10.1128/jcm.41.7.2908-2914.2003 PMC : PMC165277 Abstract >>
Comparative sequence analysis was performed upon Bacillus anthracis and its closest relatives, B. cereus and B. thuringiensis. Portions of rpoB DNA from 10 strains of B. anthracis, 16 of B. cereus, 10 of B. thuringiensis, 1 of B. mycoides, and 1 of B. megaterium were amplified and sequenced. The determined rpoB sequences (318 bp) of the 10 B. anthracis strains, including five Korean isolates, were identical to those of Ames, Florida, Kruger B, and Western NA strains. Strains of the "B. cereus group" were separated into two subgroups, in which the B. anthracis strains formed a separate clade in the phylogenetic tree. However, B. cereus and B. thuringiensis could not be differentiated. Sequence analysis confirmed the five Korean isolates as B. anthracis. Based on the rpoB sequences determined in the present study, multiplex PCR generating either B. anthracis-specific amplicons (359 and 208 bp) or cap DNA (291 bp) in a virulence plasmid could be used for the rapid differential detection and identification of virulent B. anthracis.
|
11. |
Chen J,
Yu J,
Tang L,
Tang M,
Shi Y,
Pang Y,
( 2003 ) Comparison of the expression of Bacillus thuringiensis full-length and N-terminally truncated vip3A gene in Escherichia coli. PMID : 12859763 : Abstract >>
Studies were performed to demonstrate the function of the putative signal peptide of Vip3A proteins in Escherichia coli. The full-length vip3A-S184 gene was isolated from a soil-isolated Bacillus thuringiensis, and the vip3AdeltaN was constructed by deleting 81 nucleotides at the 5'-terminus of vip3A-S184. Both were transformed and expressed in E. coli. About 19.2% of Vip3A-S184 proteins secreted soluble proteins and others formed inclusion bodies in the periplasmic space. In contrast, the Vip3AdeltaN was insoluble and formed inclusion bodies in the cytoplasm. Bioassay indicated that Vip3A-S184 showed different toxicity against Spodoptera exigua, Helicoverpa armigera and S. litura, but Vip3AdeltaN showed no toxicity to either of them because of the deletion of the first 27 amino acids at the N-terminus. The results suggest that the deleted N-terminal sequences were essential for the secretion of Vip3A-S184 protein in E. coli and might be required for toxicity. The function of the putative signal peptide of Vip3A protein in E. coli was investigated. These would be helpful to make clear the unknown secretion pathway of Vip3A protein in B. thuringiensis and determine the receptor-binding domain or toxic fragment of Vip3A-S184 protein.
|
12. |
Barboza-Corona JE,
Nieto-Mazzocco E,
Velázquez-Robledo R,
Salcedo-Hernandez R,
Bautista M,
Jiménez B,
Ibarra JE,
( 2003 ) Cloning, sequencing, and expression of the chitinase gene chiA74 from Bacillus thuringiensis. PMID : 12571025 : DOI : 10.1128/aem.69.2.1023-1029.2003 PMC : PMC143672 Abstract >>
The endochitinase gene chiA74 from Bacillus thuringiensis serovar kenyae strain LBIT-82 was cloned in Escherichia coli DH5 alpha F'. A sequence of 676 amino acids was deduced when the gene was completely sequenced. A molecular mass of 74 kDa was estimated for the preprotein, which includes a putative 4-kDa signal sequence located at the N terminus. The deduced amino acid sequence showed high degree of identity with other chitinases such as ChiB from Bacillus cereus (98%) and ChiA71 from Bacillus thuringiensis serovar pakistani (70%). Additionally, ChiA74 showed a modular structure comprised of three domains: a catalytic domain, a fibronectin-like domain, and a chitin-binding domain. All three domains showed conserved sequences when compared to other bacterial chitinase sequences. A ca. 70-kDa mature protein expressed by the cloned gene was detected in zymograms, comigrating with a chitinase produced by the LBIT-82 wild-type strain. ChiA74 is active within a wide pH range (4 to 9), although a bimodal activity was shown at pH 4.79 and 6.34. The optimal temperature was estimated at 57.2 degrees C when tested at pH 6. The potential use of ChiA74 as a synergistic agent, along with the B. thuringiensis insecticidal Cry proteins, is discussed.
|
13. |
Ghelardi E,
Celandroni F,
Salvetti S,
Beecher DJ,
Gominet M,
Lereclus D,
Wong AC,
Senesi S,
( 2002 ) Requirement of flhA for swarming differentiation, flagellin export, and secretion of virulence-associated proteins in Bacillus thuringiensis. PMID : 12426328 : DOI : 10.1128/jb.184.23.6424-6433.2002 PMC : PMC135439 Abstract >>
Bacillus thuringiensis is being used worldwide as a biopesticide, although increasing evidence suggests that it is emerging as an opportunistic human pathogen. While phospholipases, hemolysins, and enterotoxins are claimed to be responsible for B. thuringiensis virulence, there is no direct evidence to indicate that the flagellum-driven motility plays a role in parasite-host interactions. This report describes the characterization of a mini-Tn10 mutant of B. thuringiensis that is defective in flagellum filament assembly and in swimming and swarming motility as well as in the production of hemolysin BL and phosphatidylcholine-preferring phospholipase C. The mutant strain was determined to carry the transposon insertion in flhA, a flagellar class II gene encoding a protein of the flagellar type III export apparatus. Interestingly, the flhA mutant of B. thuringiensis synthesized flagellin but was impaired in flagellin export. Moreover, a protein similar to the anti-sigma factor FlgM that acts in regulating flagellar class III gene transcription was not detectable in B. thuringiensis, thus suggesting that the flagellar gene expression hierarchy of B. thuringiensis differs from that described for Bacillus subtilis. The flhA mutant of B. thuringiensis was also defective in the secretion of hemolysin BL and phosphatidylcholine-preferring phospholipase C, although both of these virulence factors were synthesized by the mutant. Since complementation of the mutant with a plasmid harboring the flhA gene restored swimming and swarming motility as well as secretion of toxins, the overall results indicate that motility and virulence in B. thuringiensis may be coordinately regulated by flhA, which appears to play a crucial role in the export of flagellar as well as nonflagellar proteins.
|
14. |
Doss VA,
Kumar KA,
Jayakumar R,
Sekar V,
( 2002 ) Cloning and expression of the vegetative insecticidal protein (vip3V) gene of Bacillus thuringiensis in Escherichia coli. PMID : 12356474 : Abstract >>
A genomic library of Bacillus thuringiensis var. kurstaki (B.t.k.) was constructed and a positive clone harboring the full-length gene encoding a novel vegetative insecticidal protein (Vip3V) was characterized. The vip3V gene was subcloned into pET-22b(+) vector and overexpressed in Escherichia coli to an extent of about 30% of the total protein. While transcription was influenced by the T7 promoter of the vector, synthesis of Vip3V in E. coli host occurred from the B.t.k. ribosomal binding site (rbs) found 917bp downstream of the insert and not from the E. coli rbs of the vector. The expressed Vip3V protein was found in the soluble and periplasmic fractions as well as in the inclusion bodies. A simplified anion-exchange chromatographic method for the purification of Vip3V using step gradient or one-step elution was developed. The purified protein showed broad-spectrum activity against some of the lepidopteran larvae tested and did not show any activity against the larvae of silkworm (Bombyx mori) and mosquito (Culex quinquefasciatus).
|
15. |
Prabagaran SR,
Nimal SJ,
Jayachandran S,
( N/A ) Phenotypic and genetic diversity of Bacillus thuringiensis strains isolated in India active against Spodoptera litura. PMID : 12396125 : Abstract >>
Bacillus thuringiensis strains isolated from different agroclimatic regions of India were found to harbor cry1 family genes. Of 831 strains 18 that were found to produce 130- and 68-kDa mol wt proteins in sodium dodecyl sulfate polyacry1amide gel electrophoresis were subjected to bioassay against second instar larvae of Spodoptera litura. According to the time response curve, while the highest toxic activity against S. litura was observed in PBT-782 with an LT50 of 25.46 h, strains PBT-372, PBT-574, PBT-801, and PBT-716 in descending order of merit had LT50 values of 36.81, 48.18, 50.35, and 73.53 h. The results of the field experiment testing the efficacy of different B. thuringiensis strains in controlling S. litura larvae infecting peanut plants showed that the chemical insecticide chlorpyriphos was the most effective in controlling S. litura throughout the study period. However, among B. thuringiensis strains, PBT-372 was superior. All the B. thuringiensis strains except PBT-689 were found to contain cry1Ac1-type gene. However, only nine strains contained cry1Aa1 gene. While cry1Ab1 was present only in PBT-372 and PBT-689, cry1Ca1 was present in PBT-574, PBT-688, PBT-689, and PBT-695. cry1Da1 was detected only in PBT-688 and PBT-692. None of the strains contained cry1Ba1 and cry1Ea1 genes. When polymerase chain reaction analysis using cry1Ca1 primer was performed, PBT-695 produced an unexpected 739-bp product, which showed 33% homology with cry1Ca1 gene between nucleotides 1819 and 2107. Our results indicated that among the field-collected B. thuringiensis strains, PBT-372 harbors multiple cry-type genes and could be employed for biological control of insects.
|
16. |
Fedhila S,
Msadek T,
Nel P,
Lereclus D,
( 2002 ) Distinct clpP genes control specific adaptive responses in Bacillus thuringiensis. PMID : 12270812 : DOI : 10.1128/jb.184.20.5554-5562.2002 PMC : PMC139615 Abstract >>
ClpP and ClpC are subunits of the Clp ATP-dependent protease, which is ubiquitous among prokaryotic and eukaryotic organisms. The role of these proteins in stress tolerance, stationary-phase adaptive responses, and virulence in many bacterial species has been demonstrated. Based on the amino acid sequences of the Bacillus subtilis clpC and clpP genes, we identified one clpC gene and two clpP genes (designated clpP1 and clpP2) in Bacillus thuringiensis. Predicted proteins ClpP1 and ClpP2 have approximately 88 and 67% amino acid sequence identity with ClpP of B. subtilis, respectively. Inactivation of clpC in B. thuringiensis impaired sporulation efficiency. The clpP1 and clpP2 mutants were both slightly susceptible to salt stress, whereas disruption of clpP2 negatively affected sporulation and abolished motility. Virulence of the clp mutants was assessed by injecting bacteria into the hemocoel of Bombyx mori larvae. The clpP1 mutant displayed attenuated virulence, which appeared to be related to its inability to grow at low temperature (25 degrees C), suggesting an essential role for ClpP1 in tolerance of low temperature. Microscopic examination of clpP1 mutant cells grown at 25 degrees C showed altered bacterial division, with cells remaining attached after septum formation. Analysis of lacZ transcriptional fusions showed that clpP1 was expressed at 25 and 37 degrees C during the entire growth cycle. In contrast, clpP2 was expressed at 37 degrees C but not at 25 degrees C, suggesting that ClpP2 cannot compensate for the absence of ClpP1 in the clpP1 mutant cells at low temperature. Our study demonstrates that ClpP1 and ClpP2 control distinct cellular regulatory pathways in B. thuringiensis.
|
17. |
Fedhila S,
Nel P,
Lereclus D,
( 2002 ) The InhA2 metalloprotease of Bacillus thuringiensis strain 407 is required for pathogenicity in insects infected via the oral route. PMID : 12029046 : DOI : 10.1128/jb.184.12.3296-3304.2002 PMC : PMC135110 Abstract >>
The entomopathogenic bacterium Bacillus thuringiensis is known to secrete a zinc metalloprotease (InhA) that specifically cleaves antibacterial peptides produced by insect hosts. We identified a second copy of the inhA gene, named inhA2, in B. thuringiensis strain 407 Cry(-). The inhA2 gene encodes a putative polypeptide showing 66.2% overall identity with the InhA protein and harboring the zinc-binding domain (HEXXH), which is characteristic of the zinc-requiring metalloproteases. We used a transcriptional inhA2'-lacZ fusion to show that inhA2 expression is induced at the onset of the stationary phase and is overexpressed in a Spo0A minus background. The presence of a reverse Spo0A box in the promoter region of inhA2 suggests that Spo0A directly regulates the transcription of inhA2. To determine the role of the InhA and InhA2 metalloproteases in pathogenesis, we used allelic exchange to isolate single and double mutant strains for the two genes. Spores and vegetative cells of the mutant strains were as virulent as those of the parental strain in immunized Bombyx mori larvae infected by the intrahemocoelic route. Exponential phase cells of all the strains displayed the same in vitro potential for colonizing the vaccinated hemocoel. We investigated the synergistic effect of the mutant strain spores on the toxicity of Cry1C proteins against Galleria mellonella larvae infected via the oral pathway. The spores of DeltainhA2 mutant strain were ineffective in providing synergism whereas those of the DeltainhA mutant strain were not. These results indicate that the B. thuringiensis InhA2 zinc metalloprotease has a vital role in virulence when the host is infected via the oral route.
|
18. |
Selvapandiyan A,
Arora N,
Rajagopal R,
Jalali SK,
Venkatesan T,
Singh SP,
Bhatnagar RK,
( 2001 ) Toxicity analysis of N- and C-terminus-deleted vegetative insecticidal protein from Bacillus thuringiensis. PMID : 11722946 : DOI : 10.1128/AEM.67.12.5855-5858.2001 PMC : PMC93383 Abstract >>
A vegetative insecticidal protein (VIP)-encoding gene from a local isolate of Bacillus thuringiensis has been cloned, sequenced, and expressed in Escherichia coli. The expressed protein shows insecticidal activity against several lepidopteran pests but is ineffective against Agrotis ipsilon. Comparison of the amino acid sequence with those of reported VIPs revealed a few differences. Analysis of insecticidal activity with N- and C-terminus deletion mutants suggests a differential mode of action of VIP against different pests.
|
19. |
Dong YH,
Gusti AR,
Zhang Q,
Xu JL,
Zhang LH,
( 2002 ) Identification of quorum-quenching N-acyl homoserine lactonases from Bacillus species. PMID : 11916693 : DOI : 10.1128/aem.68.4.1754-1759.2002 PMC : PMC123891 Abstract >>
A range of gram-negative bacterial species use N-acyl homoserine lactone (AHL) molecules as quorum-sensing signals to regulate different biological functions, including production of virulence factors. AHL is also known as an autoinducer. An autoinducer inactivation gene, aiiA, coding for an AHL lactonase, was cloned from a bacterial isolate, Bacillus sp. strain 240B1. Here we report identification of more than 20 bacterial isolates capable of enzymatic inactivation of AHLs from different sources. Eight isolates showing strong AHL-inactivating enzyme activity were selected for a preliminary taxonomic analysis. Morphological phenotypes and 16S ribosomal DNA sequence analysis indicated that these isolates probably belong to the species Bacillus thuringiensis. Enzymatic analysis with known Bacillus strains confirmed that all of the strains of B. thuringiensis and the closely related species B. cereus and B. mycoides tested produced AHL-inactivating enzymes but B. fusiformis and B. sphaericus strains did not. Nine genes coding for AHL inactivation were cloned either by functional cloning or by a PCR procedure from selected bacterial isolates and strains. Sequence comparison of the gene products and motif analysis showed that the gene products belong to the same family of AHL lactonases.
|
20. |
Manasherob R,
Zaritsky A,
Ben-Dov E,
Saxena D,
Barak Z,
Einav M,
( 2001 ) Effect of accessory proteins P19 and P20 on cytolytic activity of Cyt1Aa from Bacillus thuringiensis subsp. israelensis in Escherichia coli. PMID : 11688801 : Abstract >>
The gene coding for the accessory protein P19 of Bacillus thuringiensis subsp. israelensis was expressed in Escherichia coli and its product was characterized. To investigate its putative role in delta-endotoxin crystallization as a P20-like polypeptide, each of the two encoding genes, p20 and p19, was cloned for inducible expression coordinatively with cyt1Aa. The latter is known to kill its transgenic host. P20 but not P19 stabilized Cyt1Aa and protected the host cells from its lethal effect. Neither GroEL nor GroES, expressed in trans, affected Cyt1Aa as did P20. The function of P20 is thus more specific than that of the chaperones, but that of P19 remains enigmatic. The correct sequence of p19, confirmed in all five isolates of B. thuringiensis subsp. israelensis, does not explain the slow electrophoretic mobility of its 179 amino acids product.
|
21. |
Ellis RT,
Stockhoff BA,
Stamp L,
Schnepf HE,
Schwab GE,
Knuth M,
Russell J,
Cardineau GA,
Narva KE,
( 2002 ) Novel Bacillus thuringiensis binary insecticidal crystal proteins active on western corn rootworm, Diabrotica virgifera virgifera LeConte. PMID : 11872461 : DOI : 10.1128/aem.68.3.1137-1145.2002 PMC : PMC123759 Abstract >>
A new family of insecticidal crystal proteins was discovered by screening sporulated Bacillus thuringiensis cultures for oral activity against western corn rootworm (WCR) larvae. B. thuringiensis isolates PS80JJ1, PS149B1, and PS167H2 have WCR insecticidal activity attributable to parasporal inclusion bodies containing proteins with molecular masses of ca. 14 and 44 kDa. The genes encoding these polypeptides reside in apparent operons, and the 14-kDa protein open reading frame (ORF) precedes the 44-kDa protein ORF. Mutagenesis of either gene in the apparent operons dramatically reduced insecticidal activity of the corresponding recombinant B. thuringiensis strain. Bioassays performed with separately expressed, biochemically purified 14- and 44-kDa polypeptides also demonstrated that both proteins are required for WCR mortality. Sequence comparisons with other known B. thuringiensis insecticidal proteins failed to reveal homology with previously described Cry, Cyt, or Vip proteins. However, there is evidence that the 44-kDa polypeptide and the 41.9- and 51.4-kDa binary dipteran insecticidal proteins from Bacillus sphaericus are evolutionarily related. The 14- and 44-kDa polypeptides from isolates PS80JJ1, PS149B1, and PS167H2 have been designated Cry34Aa1, Cry34Ab1, and Cry34Ac1, respectively, and the 44-kDa polypeptides from these isolates have been designated Cry35Aa1, Cry35Ab1, and Cry35Ac1, respectively.
|
22. |
Qi Y,
Patra G,
Liang X,
Williams LE,
Rose S,
Redkar RJ,
DelVecchio VG,
( 2001 ) Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. PMID : 11472954 : DOI : 10.1128/AEM.67.8.3720-3727.2001 PMC : PMC93078 Abstract >>
The potential use of Bacillus anthracis as a weapon of mass destruction poses a threat to humans, domesticated animals, and wildlife and necessitates the need for a rapid and highly specific detection assay. We have developed a real-time PCR-based assay for the specific detection of B. anthracis by taking advantage of the unique nucleotide sequence of the B. anthracis rpoB gene. Variable region 1 of the rpoB gene was sequenced from 36 Bacillus strains, including 16 B. anthracis strains and 20 other related bacilli, and four nucleotides specific for B. anthracis were identified. PCR primers were selected so that two B. anthracis-specific nucleotides were at their 3' ends, whereas the remaining bases were specific to the probe region. This format permitted the PCR reactions to be performed on a LightCycler via fluorescence resonance energy transfer (FRET). The assay was found to be specific for 144 B. anthracis strains from different geographical locations and did not cross-react with other related bacilli (175 strains), with the exception of one strain. The PCR assay can be performed on isolated DNA as well as crude vegetative cell lysates in less than 1 h. Therefore, the rpoB-FRET assay could be used as a new chromosomal marker for rapid detection of B. anthracis.
|
23. |
Moellenbeck DJ,
Peters ML,
Bing JW,
Rouse JR,
Higgins LS,
Sims L,
Nevshemal T,
Marshall L,
Ellis RT,
Bystrak PG,
Lang BA,
Stewart JL,
Kouba K,
Sondag V,
Gustafson V,
Nour K,
Xu D,
Swenson J,
Zhang J,
Czapla T,
Schwab G,
Jayne S,
Stockhoff BA,
Narva K,
Schnepf HE,
Stelman SJ,
Poutre C,
Koziel M,
Duck N,
( 2001 ) Insecticidal proteins from Bacillus thuringiensis protect corn from corn rootworms. PMID : 11433280 : DOI : 10.1038/90282 Abstract >>
Field tests of corn co-expressing two new delta-endotoxins from Bacillus thuringiensis (Bt) have demonstrated protection from root damage by western corn rootworm (Diabrotica virgifera virgifera LeConte). The level of protection exceeds that provided by chemical insecticides. In the bacterium, these proteins form crystals during the sporulation phase of the growth cycle, are encoded by a single operon, and have molecular masses of 14 kDa and 44 kDa. Corn rootworm larvae fed on corn roots expressing the proteins showed histopathological symptoms in the midgut epithelium.
|
24. |
Grandvalet C,
Gominet M,
Lereclus D,
( 2001 ) Identification of genes involved in the activation of the Bacillus thuringiensis inhA metalloprotease gene at the onset of sporulation. PMID : 11429458 : DOI : 10.1099/00221287-147-7-1805 Abstract >>
The immune inhibitor A (InhA) metalloprotease from Bacillus thuringiensis specifically cleaves antibacterial proteins produced by the insect host, suggesting that it may contribute to the overall virulence of B. thuringiensis. The transcriptional regulation of the inhA gene in both B. thuringiensis and Bacillus subtilis was investigated. Using a transcriptional inhA'-lacZ fusion, it was shown that inhA expression is activated at the onset of sporulation. However, the transcriptional start site of inhA is similar to sigma(A)-dependent promoters, and deletion of the sporulation-specific sigma factors sigma(F) or sigma(E) had no effect on inhA expression in B. subtilis. The DNA region upstream from inhA contains two genes encoding polypeptides similar to the SinI and SinR regulators of B. subtilis. SinR is a DNA-binding protein regulating gene expression and SinI inhibits SinR activity. Overexpression of the sin genes affects the expression of the inhA'-lacZ transcriptional fusion in B. thuringiensis: early induction of inhA expression was observed when sinI was overexpressed, whereas inhA expression was reduced in a strain overexpressing sinR, suggesting that inhA transcription is repressed, directly or indirectly, by SinR. inhA transcription was greatly reduced in B. thuringiensis and B. subtilis spo0A mutants. Analysis of the inhA'-lacZ expression in abrB and abrB-spo0A mutants of B. subtilis indicates that the Spo0A-dependent regulation of inhA expression depends on AbrB, which is known to regulate expression of transition state and sporulation genes in B. subtilis.
|
25. |
Gominet M,
Slamti L,
Gilois N,
Rose M,
Lereclus D,
( 2001 ) Oligopeptide permease is required for expression of the Bacillus thuringiensis plcR regulon and for virulence. PMID : 11401703 : DOI : 10.1046/j.1365-2958.2001.02440.x Abstract >>
PlcR is a pleiotropic regulator of virulence factors in the insect pathogen Bacillus thuringiensis and in the opportunistic human pathogen Bacillus cereus. It activates the transcription of at least 15 genes encoding extracellular proteins, including phospholipases C, proteases and enterotoxins. Expression of the plcR gene is autoregulated and activated at the onset of stationary phase. Here, we used mini-Tn10 transposition to generate a library of B. thuringiensis mutants, with the goal of characterizing genes involved in the expression of the plcR gene. Three mutant strains were identified carrying distinct mini-Tn10 insertions. The mutations impaired plcR expression and caused a deficient haemolytic phenotype, similar to the phenotype of a B. thuringiensis strain in which the plcR gene had been disrupted. The insertion sites of the three mini-Tn10 transposons mapped in a five-gene operon encoding polypeptides homologous to the components of the oligopeptide permease (Opp) system of Bacillus subtilis, and with a similar structural organization. By analogy, the five B. thuringiensis genes were designated oppA, B, C, D and F. In vitro disruption of the B. thuringiensis oppB gene reproduced the effect of the mini-Tn10 insertions (i.e. the loss of haemolytic activity) and reduced the virulence of the strain against insects. These phenotypes are similar to those of a DeltaplcR mutant. Opp is required for the import of small peptides into the cell. Therefore, plcR expression might be activated at the onset of stationary phase by the uptake of a signalling peptide acting as a quorum-sensing effector. The opp mutations impaired the sporulation efficiency of B. thuringiensis when the cells were cultured in LB medium. Thus, Opp is on the pathway that ultimately regulates Spo0A phosphorylation, as is the case in B. subtilis. However, analysis of plcR expression in DeltaoppB, Deltaspo0A and DeltaoppB Deltaspo0A mutants indicates that Opp is required for plcR expression via a Spo0A-independent mechanism.
|
26. |
Jung YC,
Chung YS,
Côté JC,
( 2001 ) Cloning and nucleotide sequence of a new insertion sequence, IS231N, from a non-serotypable strain of Bacillus thuringiensis. PMID : 11400069 : DOI : 10.1007/s002840010286 Abstract >>
A new IS231 variant, IS231N, has been isolated from an autoagglutinable, non-serotypable strain of B. thuringiensis. IS231N is 1654 bp in length and is delimited by two incomplete 20-bp inverted repeats (IRL and IRR) with two mismatches. No direct repeats (DRs) were found at the right and left borders of IS231N. Surprisingly, IS231N contains three open reading frames (ORFs) that could code for polypeptides of 329 (ORF1), 118 (ORF2), and 17 (ORF3) amino acids, respectively. IS231N lacks the 5th conserved amino acid domain, called C2, owing to the addition of an adenine residue at nucleotide 1319. IS231N shows the highest nucleotide identity (99%) with IS231M, another insertion sequence previously isolated from the same bacterial strain. IS231N, however, shares only 83% amino acid identity with IS231M because of nucleotide substitutions and additions. The ORF1 of IS231N has five fewer amino acids than ORF1 of IS231M. Furthermore, the ORF2-3 putative fusion product in IS231N contains eight fewer amino acids than ORF2 in IS231M. The dendrogram showing the evolutionary relationship between members of the IS231 family and IS231N indicates that IS231N is phylogenetically more closely related to IS231M (83%), followed by IS231F(74%), and is more distant from IS231V and W(46%).
|
27. |
Mesnage S,
Haustant M,
Fouet A,
( 2001 ) A general strategy for identification of S-layer genes in the Bacillus cereus group: molecular characterization of such a gene in Bacillus thuringiensis subsp. galleriae NRRL 4045. PMID : 11320137 : DOI : 10.1099/00221287-147-5-1343 Abstract >>
Despite its possible role in virulence, there has been little molecular characterization of members of the S-layer protein family of the Bacillus cereus group. It is hypothesized that the components of the S-layers are likely to display similar anchoring structures in Bacillus thuringiensis and Bacillus anthracis. Based on inferred sequence similarities, a DNA fragment encoding the cell-wall-anchoring domain of an S-layer component of BAC: thuringiensis subsp. galleriae NRRL 4045 was isolated. The complete gene was identified and sequenced. An ORF of 2463 nt was identified, which was predicted to encode a protein of 821 aa, SlpA. The mature SlpA protein (792 residues) carries three S-layer homology (SLH) motifs towards its amino terminus, each about 50 aa long. These motifs were sufficient to bind Bac. thuringiensis and Bac. anthracis cell walls in vitro by interacting with peptidoglycan-associated polymers, confirming a common wall-anchoring mechanism. The slpA null-allele mutant was constructed and shown to possess no other abundant surface protein. It is proposed that the method described in this paper could be applied to the identification and deletion of any Bac. cereus S-layer gene and is of great value for the molecular and functional characterization of these genes.
|
28. |
Jung YC,
Xu D,
Chung YS,
Côté JC,
( 2001 ) A new insertion sequence, IS231M, in an autoagglutinable isolate of Bacillus thuringiensis. PMID : 11322825 : DOI : 10.1006/plas.2000.1508 Abstract >>
An insertion sequence was isolated from an autoagglutinable strain of Bacillus thuringiensis. Analysis of its DNA sequence revealed high homology to the IS231 family. The name IS231M is proposed for this new insertion sequence. IS231M is 1652 bp long and is delimited by two imperfect 20-bp inverted repeat sequences with two mismatches, which are flanked by two perfect 11-bp direct repeats (DRs). The region upstream of the open reading frame, presumed to be able to form a stable hairpin structure, is particularly well conserved in IS231M. Based on primary nucleotide sequences, IS231M is most homologous to IS231F and IS231G and most distant from IS231V and IS231W. However, as opposed to the single transposase A ORF found in IS231A, -B, -C, -D, -F, and -G, IS231M has two overlapping open reading frames, ORF1 and ORF2, that could code for polypeptides of 334 and 143 amino acids, respectively. Whether IS231M is a functional transposable element remains to be determined.
|
29. |
Shin BS,
Kong EM,
Choi SK,
( 2000 ) Cloning of a new Bacillus thuringiensis cry1I-type crystal protein gene. PMID : 10919402 : Abstract >>
A new cry1I-type gene, cry1Id1, was cloned from a B. thuringiensis isolate, and its nucleotide sequence was determined. The deduced amino acid sequence of Cry1Id1 is 89.7%, 87.2%, and 83.4% identical to the Cry1Ia, Cry1Ib, and Cry1Ic proteins, respectively. The upstream sequence of the cry1Id1 structural gene was not functional as promoter in B. subtilis. The Cry1Id1 protein, purified from recombinant E. coli cells, had a toxicity comparable to that of Cry1Ia against Plutella xylostella, but it was significantly less active than Cry1Ia against Bombyx mori. Cry1Id1 was not active against the coleopteran insect, Agelastica coerulea.
|
30. |
Tan Y,
Donovan WP,
( 2001 ) Deletion of aprA and nprA genes for alkaline protease A and neutral protease A from bacillus thuringiensis: effect on insecticidal crystal proteins. PMID : 11035189 : Abstract >>
The aprA gene encoding alkaline protease A (AprA) was cloned from Bacillus thuringiensis subsp. kurstaki, and the cloned gene was used to construct aprA-deleted (aprA1) strains of B. thuringiensis. An aprA1 strain of B. thuringiensis that contained the wild-type gene for neutral protease A (nprA(+)) displayed levels of extracellular proteolytic activity that were similar to those of an aprA(+)nprA(+) strain. However, when EDTA was included in the protease assay to inhibit NprA activity the aprA1nprA(+) strain displayed only 2% of the extracellular proteolytic activity of the aprA(+)nprA(+) strain. A strain that was deleted for both aprA and nprA (aprA1nprA3 strain) failed to produce detectable levels of proteolytic activity either in the presence or absence of EDTA in the assay. Compared with the aprA(+)nprA(+) strain the aprA1nprA(+) strain yielded 10% more full-length Cry1Bb crystal protein and the aprA1nprA3 strain yielded 25% more full-length Cry1Bb protein. No significant differences were seen in the 50% lethal dose of Cry1Bb protein from aprA(+)nprA(+) and aprA1nprA3 strains against three species of lepidopteran insects. These results suggest that enhanced yield of certain crystal proteins can be obtained by deletion of the genes aprA and nprA which are the major extracellular proteases of B. thuringiensis.
|
31. |
Saitoh H,
Yamashita S,
Akao T,
Park YS,
Mizuki E,
( 2000 ) Parasporin, a human leukemic cell-recognizing parasporal protein of Bacillus thuringiensis. PMID : 10882663 : DOI : 10.1128/cdli.7.4.625-634.2000 PMC : PMC95925 Abstract >>
An unusual property, human leukemic cell-recognizing activity, associated with parasporal inclusions of a noninsecticidal Bacillus thuringiensis soil isolate was investigated, and a protein (named parasporin in this study) responsible for the activity was cloned. The parasporin, encoded by a gene 2,169 bp long, was a polypeptide of 723 amino acid residues with a predicted molecular weight of 81, 045. The sequence of parasporin contained the five conserved blocks commonly found in B. thuringiensis Cry proteins; however, only very low homologies (<25%) between parasporin and the existing classes of Cry and Cyt proteins were detected. Parasporin exhibited cytocidal activity only when degraded by proteases into smaller molecules of 40 to 60 kDa. Trypsin and proteinase K activated parasporin, while chymotrypsin did not. The activated parasporin showed strong cytocidal activity against human leukemic T cells (MOLT-4) and human uterus cervix cancer cells (HeLa) but not against normal T cells.
|
32. |
Dietrich R,
Nibler B,
Prüss BM,
( 1999 ) The hemolytic enterotoxin HBL is broadly distributed among species of the Bacillus cereus group. PMID : 10584001 : PMC : PMC91741 Abstract >>
The prevalence of the hemolytic enterotoxin complex HBL was determined in all species of the Bacillus cereus group with the exception of Bacillus anthracis. hblA, encoding the binding subunit B, was detected by PCR and Southern analysis and was confirmed by partial sequencing of 18 strains. The sequences formed two clusters, one including B. cereus and Bacillus thuringiensis strains and the other one consisting of Bacillus mycoides, Bacillus pseudomycoides, and Bacillus weihenstephanensis strains. From eight B. thuringiensis strains, the enterotoxin gene hblA could be amplified. Seven of them also expressed the complete HBL complex as determined with specific antibodies against the L(1), L(2), and B components. Eleven of 16 B. mycoides strains, all 3 B. pseudomyoides strains, 9 of 15 B. weihenstephanensis strains, and 10 of 23 B. cereus strains carried hblA. While HBL was not expressed in the B. pseudomycoides strains, the molecular assays were in accordance with the immunological assays for the majority of the remaining strains. In summary, the hemolytic enterotoxin HBL seems to be broadly distributed among strains of the B. cereus group and relates neither to a certain species nor to a specific environment. The consequences of this finding for food safety considerations need to be evaluated.
|
33. |
Craig JA,
Putnam CD,
Han S,
( 1999 ) Evolution and mechanism from structures of an ADP-ribosylating toxin and NAD complex. PMID : 10504727 : DOI : 10.1038/13300 Abstract >>
A member of the Bacillus-produced vegetative insecticidal proteins (VIPs) possesses high specificity against the major insect pest, corn rootworms, and belongs to a class of binary toxins and regulators of biological pathways distinct from classical A-B toxins. The 1.5 A resolution crystal structure of the enzymatic ADP-ribosyltransferase component, VIP2, from Bacillus cereus reveals structurally homologous N- and C-terminal alpha/beta domains likely representing the entire class of binary toxins and implying evolutionary relationships between families of ADP-ribosylating toxins. The crystal structure of the kinetically trapped VIP2-NAD complex identifies the NAD binding cleft within the C-terminal enzymatic domain and provides a structural basis for understanding the targeting and catalysis of the medically and environmentally important binary toxins. These structures furthermore provide specific experimental results to help resolve paradoxes regarding the specific mechanism of ADP-ribosylation of actin by implicating ground state destabilization and nicotinamide product sequestration as the major driving forces for catalysis.
|
34. |
Kolsto AB,
Mahillon J,
Okstad OA,
Smidt L,
( 1999 ) Replication mechanism and sequence analysis of the replicon of pAW63, a conjugative plasmid from Bacillus thuringiensis. PMID : 10322022 : PMC : PMC93776 Abstract >>
A 5.8-kb fragment of the large conjugative plasmid pAW63 from Bacillus thuringiensis subsp. kurstaki HD73 containing all the information for autonomous replication was cloned and sequenced. By deletion analysis, the pAW63 replicon was reduced to a 4.1-kb fragment harboring four open reading frames (ORFs). Rep63A (513 amino acids [aa]), encoded by the largest ORF, displayed strong similarity (40% identity) to the replication proteins from plasmids pAMbeta1, pIP501, and pSM19035, indicating that the pAW63 replicon belongs to the pAMbeta1 family of gram-positive theta-replicating plasmids. This was confirmed by the facts that no single-stranded DNA replication intermediates could be detected and that replication was found to be dependent on host-gene-encoded DNA polymerase I. An 85-bp region downstream of Rep63A was also shown to have strong similarity to the origins of replication of pAMbeta1 and pIP501, and it is suggested that this region contains the bona fide pAW63 ori. The protein encoded by the second large ORF, Rep63B (308 aa), was shown to display similarity to RepB (34% identity over 281 aa) and PrgP (32% identity over 310 aa), involved in copy control of the Enterococcus faecalis plasmids pAD1 and pCF10, respectively. No significant similarity to known proteins or DNA sequences could be detected for the two smallest ORFs. However, the location, size, hydrophilicity, and orientation of ORF6 (107 codons) were analogous to those features of the putative genes repC and prgO, which encode stability functions on plasmids pAD1 and pCF10, respectively. The cloned replicon of plasmid pAW63 was stably maintained in Bacillus subtilis and B. thuringiensis and displayed incompatibility with the native pAW63. Hybridization experiments using the cloned replicon as a probe showed that pAW63 has similarity to large plasmids from other B. thuringiensis subsp. kurstaki strains and to a strain of B. thuringiensis subsp. alesti.
|
35. |
Yamada S,
Venkateswaran K,
( 1999 ) Cloning and nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringiensis, B. mycoides, and B. anthracis and their application to the detection of B. cereus in rice. PMID : 10103241 : PMC : PMC91211 Abstract >>
As 16S rRNA sequence analysis has proven inadequate for the differentiation of Bacillus cereus from closely related species, we employed the gyrase B gene (gyrB) as a molecular diagnostic marker. The gyrB genes of B. cereus JCM 2152(T), Bacillus thuringiensis IAM 12077(T), Bacillus mycoides ATCC 6462(T), and Bacillus anthracis Pasteur #2H were cloned and sequenced. Oligonucleotide PCR primer sets were designed from within gyrB sequences of the respective bacteria for the specific amplification and differentiation of B. cereus, B. thuringiensis, and B. anthracis. The results from the amplification of gyrB sequences correlated well with results obtained with the 16S rDNA-based hybridization study but not with the results of their phenotypic characterization. Some of the reference strains of both B. cereus (three serovars) and B. thuringiensis (two serovars) were not positive in PCR amplification assays with gyrB primers. However, complete sequencing of 1.2-kb gyrB fragments of these reference strains showed that these serovars had, in fact, lower homology than their originally designated species. We developed and tested a procedure for the specific detection of the target organism in boiled rice that entailed 15 h of preenrichment followed by PCR amplification of the B. cereus-specific fragment. This method enabled us to detect an initial inoculum of 0.24 CFU of B. cereus cells per g of boiled rice food homogenate without extracting DNA. However, a simple two-step filtration step is required to remove PCR inhibitory substances.
|
36. |
Sakai H,
Howlader MT,
Ishida Y,
Nakaguchi A,
Oka K,
Ohbayashi K,
Yamagiwa M,
Hayakawa T,
( 2007 ) Flexibility and strictness in functional replacement of domain III of cry insecticidal proteins from Bacillus thuringiensis. PMID : 17502282 : DOI : 10.1263/jbb.103.381 Abstract >>
Cry1C, one of the lepidopteran-specific insecticidal proteins from Bacillus thuringiensis, exhibits potent cytotoxicity against Sf9, an insect cell line. Cry1Aa and Cry4A, which are lepidopteran- and dipteran-specific insecticidal proteins, respectively, show no cytotoxicity against Sf9. When domain III of Cry1C was replaced with that of Cry1Aa or Cry4A, the hybrid Cry1C protein retained the cytotoxicity. These results suggest that domain III of Cry1C is not crucial in determining the cytocidal specificity of Cry1C against Sf9.
|
37. |
Huang DF,
Zhang J,
Song FP,
Lang ZH,
( 2007 ) Microbial control and biotechnology research on Bacillus thuringiensis in China. PMID : 17481651 : DOI : 10.1016/j.jip.2007.02.016 Abstract >>
The current status of production and application of biopesticides for pest control in China is briefly reviewed, with a focus on research advances in microbial control with Bacillus thuringiensis (Bt). These have led to improvements in Bt production, exploitation of Bt gene resources, and development of engineered Bt insecticides and transgenic Bt crops that have expanded host ranges and increased efficacy against target pests. Both conventional and biotechnology approaches need to be employed to achieve further progress in discovery, production technology, formulation processing, development of quality standards and recommended use patterns.
|
38. |
Liu J,
Song F,
Zhang J,
Liu R,
He K,
Tan J,
Huang D,
( 2007 ) Identification of vip3A-type genes from Bacillus thuringiensis strains and characterization of a novel vip3A-type gene. PMID : 17868317 : DOI : 10.1111/j.1472-765X.2007.02217.x Abstract >>
To search for novel Vip3A proteins for controlling insect pests. A pair of universal primers was designed based on the conserved regions of five vip3A genes. Amplified products were digested with the HindIII and EcoR enzymes so as to confirm different restriction fragment length polymorphism (RFLP) patterns used to identify vip3A-type genes. The vip3A gene types of 606 Bacillus thuringiensis strains were screened and three patterns of RFLP were successfully identified. Two novel vip3A genes were found and one of these, vip3Aa19, was further characterized and its product was confirmed toxic to Spodoptera exigua, Helicoverpa armigera and Plutella xylostella larvae. Partial sequences of another novel vip3A-type gene were obtained that shared 83% homology with that of the vip3Af1 gene. A polymerase chain reaction (PCR)-RFLP system we developed could be used for identifying novel vip3A-genes from B. thuringiensis strains. A novel Vip3A protein was found to have a broader insecticidal spectrum. The reported method is a powerful tool to find novel Vip3A proteins from large-scale B. thuringiensis strains. The novel Vip3A protein may be used to control insect pests or resistant insect pests by constructing genetically engineered strains or transgenic plants.
|
39. |
Zhang Q,
Sun M,
Xu Z,
Yu Z,
( 2007 ) Cloning and characterization of pBMB9741, a native plasmid of Bacillus thuringiensis subsp. kurstaki strain YBT-1520. PMID : 17849163 : DOI : 10.1007/s00284-006-0623-3 Abstract >>
A native plasmid of Bacillus thuringiensis subsp. kurstaki strain YBT-1520 named pBMB9741 has been successfully cloned, sequenced, and characterized. Twelve open reading frames of at least 50 amino acids were identified. BLAST search indicated that three of them encode conserved proteins involved in conjugative mobilization, replication initiation, and transcription regulation. The orf6 located within a 2.2-kb minimal replication region was predicted to encode a replication protein. An homologous study of the orf6 product suggested that this plasmid might engage a rolling-circle replication mechanism. Unlike many other plasmids that adopt a rolling-circle model to replicate, pBMB9741 demonstrated strong segregation stability. When tested at 28 degrees C, 37 degrees C, and 42 degrees C, this plasmid maintained 100% stability in a variety of strains, including wild-type strains of B. thuringiensis and B. cereus, as well as plasmidless mutants of B. thuringiensis subsp. kurstaki and subsp. israelensis.
|
40. |
Shu C,
Liu R,
Wang R,
Zhang J,
Feng S,
Huang D,
Song F,
( 2007 ) Improving toxicity of Bacillus thuringiensis strain contains the cry8Ca gene specific to Anomala corpulenta larvae. PMID : 17805927 : DOI : 10.1007/s00284-007-9018-3 Abstract >>
The cry8C-type gene designated cry8Ca2, which was cloned and sequenced from a Bacillus thuringiensis isolate HBF-1 in China, consisted of an open reading frame of 3483 bp encoding a protein of 1160 amino-acid residues. Sequence analysis showed that the Cry8Ca2 protoxin of 130.5 kDa had 99.9% sequence homology with the previously reported Cry8Ca1 protein, with one mismatch between the two amino-acid sequences. When the Cry8Ca2 toxin was expressed in a crystal-negative strain of B. thuringiensis (HD-73(-)), elliptical crystals were produced. Cell extracts from this recombinant strain showed insecticidal activity against Anomala corpulenta larva. Mutant cry8Ca2 genes, produced by polymerase chain reaction amplification with Taq DNA polymerase, were used to develop recombinant B. thuringiensis strains. Mutants producing higher levels of insecticidal activity were identified by bioassay. Thirty-five mutants forming crystals were characterized, and two of them showed significantly increased insecticidal activity against A. corpulenta larva. The 50% lethality concentrations (LC(50)) of the two mutants were 0.2334 x 10(8) and 0.2591 x 10(8) colony-forming units g(-1), considerably lower than the LC(50) of the wild-type strain HBF-1 (0.9583 x 10(8) CFU g(-1)) and that of B. thuringiensis serovar japonensis strain Buibui (1.0752 x 10(8) CFU g(-1)).
|
41. |
Berón CM,
Salerno GL,
( 2007 ) Cloning and characterization of a novel crystal protein from a native Bacillus thuringiensis isolate highly active against Aedes aegypti. PMID : 17334846 : DOI : 10.1007/s00284-006-0299-8 Abstract >>
We characterized a novel Bacillus thuringiensis isolate native to Argentina (FCC 41) that exhibits a mosquitocidal activity higher than the reference B. thuringiensis subsp. israelensis. This isolate shows a rounded crystal harboring two major proteins of about 70-80 kDa. Moreover, we cloned and sequenced the encoding gene of one of the crystal proteins (Cry) consisting of an open reading frame of 2061 pb that encodes a protein of 687 amino acid residues. The deduced amino acid sequence has a predicted relative molecular mass of 78 kDa and is 52% and 45% identical to those of the reported Cry24Aa and Cry24Ba sequences, respectively. The novel Cry protein was designated as Cry24Ca, which also exhibited larvicidal activity against Aedes aegypti when its encoding gene was expressed in an Escherichia coli host strain.
|
42. |
Hayakawa T,
Kanagawa R,
Kotani Y,
Kimura M,
Yamagiwa M,
Yamane Y,
Takebe S,
Sakai H,
( 2007 ) Parasporin-2Ab, a newly isolated cytotoxic crystal protein from Bacillus thuringiensis. PMID : 17700988 : DOI : 10.1007/s00284-006-0351-8 Abstract >>
A novel crystal protein that exhibited potent cytotoxicity against human leukemic T-cells was cloned from the Bacillus thuringiensis TK-E6 strain. The protein, designated as parasporin-2Ab (PS2Ab), was a polypeptide of 304 amino acid residues with a predicted molecular weight of 33,017. The deduced amino acid sequence of PS2Ab showed significant homology (84% identitiy) to parasporin-2Aa (PS2Aa) from the B. thuringiensis A1547 strain. Upon processing of PS2Ab with proteinase K, the active form of 29 kDa was produced. The activated PS2Ab showed potent cytotoxicity against MOLT-4 and Jurkat cells and the EC(50) values were estimated as 0.545 and 0.745 ng/mL, respectively. The cytotoxicity of PS2Ab was significantly higher than that of PS2Aa reported elsewhere. Although both cytotoxins were structurally related, it was thought that the minor differences found were responsible for the different cytotoxicities of PS2Ab and PS2Aa.
|
43. |
Zhang LL,
Lin J,
Luo L,
Guan CY,
Zhang QL,
Guan Y,
Zhang Y,
Ji JT,
Huang ZP,
Guan X,
( 2007 ) A novel Bacillus thuringiensis strain LLB6, isolated from bryophytes, and its new cry2Ac-type gene. PMID : 17309508 : DOI : 10.1111/j.1472-765X.2006.02072.x Abstract >>
To isolate and characterize the novel Bacillus thuringiensis strains from bryophytes collected from Wuyi Mountain, Fujian Province of China, and identify new B. thuringiensis strains and toxins active against mosquitoes. Twelve novel B. thuringiensis strains were isolated from 76 bryophyte samples. According to the results of this preliminary screening, LLB6 was the most toxic to Aedes albopictus. Then phase-contrast as well as scanning electron microscopy, bioassays, cloning, sequencing and expression were performed to characterize the novel isolate LLB6 and its new gene cry2Ac5. Bacillus thuringiensis occurred naturally on bryophytes. LLB6 isolated from Physcomitrium japonicum was toxic to A. albopictus. A new cry2Ac5 gene of LLB6 was detected, cloned and expressed successfully. Bioassays on A. albopictus showed that the expressed Cry2Ac5 was also toxic to the third instar larvae. This is the first report of B. thuringiensis strains isolated from bryophytes. It represents a specific source of new B. thuringiensis strains and is of great importance for the knowledge of the ecology of B. thuringiensis. Novel LLB6 harboring the new gene cry2Ac5 and its expressed Cry2Ac5 protein revealed activity against A. albopictus and became a new member of B. thuringiensis toxins.
|
44. |
Brown KL,
Whiteley HR,
( 1992 ) Molecular characterization of two novel crystal protein genes from Bacillus thuringiensis subsp. thompsoni. PMID : 1729243 : DOI : 10.1128/jb.174.2.549-557.1992 PMC : PMC205749 Abstract >>
Two genes encoding the predominant polypeptides of Bacillus thuringiensis subsp. thompsoni cuboidal crystals were cloned in Escherichia coli and sequenced. The polypeptides have electrophoretic mobilities of 40 and 34 kDa, with the deduced amino acid sequences predicting molecular masses of 35,384 and 37,505 Da, respectively. No statistically significant similarities were detected between the 40- or 34-kDa crystal protein and any other characterized B. thuringiensis crystal protein, nor were they detected between the 40- and 34-kDa crystal proteins. A 100-MDa plasmid carries both crystal protein genes, which appear to be part of an operon, with the 40-kDa gene 64 nucleotides upstream of the 34-kDa gene. Both crystal proteins are synthesized in approximately the same amounts. Even though small compared with other crystal proteins, the 34-kDa crystal protein has insecticidal activity against lepidopteran larvae (Manduca sexta). The 40-kDa polypeptide appears to have no insecticidal activity, but it could have a role in crystal structure.
|
45. |
Lereclus D,
Arantes O,
( 1992 ) spbA locus ensures the segregational stability of pTH1030, a novel type of gram-positive replicon. PMID : 1738313 : DOI : 10.1111/j.1365-2958.1992.tb00835.x Abstract >>
The replication region of the plasmid pHT1030 of Bacillus thuringiensis was previously mapped to a 2.9 kb DNA fragment. The DNA sequence was analysed and it was shown that the minimal replicon resides within a 1 kb fragment of DNA carrying no potential protein coding sequence. Moreover, no production of single-stranded DNA intermediates was detected in the plasmid-containing cells. pHT1030 therefore belongs to a class of replicons not previously described in Gram-positive bacteria. Examination of the segregational stability of deletion derivatives of pHT1030 in bacilli defined two stability regions. One is located within the minimal replicon of pHT1030, whereas the second (spbA) is not required for replication. spbA encodes a 15 kDa protein and ensures the segregational stability of the plasmid. This effect of spbA is particularly highlighted in sporulation. The absence of the spbA locus gives rise to plasmid-free spores at high frequency, whereas the spbA+ plasmids are stably maintained. The stability of the plasmids during sporulation seems to be correlated with an unequal division of the cell by the sporulation septum.
|
46. |
Zhao C,
Luo Y,
Song C,
Liu Z,
Chen S,
Yu Z,
Sun M,
( 2007 ) Identification of three Zwittermicin A biosynthesis-related genes from Bacillus thuringiensis subsp. kurstaki strain YBT-1520. PMID : 17225146 : DOI : 10.1007/s00203-006-0196-3 Abstract >>
Zwittermicin A (ZwA) is a novel, broad-spectrum linear aminopolyol antibiotic produced by some Bacillus cereus and Bacillus thuringiensis. However, only part of its biosynthesis cluster has been identified and characterized from B. cereus UW85. To better understand the biosynthesis cluster of ZwA, a bacterial artificial chromosome (BAC) library of B. thuringiensis subsp. kurstaki strain YBT-1520, a ZwA-producing strain, was constructed. Two BAC clones, 1F8 and 5E2, were obtained by PCR, which overlap the known ZwA biosynthesis cluster of B. cereus UW85. This ZwA biosynthesis cluster is at least 38.6 kb and is located on the chromosome, instead of the plasmid. Partial DNA sequencing revealed both BAC clones carry three new ZwA biosynthesis-related genes, zwa6, zwa5A and zwa5B, which were found at the corresponding location of B. cereus UW85. Putative amino acid sequences of these genes shown that ZWA6 is homologous to a typical carbamoyltransferase from Streptomyces avermitilis, while ZWA5A and ZWA5B are homologs of cysteine synthetase and ornithine cyclodeaminase which jointly synthesize 2,3-diaminopropionate in the viomycin biosynthesis pathway, respectively. The identification of these three genes further supports the hypothesized ZwA biosynthesis pathway.
|
47. |
Fang J,
Xu X,
Wang P,
Zhao JZ,
Shelton AM,
Cheng J,
Feng MG,
Shen Z,
( 2007 ) Characterization of chimeric Bacillus thuringiensis Vip3 toxins. PMID : 17122403 : DOI : 10.1128/AEM.02079-06 PMC : PMC1800787 Abstract >>
Bacillus thuringiensis vegetative insecticidal proteins (Vip) are potential alternatives for B. thuringiensis endotoxins that are currently utilized in commercial transgenic insect-resistant crops. Screening a large number of B. thuringiensis isolates resulted in the cloning of vip3Ac1. Vip3Ac1 showed high insecticidal activity against the fall armyworm Spodoptera frugiperda and the cotton bollworm Helicoverpa zea but very low activity against the silkworm Bombyx mori. The host specificity of this Vip3 toxin was altered by sequence swapping with a previously identified toxin, Vip3Aa1. While both Vip3Aa1 and Vip3Ac1 showed no detectable toxicity against the European corn borer Ostrinia nubilalis, the chimeric protein Vip3AcAa, consisting of the N-terminal region of Vip3Ac1 and the C-terminal region of Vip3Aa1, became insecticidal to the European corn borer. In addition, the chimeric Vip3AcAa had increased toxicity to the fall armyworm. Furthermore, both Vip3Ac1 and Vip3AcAa are highly insecticidal to a strain of cabbage looper (Trichoplusia ni) that is highly resistant to the B. thuringiensis endotoxin Cry1Ac, thus experimentally showing for the first time the lack of cross-resistance between B. thuringiensis Cry1A proteins and Vip3A toxins. The results in this study demonstrated that vip3Ac1 and its chimeric vip3 genes can be excellent candidates for engineering a new generation of transgenic plants for insect pest control.
|
48. |
Lin Y,
Fang G,
Peng K,
( 2007 ) Characterization of the highly variable cry gene regions of Bacillus thuringiensis strain ly4a3 by PCR-SSCP profiling and sequencing. PMID : 17151960 : DOI : 10.1007/s10529-006-9224-2 Abstract >>
Characterization of cry gene contents can help to predict the insecticidal activities of Bacillus thuringiensis isolates and in the searching of new cry genes. PCR-Single-strand conformation polymorphism (SSCP) profiling and sequencing of the highly variable cry gene regions were used to characterize cry gene content of B. thuringiensis strain ly4a3. The highly variable regions with about 1100 bp in sizes were amplified using a degenerate primer pair for cry genes, OL2(d) and OL5(r). A library of the PCR product was constructed, and all white colonies were subjected to PCR using another degenerate primer pair for cry genes, OL3(d) and OL5(r), with products about 250 bp in sizes. Two different profiles were observed based on SSCP profiling for the PCR products. The cry genes in the two corresponding colonies were sequenced and their deduced amino acids showed high identities to Cry1Ab (84.5% approximately 98.4%) and Cry1I (88.78% approximately 98.4%), respectively. This method allows the quick characterization of cry gene content of B. thuringiensis isolates and the detection of new cry genes.
|
49. |
Hu K,
Yang H,
Liu G,
Tan H,
( 2006 ) Identification and characterization of a polysaccharide deacetylase gene from Bacillus thuringiensis. PMID : 17110961 : DOI : 10.1139/w06-045 Abstract >>
One polysaccharide deacetylase gene was cloned from Bacillus thuringiensis and designated pdaA. Disruption of pdaA did not affect vegetative growth and sporulation but obviously affected spore germination. When L-alanine was added into the spore suspension, the spores of the pdaA disruption mutant showed a slow and partial reduction in absorbance at OD600 and became phase pale gray compared with phase dark of the wild-type strain. In contrast with the outgrowing of wild-type spores after germination, the pdaA mutant spores were blocked at the stage of spore germination. Transmission electron micrographs revealed a significant difference between the pdaA mutant and the wild-type strain in the spore cortex. Introduction of the pdaA gene into the pdaA disruption mutant complemented the germination-negative phenotype. Reverse transcription--polymerase chain reaction showed that pdaA was transcribed after incubation for 10 h in CCY medium.
|
50. |
Xu D,
Côté JC,
( 2006 ) Sequence diversity of the Bacillus thuringiensis and B. cereus sensu lato flagellin (H antigen) protein: comparison with H serotype diversity. PMID : 16820457 : DOI : 10.1128/AEM.00328-06 PMC : PMC1489342 Abstract >>
We set out to analyze the sequence diversity of the Bacillus thuringiensis flagellin (H antigen [Hag]) protein and compare it with H serotype diversity. Some other Bacillus cereus sensu lato species and strains were added for comparison. The internal sequences of the flagellin (hag) alleles from 80 Bacillus thuringiensis strains and 16 strains from the B. cereus sensu lato group were amplified and cloned, and their nucleotide sequences were determined and translated into amino acids. The flagellin allele nucleotide sequences for 10 additional strains were retrieved from GenBank for a total of 106 Bacillus species and strains used in this study. These included 82 B. thuringiensis strains from 67 H serotypes, 5 B. cereus strains, 3 Bacillus anthracis strains, 3 Bacillus mycoides strains, 11 Bacillus weihenstephanensis strains, 1 Bacillus halodurans strain, and 1 Bacillus subtilis strain. The first 111 and the last 66 amino acids were conserved. They were referred to as the C1 and C2 regions, respectively. The central region, however, was highly variable and is referred to as the V region. Two bootstrapped neighbor-joining trees were generated: a first one from the alignment of the translated amino acid sequences of the amplified internal sequences of the hag alleles and a second one from the alignment of the V region amino acid sequences, respectively. Of the eight clusters revealed in the tree inferred from the entire C1-V-C2 region amino acid sequences, seven were present in corresponding clusters in the tree inferred from the V region amino acid sequences. With regard to B. thuringiensis, in most cases, different serovars had different flagellin amino acid sequences, as might have been expected. Surprisingly, however, some different B. thuringiensis serovars shared identical flagellin amino acid sequences. Likewise, serovars from the same H serotypes were most often found clustered together, with exceptions. Indeed, some serovars from the same H serotype carried flagellins with sufficiently different amino acid sequences as to be located on distant clusters. Species-wise, B. halodurans, B. subtilis, and B. anthracis formed specific branches, whereas the other four species, all in the B. cereus sensu lato group, B. mycoides, B. weihenstephanensis, B. cereus, and B. thuringiensis, did not form four specific clusters as might have been expected. Rather, strains from any of these four species were placed side by side with strains from the other species. In the B. cereus sensu lato group, B. anthracis excepted, the distribution of strains was not species specific.
|
51. |
Ruiz de Escudero I,
Estela A,
Porcar M,
Martínez C,
Oguiza JA,
Escriche B,
Ferré J,
Caballero P,
( 2006 ) Molecular and insecticidal characterization of a Cry1I protein toxic to insects of the families Noctuidae, Tortricidae, Plutellidae, and Chrysomelidae. PMID : 16820473 : DOI : 10.1128/AEM.02861-05 PMC : PMC1489379 Abstract >>
The most notable characteristic of Bacillus thuringiensis is its ability to produce insecticidal proteins. More than 300 different proteins have been described with specific activity against insect species. We report the molecular and insecticidal characterization of a novel cry gene encoding a protein of the Cry1I group with toxic activity towards insects of the families Noctuidae, Tortricidae, Plutellidae, and Chrysomelidae. PCR analysis detected a DNA sequence with an open reading frame of 2.2 kb which encodes a protein with a molecular mass of 80.9 kDa. Trypsin digestion of this protein resulted in a fragment of ca. 60 kDa, typical of activated Cry1 proteins. The deduced sequence of the protein has homologies of 96.1% with Cry1Ia1, 92.8% with Cry1Ib1, and 89.6% with Cry1Ic1. According to the Cry protein classification criteria, this protein was named Cry1Ia7. The expression of the gene in Escherichia coli resulted in a protein that was water soluble and toxic to several insect species. The 50% lethal concentrations for larvae of Earias insulana, Lobesia botrana, Plutella xylostella, and Leptinotarsa decemlineata were 21.1, 8.6, 12.3, and 10.0 microg/ml, respectively. Binding assays with biotinylated toxins to E. insulana and L. botrana midgut membrane vesicles revealed that Cry1Ia7 does not share binding sites with Cry1Ab or Cry1Ac proteins, which are commonly present in B. thuringiensis-treated crops and commercial B. thuringiensis-based bioinsecticides. We discuss the potential of Cry1Ia7 as an active ingredient which can be used in combination with Cry1Ab or Cry1Ac in pest control and the management of resistance to B. thuringiensis toxins.
|
52. |
Sauka DH,
Amadio AF,
Zandomeni RO,
Benintende GB,
( 2007 ) Strategy for amplification and sequencing of insecticidal cry1A genes from Bacillus thuringiensis. PMID : 17096209 : DOI : 10.1007/s10482-006-9125-3 Abstract >>
A feasible and fully described strategy, with a detailed list of primers, for amplifying, cloning and sequencing known and potentially novel cry1A genes harboured by a Bacillus thuringiensis strain was successfully established. Based on the analysis of conserved regions of the cry1A genes, the 1AF and 1UR oligonucleotide primers were designed to amplify the whole open reading frame of these genes. The PCR products obtained revealed the successful amplification of cry1A genes from 13 B. thuringiensis strains. These bacteria were previously known to harbour at least one cry1A gene. An Argentinean B. thuringiensis isolate INTA Mo1-12 was randomly chosen for cloning and sequencing of cry1A genes by using a primer set developed in this study. Both nucleotide and amino acid sequences similarity analysis revealed that cry1Aa and cry1Ac from B. thuringiensis INTA Mo1-12 are new natural variants, showing several differences with the other known cry1A subclasses. These genes were named by the B. thuringiensis Pesticidal Crystal Protein Nomenclature Committee as cry1Aa15 and cry1Ac21 respectively.
|
53. |
Hajaij-Ellouze M,
Fedhila S,
Lereclus D,
Nielsen-LeRoux C,
( 2006 ) The enhancin-like metalloprotease from the Bacillus cereus group is regulated by the pleiotropic transcriptional activator PlcR but is not essential for larvicidal activity. PMID : 16790012 : DOI : 10.1111/j.1574-6968.2006.00289.x Abstract >>
Bacillus cereus group bacteria produce virulence factors. Many of these are regulated by the pleiotropic transcriptional activator PlcR, which is implicated in insect virulence. In silico analysis of the B. cereus strain ATCC14579 genome showed an enhancin-like gene preceded by a typical PlcR binding sequence. The gene is predicted to encode a polypeptide showing 23-25% identity with enhancins from several baculoviruses and 31% with that of Yersinia pestis. Viral enhancin acts after oral infection and degrades the peritrophic matrix of various Lepidopteran larvae. To rule out a possible implication of Bacillus enhancin in insect virulence, we sequenced the enhancin gene from the Bacillus thuringiensis 407-crystal minus strain and investigated its gene regulation and larvicidal activity. A typical metalloprotease zinc-binding domain (HEIAH) was detected and the gene was named mpbE (metalloprotease bacillus enhancin). An mpbE'-lacZ transcriptional fusion demonstrated that mpbE belongs to the PlcR regulon. The mpbE mutant was fed to Galleria mellonella larvae, and no significant reduction in virulence was observed. However, this may not exclude MpbE from a role in pathogenesis.
|
54. |
Cai J,
Xiao L,
Yan B,
Bin G,
Chen Y,
Ren G,
( 2006 ) Vip3A is responsible for the potency of Bacillus thuringiensis 9816C culture supernatant against Helicoverpa armigera and Spodoptera exigua. PMID : 16778351 : Abstract >>
Culture supernatant of Bacillus thuringiensis 9816C had high toxicity against Helicoverpa armigera and Spodoptera exigua. However, it lost insecticidal activities after being bathed in boiling water for 5 min. Acrystalliferous mutants of Bt9816C (Bt9816C-NP1 and Bt9816C-NP2) cured of its endogenous plasmids no longer possessed vip3A gene and toxicity. The 89 kD protein which existed in Bt9816C supernatant disappeared in the two mutants' supernatant; nevertheless, the two mutants still exhibited hemolytic and phospholipase C activity as Bt9816C did. The vip3A gene of Bt9816C, vip3Aa18, was cloned and expressed in Escherichia coli BL21. Bioassay demonstrated that the recombinant E. coli had high toxicity against S. exigua. Taken together, it suggested that Vip3A protein was responsible for the toxicity of Bt9816C culture supernatants.
|
55. |
Yu H,
Zhang J,
Huang D,
Gao J,
Song F,
( 2006 ) Characterization of Bacillus thuringiensis strain Bt185 toxic to the Asian cockchafer: Holotrichia parallela. PMID : 16775781 : DOI : 10.1007/s00284-005-0097-8 Abstract >>
A new Bacillus thuringiensis strain, Bt185, was isolated from HeBei soil samples in China. Observations after transmission electron microscopy found that the strain produced spherical parasporal inclusions similar to that of the B. thuringiensis subsp. japonensis Buibui strain, which showed toxicity to both Anomala corpulenta and Popillia japonica. The plasmid profile seen on an agarose gel revealed that Bt185 contained six large bands of 191 kb, 161 kb, 104 kb, 84 kb, 56 kb, and 37 kb. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis revealed one major band with an estimated molecular mass of 130 kDa. Polymerase chain reaction-restriction fragment length polymorphism results showed that a novel cry8-type gene sequence was found in the Bt185 strain. When we screened for this novel gene sequence, an additional novel cry8-type gene was isolated, having a partial sequence of 2340 bp and encoding a protein of 780 amino acids. Bioassay results showed that Bt185 had no toxicity against several Coleopteran and Lepidopteran pests. However, Bt185 exhibited toxicity against larvae of the Asian cockchafer, Holotrichia parallela. This is the first report of the occurrence of a Bacillus strain that has insecticidal activity against Holotrichia parallela larvae.
|
56. |
Yasutake K,
Binh ND,
Kagoshima K,
Uemori A,
Ohgushi A,
Maeda M,
Mizuki E,
Yu YM,
Ohba M,
( 2006 ) Occurrence of parasporin-producing Bacillus thuringiensis in Vietnam. PMID : 16699587 : DOI : 10.1139/w05-134 Abstract >>
A total of 63 Bacillus thuringiensis isolates were recovered from urban soils of Hanoi, Vietnam. Of these, 34 were identified to 12 H serogroups. None of the isolates showed larvicidal activities against three lepidopterous insects. Three isolates belonging to the two serovars, colmeri (H21) and konkukian (H34), were highly toxic to larvae of the mosquito Aedes aegypti. Parasporal inclusion proteins of four isolates exhibited cytocidal activities against HeLa cells. Immunologically, proteins of four isolates were closely related to parasporin-1 (Cry31Aa), a parasporal protein that preferentially kills human cancer cells. Haemolytic activities were associated with parasporal proteins of the three mosquitocidal isolates but not with those of the four cancer-cell-killing isolates. PCR experiments and nucleotide sequence analysis revealed that the genes of four anti-cancer isolates are closely related to the gene parasporin-1 (cry31Aa) but are dissimilar to those of the three other existing parasporins. Our results suggest that the soil of northern Vietnam is a good reservoir of parasporin-producing B. thuringiensis.
|
57. |
Steggles JR,
Wang J,
Ellar DJ,
( 2006 ) Discovery of Bacillus thuringiensis virulence genes using signature-tagged mutagenesis in an insect model of septicaemia. PMID : 16941243 : DOI : 10.1007/s00284-006-0037-2 Abstract >>
Transposon Tn917 was used to identify Bacillus thuringiensis genes required for virulence and survival in a Manduca sexta (tobacco hornworm) septicaemia model. Uniquely tagged transposons, n = 72, were constructed and used to generate 1152 insertion mutants. Sixteen pools of 72 mutants were screened in the infection model, and 12 virulence-attenuated mutants were unable to survive the infection. Analysis of the mutated DNA sequences implicated an arsR family transcriptional regulator, a histone-like DNA-binding protein, a transposon, and several sequences of unknown function in B. thuringiensis pathogenesis.
|
58. |
Chao L,
Qiyu B,
Fuping S,
Ming S,
Dafang H,
Guiming L,
Ziniu Y,
( 2007 ) Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520. PMID : 16901541 : DOI : 10.1016/j.plasmid.2006.06.002 Abstract >>
The complete nucleotide sequence of a large (67kb) cryptic plasmid pBMB67 from Bacillus thuringiensis strain YBT-1520 was determined. Of the 74 predicted open reading frames (ORFs), 25 (34%) were assigned putative functions, 18 (24%) encoded conserved hypothetical proteins, and 31 (42%) had no homology to any genes present in the current open databases. The ORFs with similar functions were organized in a modular structure; thus, the DNA sequence of pBMB67 could be functionally divided into three modules, including a 39kb transfer region encoding homologs of the Agrobacterium tumefaciens VirB/D4 system components VirB1, VirB4, VirB11, and VirD4, as well as homologs of Gram-positive conjugation proteins. We also found a potential operon that was analogous to the Rap-Phr cassettes from Bacillus subtilis, which are involved in cell-cell communication and transcriptional regulation. Thus, we suggest that pBMB67 is likely to be implicated in cell-cell signaling and plays a role in the regulation of several cellular processes, with the production of exoprotease being one of the candidates.
|
59. |
Iddar A,
Valverde F,
Assobhei O,
Serrano A,
Soukri A,
( 2005 ) Widespread occurrence of non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase among gram-positive bacteria. PMID : 16562377 : Abstract >>
The non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase (GAPDHN, NADP+-specific, EC 1.2.1.9) is present in green eukaryotes and some Streptococcus strains. The present report describes the results of activity and immunoblot analyses, which were used to generate the first survey of bacterial GAPDHN distribution in a number of Bacillus, Streptococcus and Clostridium strains. Putative gapN genes were identified after PCR amplification of partial 700-bp sequences using degenerate primers constructed from highly conserved protein regions. Alignment of the amino acid sequences of these fragments with those of known sequences from other eukaryotic and prokaryotic GAPDHNs, demonstrated the presence of conserved residues involved in catalytic activity that are not conserved in aldehyde dehydrogenases, a protein family closely linked to GAPDHNs. The results confirm that the basic structural features of the members of the GAPDHN family have been conserved throughout evolution and that no identity exists with phosphorylating GAPDHs. Furthermore, phylogenetic trees generated from multiple sequence alignments suggested a close relationship between plant and bacterial GAPDHN families.
|
60. |
Smulevitch SV,
Osterman AL,
Shevelev AB,
Kaluger SV,
Karasin AI,
Kadyrov RM,
Zagnitko OP,
Chestukhina GG,
Stepanov VM,
( 1991 ) Nucleotide sequence of a novel delta-endotoxin gene cryIg of Bacillus thuringiensis ssp. galleriae. PMID : 1660003 : DOI : 10.1016/0014-5793(91)81144-w Abstract >>
A gene cryIg coding for entomocidal protein delta-endotoxin of Bacillus thuringiensis ssp. galleriae str. 11-67 named CryIG has been cloned and sequenced (EMBL accession number X58120). The deduced amino acid sequence that contains 1156 amino acid residues shows only 28% of identical residues, when compared with other delta-endotoxins of the CryI family. The extent of identity is substantially higher for some regions of the sequence ('conserved blocks'), that presumably bear important structural or functional properties. This implies that CryIG delta-endotoxin follows the same type of polypeptide chain folding as other CryI proteins, whereas peculiarities of primary structure help to explain its unique specificity.
|
61. |
Daffonchio D,
Raddadi N,
Merabishvili M,
Cherif A,
Carmagnola L,
Brusetti L,
Rizzi A,
Chanishvili N,
Visca P,
Sharp R,
Borin S,
( 2006 ) Strategy for identification of Bacillus cereus and Bacillus thuringiensis strains closely related to Bacillus anthracis. PMID : 16461679 : DOI : 10.1128/AEM.72.2.1295-1301.2006 PMC : PMC1392923 Abstract >>
Bacillus cereus strains that are genetically closely related to B. anthracis can display anthrax-like virulence traits (A. R. Hoffmaster et al., Proc. Natl. Acad. Sci. USA 101:8449-8454, 2004). Hence, approaches that rapidly identify these "near neighbors" are of great interest for the study of B. anthracis virulence mechanisms, as well as to prevent the use of such strains for B. anthracis-based bioweapon development. Here, a strategy is proposed for the identification of near neighbors of B. anthracis based on single nucleotide polymorphisms (SNP) in the 16S-23S rRNA intergenic spacer (ITS) containing tRNA genes, characteristic of B. anthracis. By using restriction site insertion-PCR (RSI-PCR) the presence of two SNP typical of B. anthracis was screened in 126 B. cereus group strains of different origin. Two B. cereus strains and one B. thuringiensis strain showed RSI-PCR profiles identical to that of B. anthracis. The sequencing of the entire ITS containing tRNA genes revealed two of the strains to be identical to B. anthracis. The strict relationship with B. anthracis was confirmed by multilocus sequence typing (MLST) of four other independent loci: cerA, plcR, AC-390, and SG-749. The relationship to B. anthracis of the three strains described by MLST was comparable and even higher to that of four B. cereus strains associated with periodontitis in humans and previously reported as the closest known strains to B. anthracis. SNP in ITS containing tRNA genes combined with RSI-PCR provide a very efficient tool for the identification of strains closely related to B. anthracis.
|
62. |
Donovan WP,
Engleman JT,
Donovan JC,
Baum JA,
Bunkers GJ,
Chi DJ,
Clinton WP,
English L,
Heck GR,
Ilagan OM,
Krasomil-Osterfeld KC,
Pitkin JW,
Roberts JK,
Walters MR,
( 2006 ) Discovery and characterization of Sip1A: A novel secreted protein from Bacillus thuringiensis with activity against coleopteran larvae. PMID : 16489451 : DOI : 10.1007/s00253-006-0332-7 Abstract >>
Bioassay screening of Bacillus thuringiensis culture supernatants identified strain EG2158 as having larvicidal activity against Colorado potato beetle (Leptinotarsa decemlineata) larvae. Ion-exchange fractionation of the EG2158 culture supernatant resulted in the identification of a protein designated Sip1A (secreted insecticidal protein) of approximately 38 kDa having activity against Colorado potato beetle (CPB). An oligonucleotide probe based on the N-terminal sequence of the purified Sip1A protein was used to isolate the sip1A gene. The sequence of the Sip1A protein, as deduced from the sequence of the cloned sip1A gene, contained 367 residues (41,492 Da). Recombinant B. thuringiensis and Escherichia coli harboring cloned sip1A produced Sip1A protein which had insecticidal activity against larvae of CPB, southern corn rootworm (Diabrotica undecimpunctata howardi), and western corn rootworm (Diabrotica virgifera virgifera).
|
63. |
Ehling-Schulz M,
Guinebretiere MH,
Monthán A,
Berge O,
Fricker M,
Svensson B,
( 2006 ) Toxin gene profiling of enterotoxic and emetic Bacillus cereus. PMID : 16842349 : DOI : 10.1111/j.1574-6968.2006.00320.x Abstract >>
Very different toxins are responsible for the two types of gastrointestinal diseases caused by Bacillus cereus: the diarrhoeal syndrome is linked to nonhemolytic enterotoxin NHE, hemolytic enterotoxin HBL, and cytotoxin K, whereas emesis is caused by the action of the depsipeptide toxin cereulide. The recently identified cereulide synthetase genes permitted development of a molecular assay that targets all toxins known to be involved in food poisoning in a single reaction, using only four different sets of primers. The enterotoxin genes of 49 strains, belonging to different phylogenetic branches of the B. cereus group, were partially sequenced to encompass the molecular diversity of these genes. The sequence alignments illustrated the high molecular polymorphism of B. cereus enterotoxin genes, which is necessary to consider when establishing PCR systems. Primers directed towards the enterotoxin complex genes were located in different CDSs of the corresponding operons to target two toxin genes with one single set of primers. The specificity of the assay was assessed using a panel of B. cereus strains with known toxin profiles and was successfully applied to characterize strains from food and clinical diagnostic labs as well as for the toxin gene profiling of B. cereus isolated from silo tank populations.
|
64. |
Sorokin A,
Candelon B,
Guilloux K,
Galleron N,
Wackerow-Kouzova N,
Ehrlich SD,
Bourguet D,
Sanchis V,
( 2006 ) Multiple-locus sequence typing analysis of Bacillus cereus and Bacillus thuringiensis reveals separate clustering and a distinct population structure of psychrotrophic strains. PMID : 16461712 : DOI : 10.1128/AEM.72.2.1569-1578.2006 PMC : PMC1392946 Abstract >>
We used multilocus sequence typing (MLST) to characterize phylogenetic relationships for a collection of Bacillus cereus group strains isolated from forest soil in the Paris area during a mild winter. This collection contains multiple strains isolated from the same soil sample and strains isolated from samples from different sites. We characterized 115 strains of this collection and 19 other strains based on the sequences of the clpC, dinB, gdpD, panC, purF, and yhfL loci. The number of alleles ranged from 36 to 53, and a total of 93 allelic profiles or sequence types were distinguished. We identified three major strain clusters-C, T, and W-based on the comparison of individual gene sequences or concatenated sequences. Some less representative clusters and subclusters were also distinguished. Analysis of the MLST data using the concept of clonal complexes led to the identification of two, five, and three such groups in clusters C, T, and W, respectively. Some of the forest isolates were closely related to independently isolated psychrotrophic strains. Systematic testing of the strains of this collection showed that almost all the strains that were able to grow at a low temperature (6 degrees C) belonged to cluster W. Most of these strains, including three independently isolated strains, belong to two clonal complexes and are therefore very closely related genetically. These clonal complexes represent strains corresponding to the previously identified species Bacillus weihenstephanensis. Most of the other strains of our collection, including some from the W cluster, are not psychrotrophic. B. weihenstephanensis (cluster W) strains appear to comprise an effectively sexual population, whereas Bacillus thuringiensis (cluster T) and B. cereus (cluster C) have clonal population structures.
|
65. |
Wu D,
Cao XL,
Bai YY,
Aronson AI,
( 1991 ) Sequence of an operon containing a novel delta-endotoxin gene from Bacillus thuringiensis. PMID : 1651878 : DOI : 10.1016/0378-1097(91)90466-n Abstract >>
An insect larval toxin designated CryII is produced by several subspecies of Bacillus thuringiensis and differs from the other major delta-endotoxins in these bacteria in its size, toxicity profile and presence as part of an operon with three open reading frames (ORF). Such an operon from a novel B. thuringiensis isolate has been cloned and differs from one previously characterized in the following ways: (a) the size and number of amino acid repeats in one of the ORFs; (b) the smaller size of the CryII protoxin and the presence of a unique 110-kDa CryII-related antigen; and (c) high larvicidal activity for a particular Lepidopteran but low activity for a Dipteran. Various subclones of this operon were introduced into a plasmid-free B. thuringiensis strain and only the cryII gene was found to be necessary for protoxin accumulation.
|
66. |
Yamashita S,
Katayama H,
Saitoh H,
Akao T,
Park YS,
Mizuki E,
Ohba M,
Ito A,
( 2005 ) Typical three-domain cry proteins of Bacillus thuringiensis strain A1462 exhibit cytocidal activity on limited human cancer cells. PMID : 16428294 : DOI : 10.1093/jb/mvi177 Abstract >>
Bacillus thuringiensis strain A1462 produced two parasporal inclusion proteins with a molecular mass of 88 kDa that were converted to 64-kDa toxins when activated by proteinase K digestion. Both toxins exhibited strong cytocidal activity against two human cancer cell lines, HL60 (myeloid leukemia cells) and HepG2 (liver cancer cells), while low or no toxicities were observed against 11 human and three mammalian cell lines, including four non-cancer cell lines. The cytotoxicity of both toxins on susceptible cells was characterized by rapid cell swelling. Gene cloning experiments provided two novel genes encoding 88-kDa Cry proteins, Cry41Aa and Cry41Ab. The amino acid sequences of the two proteins contain five block regions commonly conserved in B. thuringiensis insecticidal Cry proteins. This is the first report of the occurrence of typical three-domain Cry proteins with cytocidal activity preferential for cancer cells.
|
67. |
Ruan L,
He W,
He J,
Sun M,
Yu Z,
( 2005 ) Cloning and expression of mel gene from Bacillus thuringiensis in Escherichia coli. PMID : 15928981 : DOI : 10.1007/s10482-004-4775-5 Abstract >>
Previous work from our laboratory has shown that most of Bacillus thuringiensis strains possess the ability to produce melanin in the presence of L -tyrosine at elevated temperatures (42 degrees C). Furthermore, it was shown that the melanin produced by B. thuringiensis was synthesized by the action of tyrosinase, which catalyzed the conversion of L -tyrosine, via L -DOPA, to melanin. In this study, the tyrosinase-encoding gene (mel) from B. thuringiensis 4D11 was cloned using PCR techniques and expressed in Escherichia coli DH5 alpha. A DNA fragment with 1179 bp which contained the intact mel gene in the recombinant plasmid pGEM1179 imparted the ability to synthesize melanin to the E. coli recipient strain. The nucleotide sequence of this DNA fragment revealed an open reading frame of 744 bp, encoding a protein of 248 amino acids. The novel mel gene from B.thuringiensis expressed in E. coli DH5 alpha conferred UV protection on the recipient strain.
|
68. |
Thomas PW,
Stone EM,
Costello AL,
Tierney DL,
Fast W,
( 2005 ) The quorum-quenching lactonase from Bacillus thuringiensis is a metalloprotein. PMID : 15895999 : DOI : 10.1021/bi050050m Abstract >>
Lactonases from Bacillus species hydrolyze the N-acylhomoserine lactone (AHL) signaling molecules used in quorum-sensing pathways of many Gram-negative bacteria, including Pseudomonas aeruginosa and Erwinia carotovora, both significant pathogens. Because of sequence similarity, these AHL lactonases have been assigned to the metallo-beta-lactamase superfamily of proteins, which includes metalloenzymes of diverse activity, mechanism, and metal content. However, a recent study claims that AHL lactonase from Bacillus sp. 240B1 is not a metalloprotein [Wang, L. H., et al. (2004) J. Biol. Chem. 279, 13645]. Here, the gene for an AHL lactonase from Bacillus thuringiensis is cloned, and the protein is expressed, purified, and found to bind 2 equiv of zinc. The metal-bound form of AHL lactonase catalyzes the hydrolysis of N-hexanoyl-(S)-homoserine lactone but not the (R) enantiomer. Removal of both zinc ions results in loss of activity, and reconstitution with zinc restores activity, indicating the importance of metal ions for catalytic activity. Metal content, sequence alignments, and X-ray absorption spectroscopy of the zinc-containing lactonase all support a proposed dinuclear zinc binding site similar to that found in glyoxalase II.
|
69. |
Peña G,
Miranda-Rios J,
de la Riva G,
Pardo-López L,
Soberón M,
Bravo A,
( 2006 ) A Bacillus thuringiensis S-layer protein involved in toxicity against Epilachna varivestis (Coleoptera: Coccinellidae). PMID : 16391064 : DOI : 10.1128/AEM.72.1.353-360.2006 PMC : PMC1352243 Abstract >>
The use of Bacillus thuringiensis as a biopesticide is a viable alternative for insect control since the insecticidal Cry proteins produced by these bacteria are highly specific; harmless to humans, vertebrates, and plants; and completely biodegradable. In addition to Cry proteins, B. thuringiensis produces a number of extracellular compounds, including S-layer proteins (SLP), that contribute to virulence. The S layer is an ordered structure representing a proteinaceous paracrystalline array which completely covers the surfaces of many pathogenic bacteria. In this work, we report the identification of an S-layer protein by the screening of B. thuringiensis strains for activity against the coleopteran pest Epilachna varivestis (Mexican bean beetle; Coleoptera: Coccinellidae). We screened two B. thuringiensis strain collections containing unidentified Cry proteins and also strains isolated from dead insects. Some of the B. thuringiensis strains assayed against E. varivestis showed moderate toxicity. However, a B. thuringiensis strain (GP1) that was isolated from a dead insect showed a remarkably high insecticidal activity. The parasporal crystal produced by the GP1 strain was purified and shown to have insecticidal activity against E. varivestis but not against the lepidopteran Manduca sexta or Spodoptera frugiperda or against the dipteran Aedes aegypti. The gene encoding this protein was cloned and sequenced. It corresponded to an S-layer protein highly similar to previously described SLP in Bacillus anthracis (EA1) and Bacillus licheniformis (OlpA). The phylogenetic relationships among SLP from different bacteria showed that these proteins from Bacillus cereus, Bacillus sphaericus, B. anthracis, B. licheniformis, and B. thuringiensis are arranged in the same main group, suggesting similar origins. This is the first report that demonstrates that an S-layer protein is directly involved in toxicity to a coleopteran pest.
|
70. |
Schnepf HE,
Lee S,
Dojillo J,
Burmeister P,
Fencil K,
Morera L,
Nygaard L,
Narva KE,
Wolt JD,
( 2005 ) Characterization of Cry34/Cry35 binary insecticidal proteins from diverse Bacillus thuringiensis strain collections. PMID : 15811999 : DOI : 10.1128/AEM.71.4.1765-1774.2005 PMC : PMC1082557 Abstract >>
Bacillus thuringiensis crystal proteins of the Cry34 and Cry35 classes function as binary toxins showing activity on the western corn rootworm, Diabrotica virgifera virgifera LeConte. We surveyed 6,499 B. thuringiensis isolates by hybridization for sequences related to cry35A genes, identifying 78 strains. Proteins of the appropriate molecular mass (ca. 44 kDa) for Cry35 were observed in 42 of the strains. Full-length, or nearly full-length, sequences of 34 cry34 genes and 16 cry35 genes were also obtained from cloning, PCR analysis, and DNA sequencing. These included representatives of all known Cry34A, Cry34B, Cry35A, and Cry35B classes, as well as a novel Cry34A/Cry35A-like pair. Bioassay analysis indicated that cry35-hybridizing strains not producing a ca. 14-kDa protein, indicative of Cry34, were not active on corn rootworms, and that the previously identified Cry34A/Cry35A pairs were more active than the Cry34B/Cry35B pairs. The cry35-hybridizing B. thuringiensis strains were found in locales and materials typical for other B. thuringiensis strains. Comparison of the sequences with the geographic origins of the strains showed that identical, or nearly identical, sequences were found in strains from both Australasia and the Americas. Sequence similarity searches revealed that Cry34 proteins are similar to predicted proteins in Photorhabdus luminescens and Dictyostelium discoidium, and that Cry35Ab1 contains a segment similar to beta-trefoil domains that may be a binding motif. The binary Cry34/Cry35 B. thuringiensis crystal proteins thus appear closely related to each other, are environmentally ubiquitous, and share sequence similarities consistent with activity through membrane disruption in target organisms.
|
71. |
Kongsuwan K,
Gough J,
Kemp D,
McDevitt A,
Akhurst R,
( 2005 ) Characterization of a new Bacillus thuringiensis endotoxin, Cry47Aa, from strains that are toxic to the Australian sheep blowfly, Lucilia cuprina. PMID : 16168574 : DOI : 10.1016/j.femsle.2005.08.037 Abstract >>
Sixteen isolates of Bacillus thuringiensis, derived from various soil samples collected in Australia, are highly toxic to larvae of the sheep blowfly (Lucilia cuprina). The toxin gene from one of the strains (CAA890) was cloned by genome walking, and sequencing of the cloned fragments revealed a new cry gene, encoding a protein of 1134 amino acid residues, with a theoretical molecular mass of 139,209Da. Based on the amino acid sequence comparison with known Cry delta-endotoxins, the gene was designated cry47Aa. Homology modelling based on known crystal structures of the Cry toxins reveals the differences to be located in the loops of domain II in the putative toxin-receptor binding surfaces between Cry47Aa and the dipteran active Cry2Aa. We also showed that the cry47Aa gene is present in the other isolates that are highly toxic to the sheep blowfly.
|
72. |
Mesrati LA,
Tounsi S,
Jaoua S,
( 2005 ) Characterization of a novel vip3-type gene from Bacillus thuringiensis and evidence of its presence on a large plasmid. PMID : 15766790 : DOI : 10.1016/j.femsle.2005.02.007 Abstract >>
A novel vip3-type gene named vip3LB has been isolated from Bacillus thuringiensis strain BUPM95. The corresponding secreted vegetative insecticidal protein was active against the lepidopteran insect Ephestia kuehniella. The vip3LB gene was shown, for the first time, to be carried by the large plasmid containing the cry1Ia genes of B. thuringiensis. The nucleotide sequence predicted a protein of 789 amino acids residues with a calculated molecular mass of 88.5kDa. Both nucleotide and amino acid sequences similarity analysis revealed that vip3LB is a new vip3-type gene, presenting several differences with the other vip3-type genes. Heterologous expression of the vip3LB under the control of the strong promoter P(BAD) was performed in Escherichia coli and the produced protein conferred insecticidal activity against Ephestia kuehniella. This novel vegetative insecticidal protein Vip3LB could be a very useful biological control agent.
|
73. |
Easterday WR,
Van Ert MN,
Simonson TS,
Wagner DM,
Kenefic LJ,
Allender CJ,
Keim P,
( 2005 ) Use of single nucleotide polymorphisms in the plcR gene for specific identification of Bacillus anthracis. PMID : 15815042 : DOI : 10.1128/JCM.43.4.1995-1997.2005 PMC : PMC1081367 Abstract >>
A TaqMan-minor groove binding assay designed around a nonsense mutation in the plcR gene was used to genotype Bacillus anthracis, B. cereus, and B. thuringiensis isolates. The assay differentiated B. anthracis from these genetic near-neighbors and determined that the nonsense mutation is ubiquitous across 89 globally and genetically diverse B. anthracis strains.
|
74. |
Rang C,
Gil P,
Neisner N,
Van Rie J,
Frutos R,
( 2005 ) Novel Vip3-related protein from Bacillus thuringiensis. PMID : 16204549 : DOI : 10.1128/AEM.71.10.6276-6281.2005 PMC : PMC1265940 Abstract >>
A novel vip3-related gene was identified in Bacillus thuringiensis. This novel gene is 2,406 bp long and codes for a 91-kDa protein (801 amino acids). This novel protein exhibits between 61 and 62% similarity with Vip3A proteins and is designated Vip3Ba1. Vip3Ba1 has several specific features. Differences between Vip3Ba1 and the Vip3A proteins are spread throughout the sequence but are more frequent in the C-terminal part from amino acid 456 onward. The regions containing the two proteolytic processing sites, which are highly conserved among the Vip3A toxins, are markedly different in Vip3Ba1. The pattern DCCEE (Asp Cys Cys Glu Glu) is repeated four times between position 463 and 483 in Vip3Ba1, generating the sequence 463-DCCEEDCCEEDCCEEDCCEE-483. This sequence, which is rich in negatively charged amino acids, also contains 73% of the cysteines present in Vip3Ba1. This repeated sequence is not present in Vip3A proteins. The Vip3Ba1protein was produced in Escherichia coli and tested against Ostrinia nubilalis and Plutella xylostella, and it generated significant growth delays but had no larvicidal effect, indicating that its host range might be different than that of Vip3A proteins.
|
75. |
Letowski J,
Bravo A,
Brousseau R,
Masson L,
( 2005 ) Assessment of cry1 gene contents of Bacillus thuringiensis strains by use of DNA microarrays. PMID : 16151129 : DOI : 10.1128/AEM.71.9.5391-5398.2005 PMC : PMC1214684 Abstract >>
A single Bacillus thuringiensis strain can harbor numerous different insecticidal crystal protein (cry) genes from 46 known classes or primary ranks. The cry1 primary rank is the best known and contains the highest number of cry genes which currently totals over 130. We have designed an oligonucleotide-based DNA microarray (cryArray) to test the feasibility of using microarrays to identify the cry gene content of B. thuringiensis strains. Specific 50-mer oligonucleotide probes representing the cry1 primary and tertiary ranks were designed based on multiple cry gene sequence alignments. To minimize false-positive results, a consentaneous approach was adopted in which multiple probes against a specific gene must unanimously produce positive hybridization signals to confirm the presence of a particular gene. In order to validate the cryArray, several well-characterized B. thuringiensis strains including isolates from a Mexican strain collection were tested. With few exceptions, our probes performed in agreement with known or PCR-validated results. In one case, hybridization of primary- but not tertiary-ranked cry1I probes indicated the presence of a novel cry1I gene. Amplification and partial sequencing of the cry1I gene in strains IB360 and IB429 revealed the presence of a cry1Ia gene variant. Since a single microarray hybridization can replace hundreds of individual PCRs, DNA microarrays should become an excellent tool for the fast screening of new B. thuringiensis isolates presenting interesting insecticidal activity.
|
76. |
He W,
Ruan LF,
Sun M,
Li XX,
Yu ZN,
( 2004 ) [Cloning and expression of tyrosinase-encoding gene (mel) of Bacillus thuringiensis and its initial research of application]. PMID : 16110969 : Abstract >>
Tyrosinase, which is encoded by Tyrosinase gene (mel), is the key enzyme in the process of melanin formation in animals, plants and microorganisms. Using the primers designed by comparing the conserved domain of tyrosinase, a DNA fragment was amplified which contain the mel gene from Bacillus thuringiensis 4D11. The recombinant E. coli EMB1179 was gained by subcloning this DNA fragment onto the vector pGEM-7zf and transformed it into E. coli DH5alpha. EMB1179 express the tyrosinase activity and produce melanin under the presence of L-tyrosin. The effect of melanin on survival of E. coli was also determined. The results showed that the melanin produced by EMB1179 effectively increased its resistance against UV light.
|
77. |
Ohgushi A,
Saitoh H,
Wasano N,
Uemori A,
Ohba M,
( 2005 ) Cloning and characterization of two novel genes, cry24B and s1orf2, from a mosquitocidal strain of Bacillus thuringiensis serovar sotto. PMID : 16059769 : DOI : 10.1007/s00284-005-7529-3 Abstract >>
Two new crystal protein genes, cry24B and s1orf2, were cloned from a mosquitocidal Bacillus thuringiensis serovar sotto strain. The cry24B and s1orf2 genes encoded a 76-kDa and 62-kDa protein, respectively. The Cry24B protein retained five conserved regions commonly found in the existing Cry proteins. The amino acid sequence of the S1ORF2 had a high homology to that of the ORF2 protein of B. thuringiensis serovar jegathesan. Southern hybridization experiments with a cry24B gene-specific probe revealed that these genes are located on two large plasmids of > 100 kb. When the two genes, cry24B and s1orf2, were expressed in an acrystalliferous B. thuringiensis host, the proteins were synthesized and accumulated as inclusions. These inclusions exhibited no larvicidal activities against three mosquito species: Aedes aegypti, Anopheles stephensi, and Culex pipiens molestus. Likewise, the inclusions contained no cytocidal activity against HeLa cells.
|
78. |
Berón CM,
Curatti L,
Salerno GL,
( 2005 ) New strategy for identification of novel Cry-type genes from Bacillus thuringiensis strains. PMID : 15691928 : DOI : 10.1128/AEM.71.2.761-765.2005 PMC : PMC546719 Abstract >>
We designed five degenerate primers for detection of novel cry genes from Bacillus thuringiensis strains. An efficient strategy was developed based on a two-step PCR approach with these primers in five pair combinations. In the first step, only one of the primer pairs is used in the PCR, which allows amplification of DNA fragments encoding protein regions that include consensus domains of representative proteins belonging to different Cry groups. A second PCR is performed by using the first-step amplification products as DNA templates and the set of five primer combinations. Cloning and sequencing of the last-step amplicons allow both the identification of known cry genes encoding Cry proteins covering a wide phylogenetic distance and the detection and characterization of cry-related sequences from novel B. thuringiensis isolates.
|
79. |
Slamti L,
Lereclus D,
( 2005 ) Specificity and polymorphism of the PlcR-PapR quorum-sensing system in the Bacillus cereus group. PMID : 15659693 : DOI : 10.1128/JB.187.3.1182-1187.2005 PMC : PMC545710 Abstract >>
The expression of extracellular virulence factors in various species of the Bacillus cereus group is controlled by the plcR and papR genes, which encode a transcriptional regulator and a cell-cell signaling peptide, respectively. A processed form of PapR, presumably a pentapeptide, specifically interacts with PlcR to facilitate its binding to its DNA targets. This activating mechanism is strain specific, with this specificity being determined by the first residue of the pentapeptide. We carried out in vivo complementation assays and compared the PlcR-PapR sequences of 29 strains from the B. cereus group. Our findings suggested that the fifth amino acid of the pentapeptide is also involved in the specificity of activation. We identified four classes of PlcR-PapR pairs, defining four distinct pherotypes in the B. cereus group. We used these findings to look at the evolution of the PlcR-PapR quorum-sensing system with regard to the phylogeny of the species forming the B. cereus group.
|
80. |
Wu ZL,
Guo WY,
Qiu JZ,
Huang TP,
Li XB,
Guan X,
( 2004 ) Cloning and localization of vip3A gene of Bacillus thuringiensis. PMID : 15604775 : DOI : 10.1023/B:BILE.0000045645.45536.3f Abstract >>
An insecticidal protein gene, vip3A, was cloned from Bacillus thuringiensis strain WB50. The nucleotide sequence of 2,460 bp (GenBank acc. No. AY295778) showed 99% homology with the known vip3A genes. Using specific primers for vip3A gene, PCR was performed to demonstrate that the gene was not located on the bacterial chromosome and this was confirmed by Southern blotting using an internal fragment (486 bp) from vip3A gene as a probe. The gene was carried on a plasmid of 31.8 kb.
|
81. |
Chen J,
Dai LY,
Wang XP,
Tian YC,
Lu MZ,
( 2005 ) The cry3Aa gene of Bacillus thuringiensis Bt886 encodes a toxin against long-horned beetles. PMID : 15647932 : DOI : 10.1007/s00253-004-1859-0 Abstract >>
This report describes the identification of a new toxigenic strain of Bacillus thuringiensis specific for long-horned beetles. B. thuringiensis Bt866 encodes a cry3Aa-like gene (Bt886cry3Aa) that is 1,956 bp in length and is predicted to encode an 85.78-kDa protein. The gene is highly similar to cry3Aa1, differing in only six nucleotides and four amino acids. The four disparate amino acids occur within the conserved domains of the Cry3Aa toxin. The expression of Bt866cry3A in Escherichia coli cells resulted in a high level of toxicity toward Apriona germari Hope larvae. More than 75% of the larvae were killed; and the remaining survivors exhibited slower growth. These results indicate that the toxigenic strain Bt886cry3Aa encodes a protein that is specific against long-horned beetles. Genetic engineering of the Bt866cry3Aa gene into poplar plantations may provide resistance to long-horned beetles.
|
82. |
Vilas-Bôas GT,
Lemos MV,
( 2004 ) Diversity of cry genes and genetic characterization of Bacillus thuringiensis isolated from Brazil. PMID : 15467786 : DOI : 10.1139/w04-052 Abstract >>
Two hundred and eighteen Bacillus thuringiensis isolates from Brazil were characterized by the presence of crystal protein genes by PCR with primers specific to different cry and cyt genes. Among these isolates, 95 were selected according to their geographic origin for genetic characterization with the 16S rRNA gene, RAPD, and plasmid profile. Isolates containing cry1 genes were the most abundant (48%) followed by the cry11 and cyt (7%) and cry8 genes (2%). Finally, 40.3% of the isolates did not produce any PCR product. The plasmid profile and RAPD analysis showed a remarkable diversity among the isolates of B. thuringiensis not observed in the 16S rRNA gene. These results suggest that the genetic diversity of B. thuringiensis species results from the influence of different ecological factors and spatial separation between strains generated by the conquest of different habitats.
|
83. |
Huang T,
Liu J,
Song F,
Shu C,
Qiu J,
Guan X,
Huang D,
Zhang J,
( 2004 ) Identification, distribution pattern of IS231 elements in Bacillus thuringiensis and their phylogenetic analysis. PMID : 15556706 : DOI : 10.1016/j.femsle.2004.09.037 Abstract >>
In order to better understand the fundamental biology of Bacillus thuringiensis, a single oligonucleotide primer (5'-CATSSCCATCAASYTAAVR-3') was used to investigate the distribution pattern of IS231 elements in B. thuringiensis by PCR. The results indicated that IS231 elements appeared in 20 standard strains and 107 of 111 China isolates. Three novel IS231, IS231J, IS231O and IS231Q, five variants and a mobile insertion cassette MICBth4 were cloned from eight standard strains of B. thuringiensis, respectively. Interestingly, BLAST analysis revealed that the 5' end of novel IS231J shared 99% identity in 495-bp with a DNA segment adjacent to the 3' end of B. thuringiensis vip1Ac gene (GenBank Accession No.). Two phylogenetic trees of IS231 elements were constructed and analyzed by neighbor-joining and UPGMA methods from PHYLIP 3.6b program, respectively.
|
84. |
Shi Y,
Xu W,
Yuan M,
Tang M,
Chen J,
Pang Y,
( 2004 ) Expression of vip1/vip2 genes in Escherichia coli and Bacillus thuringiensis and the analysis of their signal peptides. PMID : 15357725 : DOI : 10.1111/j.1365-2672.2004.02365.x Abstract >>
To determine the expression time courses and high expression level of Vip2A(c) and Vip1A(c) in Bacillus thuringiensis, and survey their insecticidal toxicity and insecticidal spectrum. A kind of new vegetative insecticidal toxin genes encoded by a single operon from B. thuringiensis had been cloned and sequenced. The individual genes, 5-terminus truncated genes and the operon were respectively expressed in Escherichia coli. Only N-terminus deleted Vip2A(c) and Vip1A(c) proteins could be purified by Ni-NTA agarose, while others were processed and their N-terminal signal peptides were cleaved. The individual genes and the operon were also expressed in B. thuringiensis. Both proteins were mostly secreted into the cell supernatants. The expression level of Vip1A(c) was influenced because of the interruption of vip2A(c) gene on the operon. Bioassays showed that neither separate protein nor both performed any toxicity against tested lepidopteran and coleopteran insects. Vip2A(c) and Vip1A(c) have similar secretion mechanism in E. coli and B. thuringiensis. Vip1A(c) remained its high expression level only when being expressed with vip2A(c) gene as an operon in B. thuringiensis. Expression of vip2A(c) and vip1A(c) genes in E. coli and B. thuringiensis were investigated. This would help to make clear the secretion mechanism of VIP proteins and study the function of ADP-ribosyltransferase Vip2.
|
85. |
Ko KS,
Kim JW,
Kim JM,
Kim W,
Chung SI,
Kim IJ,
Kook YH,
( 2004 ) Population structure of the Bacillus cereus group as determined by sequence analysis of six housekeeping genes and the plcR Gene. PMID : 15322020 : DOI : 10.1128/IAI.72.9.5253-5261.2004 PMC : PMC517475 Abstract >>
The population structure of the Bacillus cereus group (52 strains of B. anthracis, B. cereus, and B. thuringiensis) was investigated by sequencing seven gene fragments (rpoB, gyrB, pycA, mdh, mbl, mutS, and plcR). Most of the strains were classifiable into two large subgroups in six housekeeping gene trees but not in the plcR tree. In addition, several consistent clusters were identified, which were unrelated to species distinction. Moreover, interrelationships among these clusters were incongruent in each gene tree. The incongruence length difference test and split decomposition analyses also showed incongruences between genes, suggesting horizontal gene transfer. The plcR gene was observed to have characteristics that differed from those of the other genes in terms of phylogenetic topology and pattern of sequence diversity. Thus, we suggest that the evolutionary history of the PlcR regulon differs from those of the other chromosomal genes and that recombination of the plcR gene may be frequent. The homogeneity of B. anthracis, which is depicted as an independent lineage in phylogenetic trees, is suggested to be of recent origin or to be due to the narrow taxonomic definition of species.
|
86. |
Slamti L,
Perchat S,
Gominet M,
Vilas-Bôas G,
Fouet A,
Mock M,
Sanchis V,
Chaufaux J,
Gohar M,
Lereclus D,
( 2004 ) Distinct mutations in PlcR explain why some strains of the Bacillus cereus group are nonhemolytic. PMID : 15150241 : DOI : 10.1128/JB.186.11.3531-3538.2004 PMC : PMC415780 Abstract >>
Bacillus thuringiensis, Bacillus cereus, and Bacillus anthracis are closely related species belonging to the Bacillus cereus group. B. thuringiensis and B. cereus generally produce extracellular proteins, including phospholipases and hemolysins. Transcription of the genes encoding these factors is controlled by the pleiotropic regulator PlcR. Disruption of plcR in B. cereus and B. thuringiensis drastically reduces the hemolytic, lecithinase, and cytotoxic properties of these organisms. B. anthracis does not produce these proteins due to a nonsense mutation in the plcR gene. We screened 400 B. thuringiensis and B. cereus strains for their hemolytic and lecithinase properties. Eight Hly- Lec- strains were selected and analyzed to determine whether this unusual phenotype was due to a mutation similar to that found in B. anthracis. Sequence analysis of the DNA region including the plcR and papR genes of these strains and genetic complementation of the strains with functional copies of plcR and papR indicated that different types of mutations were responsible for these phenotypes. We also found that the plcR genes of three B. anthracis strains belonging to different phylogenetic groups contained the same nonsense mutation, suggesting that this mutation is a distinctive trait of this species.
|
87. |
Baum JA,
Chu CR,
Rupar M,
Brown GR,
Donovan WP,
Huesing JE,
Ilagan O,
Malvar TM,
Pleau M,
Walters M,
Vaughn T,
( 2004 ) Binary toxins from Bacillus thuringiensis active against the western corn rootworm, Diabrotica virgifera virgifera LeConte. PMID : 15294828 : DOI : 10.1128/AEM.70.8.4889-4898.2004 PMC : PMC492402 Abstract >>
The western corn rootworm, Diabrotica virgifera virgifera LeConte, is a significant pest of corn in the United States. The development of transgenic corn hybrids resistant to rootworm feeding damage depends on the identification of genes encoding insecticidal proteins toxic to rootworm larvae. In this study, a bioassay screen was used to identify several isolates of the bacterium Bacillus thuringiensis active against rootworm. These bacterial isolates each produce distinct crystal proteins with approximate molecular masses of 13 to 15 kDa and 44 kDa. Insect bioassays demonstrated that both protein classes are required for insecticidal activity against this rootworm species. The genes encoding these proteins are organized in apparent operons and are associated with other genes encoding crystal proteins of unknown function. The antirootworm proteins produced by B. thuringiensis strains EG5899 and EG9444 closely resemble previously described crystal proteins of the Cry34A and Cry35A classes. The antirootworm proteins produced by strain EG4851, designated Cry34Ba1 and Cry35Ba1, represent a new binary toxin. Genes encoding these proteins could become an important component of a sustainable resistance management strategy against this insect pest.
|
88. |
Fedhila S,
Guillemet E,
Nel P,
Lereclus D,
( 2004 ) Characterization of two Bacillus thuringiensis genes identified by in vivo screening of virulence factors. PMID : 15294815 : DOI : 10.1128/AEM.70.8.4784-4791.2004 PMC : PMC492376 Abstract >>
Bacillus thuringiensis vegetative cells are known to be highly pathogenic when injected into the hemocoel of susceptible insect larvae. This pathogenicity is due to the capacity of B. thuringiensis to cause septicemia in the host. We screened a B. thuringiensis mini-Tn10 insertion library for loss of virulence against Bombyx mori larvae on injection into the hemocoel. Three clones with attenuated virulence were isolated, corresponding to two different mini-Tn10 insertions mapping to the yqgB/yqfZ locus. Single disruptions of the yqgB and yqfZ genes did not affect virulence against B. mori. In contrast, the inactivation of both genes simultaneously reproduced the effect of the mini-Tn10 insertion and resulted in a significant delay to infection. The double DeltayqgB DeltayqfZ mutant was also nonmotile, and its growth was affected at 25 degrees C. We analyzed lacZ transcriptional fusions and detected promoter activity upstream from yqgB at 25 and 37 degrees C. Overall, our findings suggest that the yqgB and yqfZ genes encode adaptive factors that may act in synergy, enabling the bacteria to cope with the physical environment in vivo, facilitating colonization of the host.
|
89. |
Lambert B,
Höfte H,
Annys K,
Jansens S,
Soetaert P,
Peferoen M,
( 1992 ) Novel Bacillus thuringiensis insecticidal crystal protein with a silent activity against coleopteran larvae. PMID : 1514800 : PMC : PMC195818 Abstract >>
A novel Bacillus thuringiensis crystal protein with a silent activity against the Colorado potato beetle is described. The crystal proteins are produced as bipyramidal crystals. These crystals contain a protein of 129 kDa with a trypsin-resistant core fragment of 72 kDa. Neither a spore-crystal mixture nor in vitro-solubilized crystals are toxic to any of several Lepidoptera and Coleoptera species tested. In contrast, a trypsin-treated solution containing the 72-kDa tryptic core fragment of the protoxin is highly toxic to Colorado potato beetle larvae. The crystal protein-encoding gene was cloned and sequenced. The inferred amino acid sequence of the putative toxic fragment has 37, 32, and 33% homology to the CryIIIA, CryIIIB, and CryIIID toxins, respectively. Interestingly, the 501 C-terminal amino acids show 41 to 48% amino acid identity with corresponding C-terminal amino acid sequences of other crystal proteins. Because of the toxicity of the fragment to the Colorado potato beetle and because of the distinct similarities of the toxic fragment with the other CryIII proteins, this gene was given a new subclass name (cryIIIC) within the CryIII class of coleopteran-active crystal proteins. CryIIIC represents the first example of a crystal protein with a silent activity towards coleopteran insect larvae. Natural CryIIIC crystals are not toxic. Toxicity is revealed only after an in vitro solubilization and activation step.
|
90. |
Stobdan T,
Kaur S,
Singh A,
( 2004 ) Cloning and nucleotide sequence of a novel cry gene from Bacillus thuringiensis. PMID : 15266122 : DOI : 10.1023/B:BILE.0000035488.85309.df Abstract >>
A cry1Ab-type gene was cloned from a new isolate of Bacillus thuringiensis by PCR. When restriction pattern was compared with that of known genes it was found to have additional restriction site for ClaI. Nucleotide sequencing and homology search revealed that the toxin shared 95% homology with the known Cry1Ab proteins as compared to more than 98% homology among the other reported Cry1Ab toxins. The gene encoded a sequence of 1,177 amino acids compared to 1,155 amino acids encoded by all the other 16 cry1Ab genes reported so far. An additional stretch of 22 amino acids after the amino acid G793 in the new toxin sequence showed 100% homology with several other cry genes within cry1 family. Homology search indicated that the new cry1Ab-type gene might have resulted by nucleotide rearrangement between cry1Ab and cry1Aa/cry1Ac genes.
|
91. |
De Palmenaer D,
Vermeiren C,
Mahillon J,
( 2004 ) IS231-MIC231 elements from Bacillus cereus sensu lato are modular. PMID : 15228527 : DOI : 10.1111/j.1365-2958.2004.04146.x Abstract >>
Summary IS231A was originally discovered in Bacillus thuringiensis as a typical 1.6 kb insertion sequence (IS) displaying 20 bp inverted repeats (IR) flanking a transposase gene. A first major variation of this canonical organization was found in MIC231A1. This mobile insertion cassette (MIC), delineated by IS231A-related extremities, contained an active d-stereospecific endopeptidase (adp) gene instead of a transposase. Interestingly, it was shown that MIC231A1 can be mobilized in trans by the IS231A transposase. In this paper, we show that this family of IS231-MIC231 elements can be extended to a broad range of related entities displaying higher levels of structural complexity. Several IS231A-like elements contained, upstream of their transposase gene, passenger genes coding for putative antibiotic resistances or regulatory factors. Furthermore, the diversity of the MIC231 elements ranged from empty cassettes to structures carrying up to three passenger genes. Among these, MIC231V carried, in addition to an adp gene, an active fosfomycin resistance determinant. In vivo transposition assays showed that MIC231V is also trans-activated by the IS231A transposase. These results lend further support to the potential contribution of these modular mobile elements to the genome plasticity of the Bacillus cereus/B. thuringiensis group.
|
92. |
Franco-Rivera A,
Benintende G,
Cozzi J,
Baizabal-Aguirre VM,
Valdez-Alarcón JJ,
López-Meza JE,
( 2004 ) Molecular characterization of Bacillus thuringiensis strains from Argentina. PMID : 15103240 : DOI : 10.1023/B:ANTO.0000024913.94410.05 Abstract >>
Bacillus thuringiensis INTA 7-3, INTA 51-3, INTA Mo9-5 and INTA Mo14-4 strains were obtained from Argentina and characterized by determination of serotype, toxicity, plasmid composition, insecticidal gene content (cry and vip) and the cloning of the single- vip3A gene of the INTA Mo9-5 strain. The serotype analysis identified the serovars tohokuensis and darmstadiensis for the INTA 51-3 and INTA Mo14-4 strains, respectively, whereas the INTA Mo9-5 strain was classified as "autoagglutinated". In contrast to the plasmid patterns of INTA 7-3, INTA 51-3 and INTA Mo9-5 (which were similar to B. thuringiensis HD-1 strain), strain INTA Mo14-4 showed a unique plasmid array. PCR analysis of the four strains revealed the presence of cry genes and vip3A genes. Interestingly, it was found that B. thuringiensis 4Q7 strain, which is a plasmid cured strain, contained vip3A genes indicating the presence of these insecticidal genes in the chromosome. Bioassays towards various lepidopteran species revealed that B. thuringiensis INTA Mo9-5 and INTA 7-3 strains were highly active. In particular, the mean LC(50) obtained against A. gemmatalis larvae with the INTA Mo9-5 and INTA 7-3 strains were 7 (5.7-8.6) and 6.7 (5.6-8.0) ppm, respectively. The INTA Mo14-4 strain was non-toxic and strain INTA 51-3 showed only a weak larvicidal activity.
|
93. |
Donovan WP,
Rupar MJ,
Slaney AC,
Malvar T,
Gawron-Burke MC,
Johnson TB,
( 1992 ) Characterization of two genes encoding Bacillus thuringiensis insecticidal crystal proteins toxic to Coleoptera species. PMID : 1476436 : PMC : PMC183205 Abstract >>
Bacillus thuringiensis EG2838 and EG4961 are highly toxic to Colorado potato beetle larvae, and only strain EG4961 is toxic to southern corn rootworm larvae. To investigate the cause of the different insecticidal activities of EG2838 and EG4961, cryIII-type genes toxic to coleopterans were cloned from each strain. The cryIIIB gene, cloned as part of an 8.0-kb EcoRI fragment of EG2838 DNA, encoded a crystal protein (CryIIIB) of 74,237 Da. The cryIIIB2 gene, cloned as part of an 8.3-kb PstI-Asp718 fragment of EG4961 DNA, encoded a crystal protein (CryIIIB2) of 74,393 Da that was 94% identical to CryIIIB. Analysis of the transcriptional start sites showed that cryIIIB and cryIIIB2 were initiated from a conserved region located within 130 nucleotides upstream from the translation start sites of both genes. Although the CryIIIB and CryIIIB2 proteins were similar in sequence, they displayed distinct insecticidal activities: CryIIIB was one-third as toxic as CryIIIB2 to Colorado potato beetle larvae, and CryIIIB2, but not CryIIIB, was toxic to southern corn rootworm larvae. Genes encoding crystal proteins of approximately 32 and 31 kDa were located adjacent to the cryIIIB and cryIIIB2 genes, respectively. The 32- and 31-kDa crystal proteins failed to enhance the insecticidal activities of CryIIIB and CryIIIB2.
|
94. |
Dement'ev AA,
Riabchenko NF,
Protasevich II,
Golyshin PN,
Stepanov AI,
Orlov VM,
Pustovaev VN,
Makarov AA,
Moiseev GP,
Karpeĭskiĭ MIa,
( N/A ) [Extracellular alkaline ribonuclease of Bacillus thuringiensis var. subtoxicus]. PMID : 1491677 : Abstract >>
Intraspecific selection of Bacillus thuringiensis strains producing extracellular alkaline ribonucleases was carried out. Subtoxicus subspecies with increased expression of the enzyme was detected. A method was developed to isolate preparative amounts of homogeneous extracellular RNase of B. thuringiensis var. subtoxicus. The physico-chemical and catalytic properties of the enzyme was studied and compared with extracellular RNases of others Bacillus species. The conclusion about the structural and evolutional conservation of Bacillus extracellular RNases was drawn.
|
95. |
Helgason E,
Tourasse NJ,
Meisal R,
Caugant DA,
Kolstø AB,
( 2004 ) Multilocus sequence typing scheme for bacteria of the Bacillus cereus group. PMID : 14711642 : DOI : 10.1128/aem.70.1.191-201.2004 PMC : PMC321270 Abstract >>
In this study we developed a multilocus sequence typing (MLST) scheme for bacteria of the Bacillus cereus group. This group, which includes the species B. cereus, B. thuringiensis, B. weihenstephanensis, and B. anthracis, is known to be genetically very diverse. It is also very important because it comprises pathogenic organisms as well as bacteria with industrial applications. The MLST system was established by using 77 strains having various origins, including humans, animals, food, and soil. A total of 67 of these strains had been analyzed previously by multilocus enzyme electrophoresis, and they were selected to represent the genetic diversity of this group of bacteria. Primers were designed for conserved regions of housekeeping genes, and 330- to 504-bp internal fragments of seven such genes, adk, ccpA, ftsA, glpT, pyrE, recF, and sucC, were sequenced for all strains. The number of alleles at individual loci ranged from 25 to 40, and a total of 53 allelic profiles or sequence types (STs) were distinguished. Analysis of the sequence data showed that the population structure of the B. cereus group is weakly clonal. In particular, all five B. anthracis isolates analyzed had the same ST. The MLST scheme which we developed has a high level of resolution and should be an excellent tool for studying the population structure and epidemiology of the B. cereus group.
|
96. |
Gueneau de Novoa P,
Williams KP,
( 2004 ) The tmRNA website: reductive evolution of tmRNA in plastids and other endosymbionts. PMID : 14681369 : DOI : 10.1093/nar/gkh102 PMC : PMC308836 Abstract >>
tmRNA combines tRNA- and mRNA-like properties and ameliorates problems arising from stalled ribosomes. Research on the mechanism, structure and biology of tmRNA is served by the tmRNA website (http://www.indiana.edu/~ tmrna), a collection of sequences, alignments, secondary structures and other information. Because many of these sequences are not in GenBank, a BLAST server has been added; another new feature is an abbreviated alignment for the tRNA-like domain only. Many tmRNA sequences from plastids have been added, five found in public sequence data and another 10 generated by direct sequencing; detection in early-branching members of the green plastid lineage brings coverage to all three primary plastid lineages. The new sequences include the shortest known tmRNA sequence. While bacterial tmRNAs usually have a lone pseudoknot upstream of the mRNA segment and a string of three or four pseudoknots downstream, plastid tmRNAs collectively show loss of pseudoknots at both postions. The pseudoknot-string region is also too short to contain the usual pseudoknot number in another new entry, the tmRNA sequence from a bacterial endosymbiont of insect cells, Tremblaya princeps. Pseudoknots may optimize tmRNA function in free-living bacteria, yet become dispensible when the endosymbiotic lifestyle relaxes selective pressure for fast growth.
|
97. |
Kao SS,
Hsieh FC,
Tzeng CC,
Tsai YS,
( 2003 ) Cloning and expression of the insecticidal crystal protein gene Cry1Ca9 of Bacillus thuringiensis G10-01A from Taiwan granaries. PMID : 14629010 : Abstract >>
A new cry gene (cry1Ca9) was cloned and sequenced from a Bacillus thuringiensis isolate native to Taiwan (G10-01A). The cry1C-type gene, designated cry1Ca9, consisted of an open reading frame of 3,567 bp, encoding a protein of 1,189 amino acid residues. The polypeptide has the deduced amino acid sequences predicting molecular masses of 134.7 kDa. The gene sequence was compared against the GenBank nucleotide sequence data base. It was found that the cry1Ca9 gene coded for a 134.7-kDa protoxin which had greater than 99.8% homology with the previously reported cry1Ca1 gene, as only three mismatches were found between the two amino acid sequences. When the Cry1Ca9 toxin was expressed in a crystal-negative strain of B. thuringiensis (cryB-), elliptical crystals were produced. Cell extracts from this recombinant strain appear to have high insecticidal activity against lepidopteran larvae (Plutella xylostella).
|
98. |
Mahadeva Swamy HM,
Asokan R,
Nagesha SN,
Arora DK,
Birah A,
Mahmood R,
( 2011 ) Cloning, characterization and diversity of insecticidal crystal protein genes of bacillus thuringiensis native isolates from soils of Andaman and Nicobar Islands. PMID : 21858696 : DOI : 10.1007/s00284-011-9998-x Abstract >>
Bt strains were isolated from soils of Andaman and Nicobar Islands and characterized by microscopic and molecular methods. Diversity was observed both in protein and cry gene profiles, where majority of the isolates showed presence of 65 kDa protein band on SDS-PAGE while rest of them showed 130, 72, 44, and 29 kDa bands. PCR analysis revealed predominance of cry1I and cry7, 8 genes in these isolates. The PCR screening strategy presented here led us to identify putative novel cry genes which could be active against Coleoptera insects. Variation in the nucleotide sequences of cry genes from the isolates suggests that the genetic diversity of Bt isolates results from the influence of different ecological factors and spatial separation between strains generated by the conquest of different habitats in the soils of Andaman and Nicobar islands. The implications of our studies are important from the point of view of identifying novel cry genes that could be toxic to insects other than lepidoptera.
|
99. |
Hibi M,
Kawashima T,
Kodera T,
Smirnov SV,
Sokolov PM,
Sugiyama M,
Shimizu S,
Yokozeki K,
Ogawa J,
( 2011 ) Characterization of Bacillus thuringiensis L-isoleucine dioxygenase for production of useful amino acids. PMID : 21821743 : DOI : 10.1128/AEM.05035-11 PMC : PMC3187082 Abstract >>
We determined the enzymatic characteristics of an industrially important biocatalyst, �\-ketoglutarate-dependent l-isoleucine dioxygenase (IDO), which was found to be the enzyme responsible for the generation of (2S,3R,4S)-4-hydroxyisoleucine in Bacillus thuringiensis 2e2. Depending on the amino acid used as the substrate, IDO catalyzed three different types of oxidation reactions: hydroxylation, dehydrogenation, and sulfoxidation. IDO stereoselectively hydroxylated several hydrophobic aliphatic l-amino acids, as well as l-isoleucine, and produced (S)-3-hydroxy-l-allo-isoleucine, 4-hydroxy-l-leucine, (S)-4-hydroxy-l-norvaline, 4-hydroxy-l-norleucine, and 5-hydroxy-l-norleucine. The IDO reaction product of l-isoleucine, (2S,3R,4S)-4-hydroxyisoleucine, was again reacted with IDO and dehydrogenated into (2S,3R)-2-amino-3-methyl-4-ketopentanoate, which is also a metabolite found in B. thuringiensis 2e2. Interestingly, IDO catalyzed the sulfoxidation of some sulfur-containing l-amino acids and generated l-methionine sulfoxide and l-ethionine sulfoxide. Consequently, the effective production of various modified amino acids would be possible using IDO as the biocatalyst.
|
100. |
Oliveira GR,
Silva MC,
Lucena WA,
Nakasu EY,
Firmino AA,
Beneventi MA,
Souza DS,
Gomes JE,
de Souza JD,
Rigden DJ,
Ramos HB,
Soccol CR,
Grossi-de-Sa MF,
( 2011 ) Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis). PMID : 21906288 : DOI : 10.1186/1472-6750-11-85 PMC : PMC3179717 Abstract >>
The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.
|
101. |
Prabhakar A,
Bishop AH,
( 2011 ) Invertebrate pathogenicity and toxin-producing potential of strains of Bacillus thuringiensis endemic to Antarctica. PMID : 21457716 : DOI : 10.1016/j.jip.2011.03.008 Abstract >>
Several strains of Bacillus thuringiensis were previously isolated from soil in Antarctica and appeared to have physiological adaptations to this cold, nutrient-poor environment. In spite of this they could produce abnormally large, parasporal crystals under laboratory conditions. Here, they have been further characterised for toxin genes and invertebrate pathogenicity. All of the strains were positive in PCR assays for the cry1Aa and cry2 genes. This was confirmed by sequence analysis and the parasporal crystals of all strains contained polypeptides of about 130kDa. This potential for lepidopteran toxicity was borne out in bioassays of purified �_-endotoxins against larvae of Pieris brassicae: the LD(50) values of B2408 (288�gg) were comparable to that of the reference strain, HD-12 (201�gg). There was no activity against the nematode Caenorhabditis elegans in spite of the fact that all strains appeared to possess the cry6 gene. PCR screening for genes encoding other nematode-toxic classes of toxins (Cry5, 4 and 21) was negative. B. thuringiensis has never previously been shown to be toxic to Collembola (springtails) but the purified �_-endotoxins of one of the Antarctic strains showed some activity against Folsomia candida and Seira domestica (224�gg and 238�gg, respectively). It seems unlikely that the level of toxicity demonstrated against springtails would support a pathogenic life-style in nature. All of the strains were positive for genes encoding Bacillus cereus-type enterotoxins. In the absence of higher insects and mammals the ecological value of retaining the toxic capability demonstrated here is uncertain.
|
102. |
Wu Y,
Lei CF,
Yi D,
Liu PM,
Gao MY,
( 2011 ) Novel Bacillus thuringiensis �_-endotoxin active against Locusta migratoria manilensis. PMID : 21441319 : DOI : 10.1128/AEM.02462-10 PMC : PMC3126473 Abstract >>
A novel �_-endotoxin gene was cloned from a Bacillus thuringiensis strain with activity against Locusta migratoria manilensis by PCR-based genome walking. The sequence of the cry gene was 3,432 bp long, and it encoded a Cry protein of 1,144 amino acid residues with a molecular mass of 129,196.5 kDa, which exhibited 62% homology with Cry7Ba1 in the amino acid sequence. The �_-endotoxin with five conserved sequence blocks in the amino-terminal region was designated Cry7Ca1 (GenBank accession no. EF486523). Protein structure analysis suggested that the activated toxin of Cry7Ca1 has three domains: 227 residues forming 7 �\-helices (domain I); 213 residues forming three antiparallel �]-sheets (domain II); and 134 residues forming a �]-sandwich (domain III). The three domains, respectively, exhibited 47, 44, and 34% sequence identity with corresponding domains of known Cry toxins. SDS-PAGE and Western blot analysis showed that Cry7Ca1, encoded by the full-length open reading frame of the cry gene, the activated toxin 1, which included three domains but without the N-terminal 54 amino acid residues and the C terminus, and the activated toxin 2, which included three domains and N-terminal 54 amino acid residues but without the C terminus, could be expressed in Escherichia coli. Bioassay results indicated that the expressed proteins of Cry7Ca1 and the activated toxins (toxins 1 and 2) showed significant activity against 2nd instar locusts, and after 7 days of infection, the estimated 50% lethal concentrations (LC??s) were 8.98 �gg/ml for the expressed Cry7Ca1, 0.87 �gg/ml for the activated toxin 1, and 4.43 �gg/ml for the activated toxin 2. The �_-endotoxin also induced histopathological changes in midgut epithelial cells of adult L. migratoria manilensis.
|
103. |
Sit CS,
van Belkum MJ,
McKay RT,
Worobo RW,
Vederas JC,
( 2011 ) The 3D solution structure of thurincin H, a bacteriocin with four sulfur to �\-carbon crosslinks. PMID : 21786372 : DOI : 10.1002/anie.201102527 Abstract >>
N/A
|
104. |
Gonzalez E,
Granados JC,
Short JD,
Ammons DR,
Rampersad J,
( 2011 ) Parasporins from a Caribbean Island: evidence for a globally dispersed Bacillus thuringiensis strain. PMID : 21380719 : DOI : 10.1007/s00284-011-9905-5 Abstract >>
Parasporins represent a new functional class of Cry (crystal protein) toxins produced by the bacterium Bacillus thuringiensis (Bt). Unlike Cry toxins that demonstrate activity mainly against some insect cells, parasporins are characterized as being non-hemolytic, yet capable of preferentially killing some human cancer cells. Globally, six different parasporin types, PS1-PS6, based on protein sequence homology, have been identified in only four countries (Japan, Vietnam, India, and Canada). Herein we report the results of a screening study of 160 Bt isolates collected from the Caribbean island of Trinidad. One isolate (strain 64-1-94) was shown to kill human cancer cells and to contain one ps6 and two ps1 parasporin genes. The two ps1 genes were located approximately 6 kb apart from each other, sharing a similar spatial arrangement, and high sequence homology, with two plasmid-located ps1 genes, ps1Aa6 and ps1Ad1, recently isolated from a Japanese strain. Evidence is also presented that a parasporin gene reported previously for a Canadian strain, ps1Aa2, is most likely derived from a recombination event between these same two genes found in the Trinidadian and Japanese strains. Notably, all three strains share a ps6 parasporin gene, presumably located on a separate plasmid. These data suggest that the global population of ps1 genes may be have originated from a single pair of parasporin genes. Given the large geographical distance between the collection sites, which are located on both continental land masses and islands at sea, ps1 genes are able to retain a remarkable level of homology not easily explained.
|
105. |
Melnikov O,
Baranes N,
Einav M,
Ben-Dov E,
Manasherob R,
Itsko M,
Zaritsky A,
( 2011 ) Tandem repeats in a new toxin gene from Bacillus thuringiensis and in other cry11-like genes. PMID : 21778765 : DOI : 10.1159/000329824 Abstract >>
A new gene, cry11Bb2 from a field isolate of Bacillus thuringiensis, was cloned for expression in Escherichia coli. The encoded protein, with a deduced molecular mass of 89.5 kDa, exhibits 97 and 79% identities with the overlap regions of Cry11Bb1 from B. thuringiensis ssp. medellin and Cry11Ba1 from ssp. jegathesan, respectively. It is however longer than Cry11Bb1 by 42 amino acids in its carboxy-terminus, of which 32 comprise 2 tandem repeats additional to the 5 existing in the latter polypeptide. Possible roles for this recurrent motif among Cry toxins and their accessory proteins, and for their encoding genes are proposed.
|
106. |
Janse I,
Hamidjaja RA,
Bok JM,
van Rotterdam BJ,
( 2010 ) Reliable detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis by using multiplex qPCR including internal controls for nucleic acid extraction and amplification. PMID : 21143837 : DOI : 10.1186/1471-2180-10-314 PMC : PMC3016324 Abstract >>
Several pathogens could seriously affect public health if not recognized timely. To reduce the impact of such highly pathogenic micro-organisms, rapid and accurate diagnostic tools are needed for their detection in various samples, including environmental samples. Multiplex real-time PCRs were designed for rapid and reliable detection of three major pathogens that have the potential to cause high morbidity and mortality in humans: B. anthracis, F. tularensis and Y. pestis. The developed assays detect three pathogen-specific targets, including at least one chromosomal target, and one target from B. thuringiensis which is used as an internal control for nucleic acid extraction from refractory spores as well as successful DNA amplification. Validation of the PCRs showed a high analytical sensitivity, specificity and coverage of diverse pathogen strains. The multiplex qPCR assays that were developed allow the rapid detection of 3 pathogen-specific targets simultaneously, without compromising sensitivity. The application of B. thuringiensis spores as internal controls further reduces false negative results. This ensures highly reliable detection, while template consumption and laboratory effort are kept at a minimum.
|
107. |
Yu X,
Zheng A,
Zhu J,
Wang S,
Wang L,
Deng Q,
Li S,
Liu H,
Li P,
( 2011 ) Characterization of vegetative insecticidal protein vip genes of Bacillus thuringiensis from Sichuan Basin in China. PMID : 20963416 : DOI : 10.1007/s00284-010-9782-3 Abstract >>
Vegetative insecticidal proteins (Vip), the second generation of insecticides, are produced during the vegetative growth stage of Bacillus thuringiensis (Bt). To perform a systematic study of vip genes in Bt strains from different ecological regions of Sichuan Basin, 1,789 soil samples were collected from this basin, which is situated in the western region of China. The basin has a complicated geomorphology and contains mountains, forests, highlands, hursts, and plains. A total of 2,134 Bt strains have been screened from the 1,789 soil samples. According to the results, three vip-type genes were found in this basin, namely the vip1, vip2, and vip3-type genes. Strains containing vip3-type genes were the most abundant in our collection (67.4%), followed by vip2-type genes (14.6%) and vip1-type genes (8.1%). The three types of vip genes were distributed in most of the regions, but E Mei Mountain and the Ba Lang Mountains only contained vip3 genes in environments with high elevation, low temperature, insufficient oxygen, and abundant snow. Moreover, five novel vip3 genes were found, and these Vip proteins were toxic for Chilo suppressalis. All the results mentioned above suggest that Sichuan Basin is a rich resource for vip genes.
|
108. |
Chambers JA,
Jelen A,
Gilbert MP,
Jany CS,
Johnson TB,
Gawron-Burke C,
( 1991 ) Isolation and characterization of a novel insecticidal crystal protein gene from Bacillus thuringiensis subsp. aizawai. PMID : 2061280 : DOI : 10.1128/jb.173.13.3966-3976.1991 PMC : PMC208042 Abstract >>
Bacillus thuringiensis subsp. aizawai EG6346, a novel grain dust isolate, was analyzed by Southern blot hybridization for its insecticidal crystal protein (ICP) gene profile. Strain EG6346 lacks previously characterized cryIA ICP genes yet does possess novel cryI-related gene sequences. A recombinant genomic plasmid library was constructed for strain EG6346 in Escherichia coli. One recombinant plasmid, pEG640, isolated from the library contained a novel ICP gene on a 5.7-kb Sau3A insert. The sequence of this gene, designated cryIF, was related to, but distinct from, the published sequences for other cryI genes. A second novel cryI-related sequence was also located on pEG640, approximately 500 bp downstream from cryIF. Introduction of cryIF into a Cry- B. thuringiensis recipient strain via electroporation enabled sufficient production of CryIF protein for quantitative bioassay analyses of insecticidal specificity. The CryIF crystal protein was selectively toxic to a subset of lepidopteran insects tested, including the larvae of Ostrinia nubilalis and Spodoptera exigua.
|
109. |
Darsi S,
Divya Prakash G,
Udayasuriyan V,
( 2010 ) Cloning and characterization of truncated cry1Ab gene from a new indigenous isolate of Bacillus thuringiensis. PMID : 20480206 : DOI : 10.1007/s10529-010-0301-1 Abstract >>
The insecticidal crystal protein(s) encoded by cry gene(s) of Bacillus thuringiensis (Bt) have been used for insect control both as biopesticides and in transgenic plants. A new 3'-truncated cry1Ab gene was cloned from an indigenous isolate of Bt, A19-31. Nucleotide sequencing and homology search revealed that the deduced amino acid sequence of Cry1Ab toxin of Bt strain A19-31 had a variation of two amino acid residues with the holotype sequence, Cry1Ab1. Expression of the 3'-truncated cry1Ab gene was studied in an acrystalliferous strain of Bt (4Q7). SDS-PAGE and immunostrip analysis of spore-crystal mixture revealed a low level expression of the 3'-truncated cry1Ab gene. Insecticidal activity assay showed that the recombinant 3'-truncated cry1Ab gene product was toxic to larvae of both Helicoverpa armigera and Spodoptera litura.
|
110. |
Rea MC,
Sit CS,
Clayton E,
O'Connor PM,
Whittal RM,
Zheng J,
Vederas JC,
Ross RP,
Hill C,
( 2010 ) Thuricin CD, a posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile. PMID : 20435915 : DOI : 10.1073/pnas.0913554107 PMC : PMC2889069 Abstract >>
The last decade has seen numerous outbreaks of Clostridium difficile-associated disease (CDAD), which presented significant challenges for healthcare facilities worldwide. We have identified and purified thuricin CD, a two-component antimicrobial that shows activity against C. difficile in the nanomolar range. Thuricin CD is produced by Bacillus thuringiensis DPC 6431, a bacterial strain isolated from a human fecal sample, and it consists of two distinct peptides, Trn-alpha and Trn-beta, that act synergistically to kill a wide range of clinical C. difficile isolates, including ribotypes commonly associated with CDAD (e.g., ribotype 027). However, this bacteriocin thuricin CD has little impact on most other genera, including many gastrointestinal commensals. Complete amino acid sequencing using infusion tandem mass spectrometry indicated that each peptide is posttranslationally modified at its respective 21st, 25th, and 28th residues. Solution NMR studies on [(13)C,(15)N] Trn-alpha and [(13)C,(15)N]Trn-beta were used to characterize these modifications. Analysis of multidimensional NOESY data shows that specific cysteines are linked to the alpha-carbons of the modified residues, forming three sulfur to alpha-carbon bridges. Complete sequencing of the thuricin CD gene cluster revealed genes capable of encoding two S'-adenosylmethionine proteins that are characteristically associated with unusual posttranslational modifications. Thuricin CD is a two-component antimicrobial peptide system with sulfur to alpha-carbon linkages, and it may have potential as a targeted therapy in the treatment of CDAD while also reducing collateral impact on the commensal flora.
|
111. |
Andrup L,
Bolander G,
Boe L,
Madsen SM,
Nielsen TT,
Wassermann K,
( 1991 ) Identification of a gene (mob14-3) encoding a mobilization protein from the Bacillus thuringiensis subsp. israelensis plasmid pTX14-3. PMID : 2041752 : DOI : 10.1093/nar/19.10.2780 PMC : PMC328203 Abstract >>
N/A
|
112. |
Von Tersch MA,
Robbins HL,
Jany CS,
Johnson TB,
( 1991 ) Insecticidal toxins from Bacillus thuringiensis subsp. kenyae: gene cloning and characterization and comparison with B. thuringiensis subsp. kurstaki CryIA(c) toxins. PMID : 2014985 : PMC : PMC182717 Abstract >>
Genes encoding insecticidal crystal proteins were cloned from three strains of Bacillus thuringiensis subsp. kenyae and two strains of B. thuringiensis subsp. kurstaki. Characterization of the B. thuringiensis subsp. kenyae toxin genes showed that they are most closely related to cryIA(c) from B. thuringiensis subsp. kurstaki. The cloned genes were introduced into Bacillus host strains, and the spectra of insecticidal activities of each Cry protein were determined for six pest lepidopteran insects. CryIA(c) proteins from B. thuringiensis subsp. kenyae are as active as CryIA(c) proteins from B. thuringiensis subsp. kurstaki against Trichoplusia ni, Lymantria dispar, Heliothis zea, and H. virescens but are significantly less active against Plutella xylostella and, in some cases, Ostrinia nubilalis. The sequence of a cryIA(c) gene from B. thuringiensis subsp. kenyae was determined (GenBank M35524) and compared with that of cryIA(c) from B. thuringiensis subsp. kurstaki. The two genes are more than 99% identical and show seven amino acid differences among the predicted sequences of 1,177 amino acids.
|
113. |
Noguera PA,
Ibarra JE,
( 2010 ) Detection of new cry genes of Bacillus thuringiensis by use of a novel PCR primer system. PMID : 20656876 : DOI : 10.1128/AEM.00797-10 PMC : PMC2937483 Abstract >>
On the basis of the known cry gene sequences of Bacillus thuringiensis, three sets of primers were designed from four conserved blocks found in the delta-endotoxin-coding region. The primer pairs designed amplify the regions between blocks 1 and 5, 2 and 5, and 1 and 4. In silico analyses indicated that 100% of the known three-domain cry gene sequences can be amplified by these sets of primers. To test their ability to amplify known and unknown cry gene sequences, 27 strains from the CINVESTAV (LBIT series) collection showing atypical crystal morphology were selected. Their DNA was used as the template with the new primer system, and after a systematic amplification and sequencing of the amplicons, each strain showed one or more cry-related sequences, totaling 54 different sequences harbored by the 27 strains. Seven sequences were selected on the basis of their low level of identity to the known cry sequences, and once cloning and sequencing of the complete open reading frames were done, three new cry-type genes (primary ranks) were identified and the toxins that they encode were designated Cry57Aa1, Cry58Aa1, and Cry59Aa1 by the B. thuringiensis Toxin Nomenclature Committee. The rest of the seven sequences were classified Cry8Ka2, Cry8-like, Cry20Ba1, and Cry1Ma1 by the committee. The crystal morphology of the selected strains and analysis of the new Cry protein sequences showed interesting peculiarities.
|
114. |
Smirnov SV,
Kodera T,
Samsonova NN,
Kotlyarova VA,
Rushkevich NY,
Kivero AD,
Sokolov PM,
Hibi M,
Ogawa J,
Shimizu S,
( 2010 ) Metabolic engineering of Escherichia coli to produce (2S, 3R, 4S)-4-hydroxyisoleucine. PMID : 20665018 : DOI : 10.1007/s00253-010-2772-3 Abstract >>
The stereo-specific L-isoleucine-4-hydroxylase (L-isoleucine dioxygenase (IDO)) was cloned and expressed in an Escherichia coli 2�G strain lacking the activities of �\-ketoglutarate dehydrogenase (EC 1.2.4.2), isocitrate liase (EC 4.1.3.1), and isocitrate dehydrogenase kinase/phosphatase (EC 2.7.11.5). The 2�G strain could not grow in a minimal-salt/glucose/glycerol medium due to the blockage of TCA during succinate synthesis. The IDO activity in the 2�G strain was able to "shunt" destroyed TCA, thereby coupling L-isoleucine hydroxylation and cell growth. Using this strain, we performed the direct biotransformation of L-isoleucine into 4-HIL with an 82% yield.
|
115. |
Nagamatsu Y,
Okamura S,
Saitou H,
Akao T,
Mizuki E,
( 2010 ) Three Cry toxins in two types from Bacillus thuringiensis strain M019 preferentially kill human hepatocyte cancer and uterus cervix cancer cells. PMID : 20208360 : DOI : 10.1271/bbb.90615 Abstract >>
Bacillus thuringiensis strain M019, non-pathogenic to lepidopteran and dipteran insects, produces a parasporal inclusion that consists of three 84-kDa Cry proteins (CPs). CP78A and CP78B, which exhibit 83.5% amino acid identity, were new variants of the previously reported HeLa cell-killing protein (parasporin-1). CP84 was a novel CP showing low-level homology, of 21.9% (56.4% similarity), with the insecticidal Cry2 toxin. In vitro solubilization with dithiothreitol at pH 10.2 and limited hydrolysis with trypsin resulted in the removal of N-terminal portions of the CPs and their activation. The 70-kDa proteins (15- and 55-kDa fragments) from CP78A and CP78B and the 73-kDa protein (14- and 59-kDa fragments) from CP84 exhibited varying degrees of cytocidal activity preferentially toward human hepatocyte cancer HepG2 cells and uterus cervix cancer HeLa cells causing cell swelling or the formation of vacuoles in the cytoplasm. These toxins appeared to attack an identical target on human cells.
|
116. |
Saadaoui I,
Miled N,
Jaoua S,
( 2010 ) Evidence of the involvement of E358, A498 and C571 of a new Cry1Ac delta-endotoxin of Bacillus thuringiensis in its high insecticidal activity against Ephestia kuehniella. PMID : 20084474 : DOI : 10.1007/s12033-010-9243-z Abstract >>
A new cry1Ac-type gene was cloned from Bacillus thuringiensis strain BLB1, sequenced and expressed. The deduced amino acid sequence of the polypeptide has a predicted molecular mass of 132.186 kDa. The amino acid sequence alignment of BLB1 Cry1Ac with those of the published ones showed that this is a new delta-endotoxin. When compared with Cry1Ac of Bacillus thuringiensis strain HD1, it was found that BLB1 Cry1Ac harbours three mutations: V358E localized in domain II and V498A and Y571C localized in domain III. When the BLB1 Cry1Ac toxin was expressed in an acrystalliferous strain of B. thuringiensis (HD1CryB), bipyramidal crystals were produced. The spore-crystal mixture of this recombinant strain was at least two-fold more active against larvae of the lepidopteran Ephestia kuehniella than that of the recombinant strain expressing Cry1Ac of HD1. The study of the structural effect of these mutations suggested that they may stabilize key regions involved in the binding of the domains II and III to insect receptors.
|
117. |
Martins ES,
Monnerat RG,
Queiroz PR,
Dumas VF,
Braz SV,
de Souza Aguiar RW,
Gomes AC,
Sánchez J,
Bravo A,
Ribeiro BM,
( 2010 ) Midgut GPI-anchored proteins with alkaline phosphatase activity from the cotton boll weevil (Anthonomus grandis) are putative receptors for the Cry1B protein of Bacillus thuringiensis. PMID : 20079436 : DOI : 10.1016/j.ibmb.2010.01.005 Abstract >>
Cry toxins from Bacillus thuringiensis (Bt) are used for insect control. They interact with specific receptors located on the host cell surface and are activated by host proteases following receptor binding resulting in midgut epithelial cells lysis. In this work we had cloned, sequenced and expressed a cry1Ba toxin gene from the B thuringiensis S601 strain which was previously shown to be toxic to Anthonomus grandis, a cotton pest. The Cry1Ba6 protein expressed in an acrystaliferous B. thuringiensis strain was toxic to A. grandis in bioassays. The binding of Cry1Ba6 toxin to proteins located in the midgut brush border membrane of A. grandis was analyzed and we found that Cry1Ba6 binds to two proteins (62 and 65kDa) that showed alkaline phosphatase (ALP) activity. This work is the first report that shows the localization of Cry toxin receptors in the midgut cells of A. grandis.
|
118. |
Zhu J,
Zheng A,
Wang S,
Liu H,
Li P,
( 2010 ) Characterization and expression of cry4Cb1 and cry30Ga1 from Bacillus thuringiensis strain HS18-1. PMID : 20034496 : DOI : 10.1016/j.jip.2009.12.004 Abstract >>
We characterized a novel Bacillus thuringiensis isolate native to China (HS18-1) that shows a spherical crystal harboring two major proteins of about 70 and 130kDa, and contains three novel cry genes (cry4Cb1, cry30Ga1, cry54-type). Furthermore, the cry4Cb1 and cry30Ga1 genes were expressed in Escherichia coli BL21 (DE3): pLysS. Insecticidal activity tests showed that the cry4Cb1 protein exhibited larvicidal activity against Aedes aegypti (Diptera) and the cry30Ga1 protein was toxic to both A. aegypti and P. xylostella (Lepidoptera).
|
119. |
Zheng A,
Zhu J,
Wang L,
Li S,
Deng Q,
Wang S,
Tan F,
Yu X,
Guan P,
Liang H,
Li P,
( 2010 ) Characterization and expression of a novel holotype insecticidal crystal protein gene from native Bacillus thuringiensis BM59-2. PMID : 20237577 : DOI : 10.1139/w09-120 Abstract >>
We characterized a novel holotype cry gene (cry52Ba1) harbored in a Bacillus thuringiensis isolate BM59-2 native to China that expresses a spherical crystal protein of about 80 kDa. In this study, the full length of the cry52Ba1 gene was cloned from this strain. Sequence analysis of the gene was also performed. Furthermore, cry52Ba1 was expressed in Escherichia coli BL21(DE)pLysS, and the resulting insecticidal activity showed that the Cry52Ba1 protein exhibited high larvicidal activity against Aedes aegypti (Diptera), with a lethal concentration 50 of 1.526 microg/mL (95% confidence: 0.740-3.499 microg/mL).
|
120. |
Guo S,
Ye S,
Liu Y,
Wei L,
Xue J,
Wu H,
Song F,
Zhang J,
Wu X,
Huang D,
Rao Z,
( 2009 ) Crystal structure of Bacillus thuringiensis Cry8Ea1: An insecticidal toxin toxic to underground pests, the larvae of Holotrichia parallela. PMID : 19591941 : DOI : 10.1016/j.jsb.2009.07.004 Abstract >>
Crystal (Cry) proteins belong to an insect toxin family encoded and expressed by a variety of Bacillus thuringiensis isolates, and are named due to their in vivo auto-crystallization abilities. To kill the infected host insects, protease-activated Cry toxins should firstly be recognized by certain membrane receptors on the surface of insect midgut epithelial cells and consequently assemble together as lethal transmembrane pores. Here we report the 2.2-A crystal structure of Cry8Ea1 toxin, a Cry family member specifically toxic to the underground larvae of Holotrichia parallela. Superimposition of the domain I from Cry8Ea1 and other structurally characterized Cry toxins reveals an identical surface proline residue and a highly conserved kink of a helix, both of which have drawn comparatively little attention from previous researchers. Further structural analysis and functional studies suggest that both the proline and the helix kink might be essential in exposing a helix-helix hairpin, which is believed to be the very first step in the well-known "umbrella" model of the membrane penetration. In summary, we propose a plausible model of the initiation of Cry toxin domain I disassembly before membrane penetration and pore formation.
|
121. |
Zhu J,
Zheng AP,
Tan FR,
Wang SQ,
Deng QM,
Li SC,
Wang LX,
Li P,
( 2010 ) Characterisation and expression of a novel holotype crystal protein gene, cry56Aa1, from Bacillus thuringiensis strain Ywc2-8. PMID : 19838632 : DOI : 10.1007/s10529-009-0147-6 Abstract >>
Bacillus thuringiensis isolate Ywc2-8, from soil in Sichuan Basin in western China, contains a spherical crystal harbouring two insecticidal crystal proteins with masses of 70 kDa and 130 kDa. A novel cry-type gene, encoding a 664 amino acid protein with 34% homology to cry29Aa1, was found and cloned from this strain. This gene belongs to a novel holotype cry and is designated as cry56Aa1. It was expressed in E. coli. Insecticidal activity assays showed that recombinant Cry56Aa1 was toxic to both Dipteran (Aedes aegypti) and Lepidopteran (Plutella xylostella and Helicoverpa armigera) pests. Cloning of this gene may help to overcome the increasing resistance of pests to currently used insecticides.
|
122. |
Kodera T,
Smirnov SV,
Samsonova NN,
Kozlov YI,
Koyama R,
Hibi M,
Ogawa J,
Yokozeki K,
Shimizu S,
( 2009 ) A novel l-isoleucine hydroxylating enzyme, l-isoleucine dioxygenase from Bacillus thuringiensis, produces (2S,3R,4S)-4-hydroxyisoleucine. PMID : 19850012 : DOI : 10.1016/j.bbrc.2009.09.126 Abstract >>
The unique function of 4-hydroxyisoleucine (4-HIL) is to stimulate glucose-induced insulin secretion in a glucose-dependent manner. 4-HIL is distributed only in certain kinds of plants and mushrooms, but the biosynthetic mechanism of 4-HIL has not been elucidated. Moreover, 4-HIL-producing microorganisms have not been reported. l-isoleucine (l-Ile) hydroxylating activity producing 4-HIL was detected in a cell lysate of Bacillus thuringiensis strain 2e2 AKU 0251 obtained from the mid-late exponential phase of growth. Properties of the purified hydroxylase demonstrated that it is a alpha-ketoglutaric acid (alpha-KG) dependent l-Ile dioxygenase (IDO) and requires alpha-KG, ferric ion, and ascorbic acid for its maximum activity. IDO showed high stereoselectivity in l-Ile hydroxylation producing only (2S,3R,4S)-4-HIL. The N-terminal 22 amino acids sequence revealed high homology to a hypothetical protein (GenBank ID: RBTH_06809) in B. thuringiensis serovar israelensis ATCC 35646. The histidine motif, which is conserved in alpha-KG dependent dioxygenases, is found in RBTH_06809.
|
123. |
Li MS,
Roh JY,
Tao X,
Yu ZN,
Liu ZD,
Liu Q,
Xu HG,
Shim HJ,
Kim YS,
Wang Y,
Choi JY,
Je YH,
( 2009 ) Cloning and molecular characterization of a novel rolling-circle replicating plasmid, pK1S-1, from Bacillus thuringiensis subsp. kurstaki K1. PMID : 19763421 : DOI : 10.1007/s12275-009-0020-2 Abstract >>
Bacillus thuringiensis, an entomopathogenic bacterium belonging to the B. cereus group, harbors numerous extra-chromosomal DNA molecules whose sizes range from 2 to 250 kb. In this study, we used a plasmid capture system (PCS) to clone three small plasmids from B. thuringiensis subsp. kurstaki Kl which were not found in B. thuringiensis subsp. kurstaki HD-1, and determined the complete nucleotide sequence of plasmid pKlS-1 (5.5 kb). Of the six putative open reading frames (ORF2-ORF7) in pKlS-1, ORF2 (MobKl) showed approximately 90% aa identity with the Mob-proteins of pGI2 and pTX14-2, which are rolling circle replicating group VII (RCR group VII) plasmids from B. thuringiensis. In addition, a putative origin of transfer (oriT) showed 95.8% identity with those of pGI2 and pTX14-2. ORF3 (RepK1) showed relatively low aa identity (17.8-25.2%) with the Rep protein coded by RCR plasmids, however. The putative double-strand origin of replication (dso) and single-strand origin of replication (sso) of pKlS-1 exhibited approximately 70% and 64% identities with those of pGI2 and pTX14-2. ORF6 and 7 showed greater than 50% similarities with alkaline serine protease, which belongs to the subtilase family. The other 2 ORFs were identified as hypothetical proteins. To determine the replicon of pKlS-1, seven subclones were contructed in the B. thuringiensis ori-negative pHTIK vector and were electroporated into a plasmid cured B. thuringiensis strain. The 1.6 kb region that included the putative ORF3 (ReplK), dso and ORF4, exhibited replication ability. These findings identified pKlS-1 as a new RCR group VII plasmid, and determined its replication region.
|
124. |
Shu C,
Yan G,
Wang R,
Zhang J,
Feng S,
Huang D,
Song F,
( 2009 ) Characterization of a novel cry8 gene specific to Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. PMID : 19399496 : DOI : 10.1007/s00253-009-1971-2 Abstract >>
A new polymerase chain reaction-restriction fragment length polymorphism method for the identification of cry8-type genes from Bacillus thuringiensis has been established by designing a pair of new universal primers. By this method, a novel gene, cry8Ga1, encoding a polypeptide of 1,157 amino acids with a deduced molecular mass of 131.2 kDa was identified and cloned from B. thuringiensis HBF-18. Recombinant B. thuringiensis strain HD8G, harboring cry8Ga1, has insecticidal activity against larvae of Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. This is the first report of a Cry toxin that has insecticidal activity to Melolonthidae pest H. oblita.
|
125. |
Amadio AF,
Benintende GB,
Zandomeni RO,
( 2009 ) Complete sequence of three plasmids from Bacillus thuringiensis INTA-FR7-4 environmental isolate and comparison with related plasmids from the Bacillus cereus group. PMID : 19654019 : DOI : 10.1016/j.plasmid.2009.07.005 Abstract >>
Bacillus thuringiensis is an insect pathogen used worldwide as a bioinsecticide. It belongs to the Bacillus cereus sensu lato group as well as Bacillus anthracis and B. cereus. Plasmids from this group of organisms have been implicated in pathogenicity as they carry the genes responsible for different types of diseases that affect mammals and insects. Some plasmids, like pAW63 and pBT9727, encode a functional conjugation machinery allowing them to be transferred to a recipient cell. They also share extensive homology with the non-functional conjugation apparatus of pXO2 from B. anthracis. In this study we report the complete sequence of three plasmids from an environmental B. thuringiensis isolate from Argentina, obtained by a shotgun sequencing method. We obtained the complete nucleotide sequence of plasmids pFR12 (12,095bp), pFR12.5 (12,459bp) and pFR55 (55,712bp) from B. thuringiensis INTA-FR7-4. pFR12 and pFR12.5 were classified as cryptic as they do not code for any obvious functions besides replication and mobilization. Both small plasmids were classified as RCR plasmids due to similarities with the replicases they encode. Plasmid pFR55 showed a structural organization similar to that observed for plasmids pAW63, pBT9727 and pXO2. pFR55 also shares a tra region with these plasmids, containing genes related to T4SS and conjugation. A comparison between pFR55 and conjugative plasmids led to the postulation that pFR55 is a conjugative plasmid. Genes related to replication functions in pFR55 are different to those described for plasmids with known complete sequences. pFR55 is the first completely sequenced plasmid with a replication machinery related to that of ori44. The analysis of the complete sequence of plasmids from an environmental isolate of B. thuringiensis permitted the identification of a near complete conjugation apparatus in pFR55, resembling those of plasmids pAW63, pBT9727 and pXO2. The availability of this sequence is a step forward in the study of the molecular basis of the conjugative process in Gram positive bacteria, particularly due to the similarity with known conjugation systems. It is also a contribution to the expansion of the non-pathogenic B. cereus plasmid gene pool.
|
126. |
Tan F,
Zhu J,
Tang J,
Tang X,
Wang S,
Zheng A,
Li P,
( 2009 ) Cloning and characterization of two novel crystal protein genes, cry54Aa1 and cry30Fa1, from Bacillus thuringiensis strain BtMC28. PMID : 19280260 : DOI : 10.1007/s00284-009-9386-y Abstract >>
Bacillus thuringiensis strain BtMC28 was isolated from the soil sample in China. Two novel crystal protein genes were found by using the PCR-RFLP method. Moreover, the full-length sequences of two novel genes were obtained by a single oligonucleotide nested (SON)-PCR upstream and downstream strategy. Sequence analysis revealed that one gene encoded a polypeptide of 673 amino acid residues with a molecular mass of 76.3 kDa, 38% identical to Cry10Aa, and the other encoded a polypeptide of 687 amino acid residues with a molecular mass of 77.1 kDa, 74% identical to Cry30Aa. These two novel crystal protein genes were designated as cry54Aa1 and cry30Fa1 by Bt Insecticidal Crystal Proteins Nomenclature Committee, respectively. The Cry54Aa1 and Cry30Fa1 proteins retained five conserved regions commonly found in the existing Cry proteins. Cry54Aa1 protein exhibited insecticidal activities against Laphygma exigua (Lepidoptera), Helicoverpa armigera (Lepidoptera), and Aedes aegypti (Diptera) when its encoding gene was expressed in an Escherichia coli host strain.
|
127. |
Martínez-Blanch JF,
Sánchez G,
Garay E,
Aznar R,
( 2009 ) Development of a real-time PCR assay for detection and quantification of enterotoxigenic members of Bacillus cereus group in food samples. PMID : 19665814 : DOI : 10.1016/j.ijfoodmicro.2009.07.013 Abstract >>
A highly sensitive real-time PCR (qPCR) procedure, targeting the phosphatidylcholine-specific phospholipase C gene (pc-plc), was developed for specific detection and quantification of strains belonging to Bacillus cereus group. The target region was selected based on the enterotoxigenic profiles of 75 Bacillus strains. The inclusivity and exclusivity of the RTi-PCR assay were assessed with 59 isolates of the B. cereus group, 16 other Bacillus spp., and 4 non-Bacillus strains. The assay was also used to construct calibration curves for different food matrices, and it had a wide quantification range of 6 log units using both serial dilutions of purified DNA and calibrated cell suspensions of B. cereus CECT 148(T). The detection limit for B. cereus in artificially contaminated liquid egg and reconstituted infant formula was about 3CFU per reaction or 60CFU/ml of food, with a relative accuracy of 86.27% to 116.12% in artificially contaminated liquid egg. Naturally contaminated food samples were tested for the presence of B. cereus with the standard method, a conventional PCR and the new developed RTi-PCR assay. Results showed that the new developed RTi-PCR assay is very suitable for detection and quantification of strains of B. cereus group in food samples without an enrichment step.
|
128. |
Lee KD,
Gray EJ,
Mabood F,
Jung WJ,
Charles T,
Clark SR,
Ly A,
Souleimanov A,
Zhou X,
Smith DL,
( 2009 ) The class IId bacteriocin thuricin-17 increases plant growth. PMID : 19083012 : DOI : 10.1007/s00425-008-0870-6 Abstract >>
The mechanisms by which many plant growth promoting rhizobacteria (PGPR) affect plants are unknown. We recently isolated a rhizosphere bacterium (Bacillus thuringiensis NEB17), that promotes soybean growth and screened the liquid growth medium in which it grew for plant growth stimulating materials. We have also shown that it produces a bacteriocin (named by us as thuricin-17 and a member of the recently described class IId bacteriocins). Here we show that application of this bacteriocin to leaves (spray) or roots (drench) directly stimulates the growth of both a C(3) dicot (soybean) and a C(4) monocot (corn). This growth stimulation is similar in nature to that previously seen when plants are treated with Nod factors. Strain NEB17 contains three copies of the gene for thuricin 17 that code for identical amino acid sequences. These two lines of evidence suggest that the dual functions of these proteins may have constrained their evolution. This is the first report of direct plant growth enhancement by a bacteriocin.
|
129. |
Shu C,
Yu H,
Wang R,
Fen S,
Su X,
Huang D,
Zhang J,
Song F,
( 2009 ) Characterization of two novel cry8 genes from Bacillus thuringiensis strain BT185. PMID : 19130127 : DOI : 10.1007/s00284-008-9338-y Abstract >>
Two novel cry8-type genes, cry8Ea1 and cry8Fa1, obtained from a Holotrichia parallela-specific Bacillus thuringiensis strain, BT185, were characterized. Findings showed that cry8Ea1 and cry8Fa1 encoded polypeptides of 1164 and 1174 amino acid residues, respectively. The deduced amino acid sequences of both Cry8Ea1 and Cry8Fa1 polypeptides are the most similar to that of Cry8Ba1. Eight conserved blocks (blocks 1-8) exist in Cry8Ea1 and Cry8Fa1 polypeptides compared with known Cry proteins. Cry8Ea1 and the Cry8Fa1 toxins could form spheric crystals when they were expressed in the acrystalliferous mutant strain HD73(-). The spores and crystals from the recombinant strain containing cry8Ea1 were toxic to Holotrichia parallela, with an LC(50) of 0.0875 x 10(8) colony-forming units (CFU)/g. However, Cry8Fa1 expressed in the recombinant strain was not toxic to H. parallela, Anomala corpulenta, or H. oblita.
|
130. |
Beard CE,
Court L,
Boets A,
Mourant R,
Van Rie J,
Akhurst RJ,
( 2008 ) Unusually high frequency of genes encoding vegetative insecticidal proteins in an Australian Bacillus thuringiensis collection. PMID : 18592309 : DOI : 10.1007/s00284-008-9173-1 Abstract >>
Of 188 Australian Bacillus thuringiensis strains screened for genes encoding soluble insecticidal proteins by polymerase chain reaction/restriction-length fragment polymorphism (RFLP) analysis, 87% showed the presence of such genes. Although 135 isolates (72%) produced an RFLP pattern identical to that expected for vip3A genes, 29 isolates possessed a novel vip-like gene. The novel vip-like gene was cloned from B. thuringiensis isolate C81, and sequence analysis demonstrated that it was 94% identical to the vip3Ba1 gene. The new gene was designated vip3Bb2. Cell-free supernatants from both the B. thuringiensis strain C81 and from Escherichia coli expressing the Vip3Bb2 protein were toxic for the cotton bollworm, Helicoverpa armigera.
|
131. |
Beard CE,
Court L,
Mourant RG,
James B,
Van Rie J,
Masson L,
Akhurst RJ,
( 2008 ) Use of a Cry1Ac-resistant line of Helicoverpa armigera (Lepidoptera: Noctuidae) to detect novel insecticidal toxin genes in Bacillus thuringiensis. PMID : 18592310 : DOI : 10.1007/s00284-008-9098-8 Abstract >>
This paper describes a screening strategy incorporating resistant insect lines for discovery of new Bacillus thuringiensis toxins against a background of known genes that would normally mask the activity of additional genes and the application of that strategy. A line of Helicoverpa armigera with resistance to Cry1Ac (line ISOC) was used to screen Cry1Ac-expressing strains of B. thuringiensis for additional toxins with activity against H. armigera. Using this approach, a number of Cry1Ac-producing strains with significant toxicity toward Cry1Ac-resistant H. armigera were identified. When the insecticidal protein complement of one of these strains, C81, was examined in detail, a novel cry2 gene (cry2Af1) was detected.
|
132. |
Yamaguchi T,
Sahara K,
Bando H,
Asano S,
( 2008 ) Discovery of a novel Bacillus thuringiensis Cry8D protein and the unique toxicity of the Cry8D-class proteins against scarab beetles. PMID : 18614174 : DOI : 10.1016/j.jip.2008.05.009 Abstract >>
A novel cry gene, cry8Db, highly toxic to scarab beetles such as the Japanese beetle, Popillia japonica Newman, was cloned from an isolate of Bacillus thuringiensis(Bt), BBT2-5. The cry8Db gene has 3525bp nucleotides and codes for a protein of 1174 amino acid residues. The protein, Cry8Db, has typical Bt characteristics such as the 8-block, conserved sequences and the three-domain 3D toxin structure as defined with Cry3Aa. When the amino acid sequence of Cry8Db was compared with that of Cry8Da whose gene was cloned and characterized in our laboratory earlier, substantial sequence diversities were found in their Domain III. The cry8Db gene was expressed in an acrystalliferous B. thuringiensis strain, BT51. BT51 expressing cry8Db formed a spherical crystal like the natural crystal of BBT2-5. The Cry8Db protein was assayed along with the other scarab active Cry8Da and Cry8Ca against the Japanese beetle. While Cry8Da and Cry8Db had toxicity against both adults and larvae of the Japanese beetle, Cry8Ca was toxic to only larvae. Cry8Ca showed no toxicity against the adult beetle up to 30 microg per 1 cm(2) of leaf discs on which the protein was applied. The activation process of Cry8Db by adult and larval gut juice was compared in vitro with the processes of Cry8Da and Cry8Ca. All three proteins, Cry8Db, Cry8Da and Cry8Ca, produced a toxic core of approximately 70kDa equally indicating that the activation process does not inactivate the adult activity of Cry8Ca. We concluded that the adult activity of Cry8D proteins is encoded in Domain II. Further tests against other beetle species showed a significant difference between Cry8D's and Cry8Ca but no difference between Cry8Da and Cry8Db. Comparison of 3D structural models of Cry8Ca, Cry8Da and Cry8Db, which were constructed by using Cry3Bb as the structural template, indicated significant structural differences, especially between Cry8Ca and Cry8D proteins, in three major surface-exposed loops of Domain II that may be involved in determining the adult beetle activity.
|
133. |
Thamthiankul Chankhamhaengdecha S,
Tantichodok A,
Panbangred W,
( 2008 ) Spore stage expression of a vegetative insecticidal gene increase toxicity of Bacillus thuringiensis subsp. aizawai SP41 against Spodoptera exigua. PMID : 18602953 : DOI : 10.1016/j.jbiotec.2008.05.013 Abstract >>
To enhance the toxicity of the Bacillus thuringiensis subsp. aizawai strain SP41 (SP41), the vegetative insecticidal protein (Vip) gene vip3A from SP41 was redirected to the sporulation stage by replacing its native promoter with the strong promoter P19 of the cry11Aa operon. Compared to the wild type, SP41 with PVIP (vip3A with its native promoter and ter) had the relative expression ratios of 457, 548, and 290 at 8, 14, and 20 h of cultivation, respectively, as measured by quantitative reverse transcription polymerase chain reaction (PCR). SP41 transformed by P19VIP (vip3A controlled by P19 promoter with vip3A ter) showed higher expressions (23, 2055, 1831) at the same time points. SP41 with P19VIP20 (vip3A controlled by P19 promoter and containing P20 and operon ter) had the lowest expression levels (3, 11, 9) at any time point. SDS-PAGE analysis of proteins in the culture supernatant of the P19VIP at 8, 14, and 20 h demonstrated a significant increase in Vip3A at the sporulation stage. Using the surface contamination bioassay, the 50% lethal concentration (LC(50)) of whole culture of PVIP, P19VIP, and P19VIP20 at 20 and 48 h of cultivation against Spodoptera exigua larvae were (68.3, 21.2, and 60.2 microg cm(-2)) and (69.8, 41.8, and 74.6 microg cm(-2)), respectively, compared with 86.6 and 104.4 microg cm(-2) for SP41. The results showed that Vip from P19VIP, expressed at spore stage at 20 and 48 h, can increase the toxicity of SP41 for 4.1- and 2.5-fold, respectively.
|
134. |
Baum JA,
Gilbert MP,
( 1991 ) Characterization and comparative sequence analysis of replication origins from three large Bacillus thuringiensis plasmids. PMID : 1885511 : DOI : 10.1128/jb.173.17.5280-5289.1991 PMC : PMC208237 Abstract >>
The replication origins of three large Bacillus thuringiensis plasmids, derived from B. thuringiensis HD263 subsp. kurstaki, have been cloned in Escherichia coli and sequenced. The replication origins, designated ori 43, ori 44, and ori 60, were isolated from plasmids of 43, 44, and 60 MDa, respectively. Each cloned replication origin exhibits incompatibility with the resident B. thuringiensis plasmid from which it was derived. Recombinant plasmids containing the three replication origins varied in their ability to transform strains of B. thuringiensis, Bacillus megaterium, and Bacillus subtilis. Analysis of the derived nucleotide and amino acid sequences indicates that the replication origins are nonhomologous, implying independent derivations. No significant homology was found to published sequences of replication origins derived from the single-stranded DNA plasmids of gram-positive bacteria, and shuttle vectors containing the three replication origins do not appear to generate single-stranded DNA intermediates in B. thuringiensis. The replication origin regions of the large plasmids are each characterized by a single open reading frame whose product is essential for replication in B. thuringiensis. The putative replication protein of ori 60 exhibits partial homology to the RepA protein of the Bacillus stearothermophilus plasmid pTB19. The putative replication protein of ori 43 exhibits weak but extensive homology to the replication proteins of several streptococcal plasmids, including the open reading frame E replication protein of the conjugative plasmid pAM beta 1. The nucleotide sequence of ori 44 and the amino acid sequence of its putative replication protein appear to be nonhomologous to other published replication origin sequences.
|
135. |
Alvarez A,
Pera LM,
Loto F,
Virla EG,
Baigori MD,
( 2009 ) Insecticidal crystal proteins from native Bacillus thuringiensis: numerical analysis and biological activity against Spodoptera frugiperda. PMID : 18800190 : DOI : 10.1007/s10529-008-9841-z Abstract >>
Fourteen strains of Bacillus thuringiensis collected from both larvae showing disease symptoms and soil samples in northwest Argentina were characterized by insecticidal activity against Spodoptera frugiperda. First instar larvae and protein profile SDS-PAGE analysis of whole cell proteins not only allowed the differentiation of native Bacillus thuringiensis but also revealed the possibility of applying protein profile analysis in classification of toxicity patterns. Cluster analysis showed that there were two main groups. Interestingly, one of them only contained the most pathogenic native strains. The biomass-bound protease activity of native pathogenic isolates and the reference strain Bt 4D1 is also reported.
|
136. |
Rosati A,
Bogani P,
Santarlasci A,
Buiatti M,
( 2008 ) Characterisation of 3' transgene insertion site and derived mRNAs in MON810 YieldGard maize. PMID : 18306044 : DOI : 10.1007/s11103-008-9315-7 Abstract >>
The construct inserted in YieldGard MON810 maize, produced by Monsanto, contains the CaMV 35S promoter, the hsp70 intron of maize, the cryI(A)b gene for resistance to lepidopterans and the NOS terminator. In a previous work a truncation event at the 3' end of the cryI(A)b gene leading to the complete loss of the NOS terminator was demonstrated. The 3' maize genome junction region was isolated in the same experiment not showing any homology with known sequences. The aim of the experiments here reported was therefore to isolate and characterize a larger portion of the 3' integration junction from genomic DNA of two commercial MON810 maize lines. Specific primers were designed on the 3' integration junction sequence for the amplification of a 476 bp fragment downstream of the sequence previously detected. In silico analysis identified the whole isolated 3' genomic region as a gene putatively coding for the HECT E3 ubiquitin ligase. RT-PCR performed in this region produced cDNA variants of different length. In silico translation of these transcripts identified 2 and 18 putative additional aminoacids in different variants, all derived from the adjacent host genomic sequences, added to the truncated CRY1A protein. These putative recombinant proteins did not show homology with any known protein domains. Our data gave new insights on the genomic organization of MON810 in the YieldGard maize and confirmed the previous suggestion that the integration in the genome of maize caused a complex recombination event without, apparently, interfering with the activity of the partial CRY1A endotoxin and both the vigor and yield of the YieldGard maize.
|
137. |
Shao T,
Bai L,
Zhang J,
Wang G,
Liu D,
Li Z,
Liu J,
Song F,
Huang D,
( 2008 ) A nonribosomal peptide synthetase gene tzw1 is involved in zwittermicin A biosynthesis in Bacillus thuringiensis G03. PMID : 18446411 : DOI : 10.1007/s00284-008-9153-5 Abstract >>
A 4.20-kb SspI fragment from Bacillus thuringiensis G03 was cloned and sequenced. Sequencing analysis revealed two complete open reading frames (ORF; tzw1 and tzw2), and one incomplete ORF (tzw3) (GenBank accession no. EU293887). Tzw1 encodes a putative nonribosomal peptide synthetase with thiolation and condensation domains localized at the C-termini, whereas tzw2 and tzw3 encode acyl carrier protein and Acyl-CoA dehydrogenase, respectively. To investigate the function of tzw1 in zwittermicin A (ZA) biosynthesis, an in-frame deletion of 1,461 bp within tzw1 was constructed. The mutant abolished ZA production. Complementation of the mutant with cloned tzw1 restored ZA productivity. These results revealed that tzw1 is required for ZA biosynthesis in B. thuringiensis G03.
|
138. |
Guo G,
Zhang L,
Zhou Z,
Ma Q,
Liu J,
Zhu C,
Zhu L,
Yu Z,
Sun M,
( 2008 ) A new group of parasporal inclusions encoded by the S-layer gene of Bacillus thuringiensis. PMID : 18341579 : DOI : 10.1111/j.1574-6968.2008.01087.x Abstract >>
Bacillus thuringiensis produces various groups of active proteins, such as Cyt, Vip and Parasporin, in addition to the Cry protein. In this study we show S-layer proteins to be a new group of parasporal inclusions of B. thuringiensis. The S-layer consists of a two-dimensional lattice structure and is the outermost component of many archaeobacteria and eubacteria. The parasporal inclusion of B. thuringiensis strain CTC was found to be not a typical crystal protein encoded by the cry gene, but a proteinaceous inclusion encoded by the S-layer gene. Furthermore, the CTC-like strains (with their parasporal inclusions coded by the S-layer gene) are widely distributed and accounted for 25.4% of the B. thuringiensis strains tested. These strains constitute a new group of parasporal inclusions encoded by the S-layer gene of B. thuringiensis and shed new light on B. thuringiensis nontoxic strains.
|
139. |
Zhao C,
Song C,
Luo Y,
Yu Z,
Sun M,
( 2008 ) L-2,3-diaminopropionate: one of the building blocks for the biosynthesis of Zwittermicin A in Bacillus thuringiensis subsp. kurstaki strain YBT-1520. PMID : 18692050 : DOI : 10.1016/j.febslet.2008.07.054 Abstract >>
Zwittermicin A (ZwA) is a hybrid polyketide-non-ribosomal peptide that is thought to be biosynthesized from five proposed building blocks, including the 2,3-diaminopropionate. Candidate genes for de novo biosynthesis of 2,3-diaminopropionate, zwa5A and zwa5B, have been identified in a previous study. In this research, zwa5A was interrupted and chemically synthesized 2,3-diaminopropionate was used to feed the zwa5A(-) mutant. Results showed that feeding with 2,3-diaminopropionate restored the ability of the zwa5A(-) mutant to produce ZwA. Another non-ribosomal peptide synthase gene, designated orf3, was identified. Amino acid dependent PPi release assay showed that the adenylation domain ZWAA2 of ORF3 acyl-adenylated l-2,3-diaminopropionate effectively. Taken together, it can be concluded that l-2,3-diaminopropionate is indeed one of the building blocks for the biosynthesis of Zwittermicin A.
|
140. |
Xue J,
Liang G,
Crickmore N,
Li H,
He K,
Song F,
Feng X,
Huang D,
Zhang J,
( 2008 ) Cloning and characterization of a novel Cry1A toxin from Bacillus thuringiensis with high toxicity to the Asian corn borer and other lepidopteran insects. PMID : 18248430 : DOI : 10.1111/j.1574-6968.2007.01053.x Abstract >>
A novel cry1A was cloned from Bacillus thuringiensis strain BT8 and expressed in the B. thuringiensis acrystalliferous mutant HD73(-). The gene, designated cry1Ah1, encoded a protein with a molecular weight of 134 kDa. Reverse transcriptase-PCR and Western blotting showed that Cry1Ah was expressed in the host strain BT8. The toxin expressed in HD73(-) exhibited high toxicity against lepidopteran larvae of Ostrinia furnacalis, Helicoverpa armigera, Chilo suppressalis, and Plutella xylostella. The 50% lethal concentrations (LC(50)s) were 0.05, 1.48, 0.98 microg g(-1) and 1.52 microg mL(-1), respectively. The LC(50)s of Cry1Ah were significantly lower than that of Cry1Ac for H. armigera, C. suppressalis, and O. furnacalis, and lower than that of Cry1Ab and Cry1Ie for Ostrinia furnacalis. The high toxicity against a range of pest species makes this novel toxin a potential candidate for insect biocontrol.
|
141. |
Wang J,
Steggles JR,
Ellar DJ,
( 2008 ) Molecular characterization of virulence defects in Bacillus thuringiensis mutants. PMID : 18218018 : DOI : 10.1111/j.1574-6968.2007.01061.x Abstract >>
Sequence analysis of a virulence-attenuated Bacillus thuringiensis signature tagged mutant 6F8 led to the identification of an 18 182 bp locus encoding 29 potential protein-coding ORFs. Thirteen of the 29 putative ORFs were found to share extensive homology with genes on plasmid pE33L466 of the pathogenic Bacillus cereus E33L strain. Nine ORFs were not only found in a cluster, but also in the same gene order, in both organisms. A number of mobile elements, including a transposon Tn4430, a novel IS231 family insertion sequence ISBth4 and various phage-related proteins, were found flanking this conserved gene cluster. These features of the 6F8 locus suggested that it might have undergone several DNA insertions from different sources by horizontal gene transfer. Transcriptional analyses of the 6F8 locus revealed that ORFs 1-23 were cotranscribed as a single transcript. Null mutants were constructed to investigate the function of the sequences flanking the signature-tagged mutagenesis insertion sites. Competition assays performed with the wild-type and null mutants demonstrated that the Tn4430 transposon element plays an important role in the full virulence of B. thuringiensis during Manduca sexta infection. This study provides the first experimental evidence that a Tn4430 family transposon is directly associated with B. thuringiensis virulence.
|
142. |
Martins ES,
Aguiar RW,
Martins NF,
Melatti VM,
Falcão R,
Gomes AC,
Ribeiro BM,
Monnerat RG,
( 2008 ) Recombinant Cry1Ia protein is highly toxic to cotton boll weevil (Anthonomus grandis Boheman) and fall armyworm (Spodoptera frugiperda). PMID : 18248369 : DOI : 10.1111/j.1365-2672.2007.03665.x Abstract >>
To evaluate the activity of cry1Ia gene against cotton pests, Spodoptera frugiperda and Anthonomus grandis. Had isolated and characterized a toxin gene from the Bacillus thuringiensis S1451 strain which have been previously shown to be toxic to S. frugiperda and A. grandis. The toxin gene (cry1Ia) was amplified by PCR, sequenced, and cloned into the genome of a baculovirus. The Cry1Ia protein was expressed in baculovirus infected insect cells, producing protein inclusions in infected cells. The Cry1Ia protein has used in bioassays against to S. frugiperda and A. grandis. Bioassays using the purified recombinant protein showed high toxicity to S. frugiperda and A. grandis larvae. Molecular modelling of the Cry1Ia protein translated from the DNA sequence obtained in this work, showed that this protein possibly posses a similar structure to the Cry3A protein. Ultrastructural analysis of midgut cells from A. grandis incubated with the Cry1Ia toxin, showed loss of microvilli integrity. The results indicate that the cry1Ia is a good candidate for the construction of transgenic plants resistant to these important cotton pests.
|
143. |
Lenane IJ,
Bagnall NH,
Josh PF,
Pearson RD,
Akhurst RJ,
Kotze AC,
( 2008 ) A pair of adjacent genes, cry5Ad and orf2-5Ad, encode the typical N- and C-terminal regions of a Cry5Adelta-endotoxin as two separate proteins in Bacillus thuringiensis strain L366. PMID : 18028391 : DOI : 10.1111/j.1574-6968.2007.00987.x Abstract >>
A new DNA sequence cry5Ad/orf2-5Ad (GenBank accession number EF219060) was isolated from Bacillus thuringiensis strain L366. This DNA sequence contains two ORFs: cry5Ad (a previously unreported member of the cry5A gene family) and orf2-5Ad. cry5Ad is unique among cry5A genes in that it encodes only the N-terminal region of a typical Cry5Adelta-endotoxin. The cry5Ad sequence includes homology blocks 1-5, which are present in most B. thuringiensisdelta-endotoxins. The usual C-terminal region of a Cry5Adelta-endotoxin (including homology blocks 6-8) is encoded by orf2-5Ad. Both proteins encoded by cry5Ad and orf2-5Ad were found in IPTG-induced Escherichia coli, after a copy of cry5Ad/orf2-5Ad was cloned into the pQE32 expression vector and transformed into pREP4 E. coli cells. Both proteins were also found in parasporal crystal inclusions of B. thuringiensis L366. Sequencing of cDNA derived from transformed E. coli cells showed that the two ORFs are transcribed as a single mRNA. Extracts prepared from the recombinant E. coli expressing Cry5Ad and Orf2-5Ad were not toxic to nematode larvae (Haemonchus contortus), indicating that these two proteins are most likely not responsible for the nematocidal activity seen previously in the B. thuringiensis strain L366.
|
144. |
Olsen JS,
Skogan G,
Fykse EM,
Rawlinson EL,
Tomaso H,
Granum PE,
Blatny JM,
( 2007 ) Genetic distribution of 295 Bacillus cereus group members based on adk-screening in combination with MLST (Multilocus Sequence Typing) used for validating a primer targeting a chromosomal locus in B. anthracis. PMID : 17997177 : DOI : 10.1016/j.mimet.2007.10.001 Abstract >>
The genetic distribution of 295 Bacillus cereus group members has been investigated by using a modified Multilocus Sequence Typing method (MLST). By comparing the nucleic acid sequence of the adk gene fragment, isolates of B. cereus group members most related to B. anthracis may be easily identified. The genetic distribution, with focus on the B. anthracis close neighbours, was used to evaluate a new primer set for specific identification of B. anthracis. This primer set, BA5510-1/2, targeted the putative B. anthracis specific gene BA5510. Real-time PCR using BA5510-1/2 amplified the target fragment from all B. anthracis strains tested and only two (of 289) non-B. anthracis strains analysed. This is one of the most thoroughly validated chromosomal B. anthracis markers for real-time PCR identification, in which the screened collection contained several very closely related B. anthracis strains.
|
145. |
Chen YL,
Lu W,
Chen YH,
Xiao L,
Cai J,
( 2007 ) [Cloning, expression and sequence analysis of chiA, chiB in Bacillus thuringiensis subsp. colmeri 15A3]. PMID : 18062260 : Abstract >>
Two DNA fragments encoding chitinase A and B were amplified from total genomic DNA of Bacillus thuringiensis subsp. colmeri 15A3, and then ligated with pUCm-T cloning vector. The recombinant plasmids pUCm-chiA and pUCm-chiB were transformed into Escherichia coli XL-Blue respectively. Both chiA and chiB were successfully expressed in E. coli with their natural promoters independent of any chitin. Additionally, the expressed ChiA and ChiB could be secreted from E. coli cells. It was proved that two chitinases were constitutively expressed in strain 15A3. The nucleotide sequence of chiA (GenBank Accession Number: EF103273) with a length of 1426bp included an open reading fram(ORF) of 1083 bp encoding for a protein of 360 amino acids . The deduced amino acid sequence showed that the mature protein ChiA with a predicted molecular mass of 36kDa consisted of a single catalytic domain. The nucleotide sequence of chiB (GenBank Accession Number: EF103273) with a length of 2279 bp included an ORF of 2031bp encoding for a protein of 676 amino acid residues. The deduced amino acid sequence showed that the mature protein ChiB with a predicted molecular mass of 70.6kD was composed of three domains: catalytic domain, chitin-binding domain and fibronectin type III-like domain. The comparison of their upstream sequences informed that there were differences between putative promoters of chiA and chiB.
|
146. |
Swiecicka I,
Bideshi DK,
Federici BA,
( 2008 ) Novel isolate of Bacillus thuringiensis subsp. thuringiensis that produces a quasicuboidal crystal of Cry1Ab21 toxic to larvae of Trichoplusia ni. PMID : 18083867 : DOI : 10.1128/AEM.01955-07 PMC : PMC2258589 Abstract >>
A new isolate (IS5056) of Bacillus thuringiensis subsp. thuringiensis that produces a novel variant of Cry1Ab, Cry1Ab21, was isolated from soil collected in northeastern Poland. Cry1Ab21 was composed of 1,155 amino acids and had a molecular mass of 130.5 kDa, and a single copy of the gene coding for this endotoxin was located on a approximately 75-kbp plasmid. When synthesized by the wild-type strain, Cry1Ab21 produced a unique, irregular, bipyramidal crystal whose long and short axes were both approximately 1 microm long, which gave it a cuboidal appearance in wet mount preparations. In diet incorporation bioassays, the 50% lethal concentrations of the crystal-spore complex were 16.9 and 29.7 microg ml(-1) for second- and fourth-instar larvae of the cabbage looper, Trichoplusia ni, respectively, but the isolate was essentially nontoxic to larvae of the beet armyworm, Spodoptera exigua. A bioassay of autoclaved spore-crystal preparations showed no evidence of beta-exotoxin activity, indicating that toxicity was due primarily to Cry1Ab21. Studies of the pathogenesis of isolate IS5056 in second-instar larvae of T. ni showed that after larval death the bacterium colonized and subsequently sporulated extensively throughout the cadaver, suggesting that other bacteria inhabiting the midgut lumen played little if any role in mortality. As T. ni is among the most destructive pests of vegetable crops in North America and has developed resistance to B. thuringiensis, this new isolate may have applied value.
|
147. |
Lin Y,
Fang G,
Cai F,
( 2008 ) The insecticidal crystal protein Cry2Ab10 from Bacillus thuringiensis: cloning, expression, and structure simulation. PMID : 17973088 : DOI : 10.1007/s10529-007-9572-6 Abstract >>
The cry2Ab-type gene was cloned from Bacillus thuringiensis and designated as cry2Ab10. The recombinant Cry2Ab10 protein expressed in E. coli cells shows high toxicity against Plutella xylostella. The protein structure was constructed by homology modeling, and the receptor-binding sites were predicted by a molecular docking method.
|
148. |
Xu D,
Côté JC,
( 2007 ) Unusual organization associated to a tandem of IS231 may yield two peculiar cloverleaf secondary structures. PMID : 17541834 : DOI : 10.1080/10425170601141127 Abstract >>
A 5.7-kb EcoRI fragment was cloned from plasmid DNA of Bacillus thuringiensis strain M15. It contains two insertion sequences (IS), IS231M2 and -M1 in the 5'-3' order, arranged in tandem, in same orientation, separated by a 540-bp region. The primary structure is typical of a composite transposon, here of 3847 bp in length, for which the name Tn231M is proposed. Each IS is delimited by 18-bp inverted repeats (IR), and flanked by 11-bp direct repeats (DR). Both IS share 99.3% nucleotide identities. IS231M1 has a single open reading frame (ORF) which encodes a putative 477-amino-acid transposase. IS231M2 has two smaller ORFs: ORF1 and ORF2, which could code for polypeptides of 329 and 118 amino acids in length, respectively. Further analysis reveals that the regions upstream of IS231M2, and downstream of -M1, and the 540-bp region, contain additional pairs of IR and DR. Interestingly, potential annealing between all pairs of IR and DR could generate two unusual cloverleaf secondary structures.
|
149. |
Grossi-de-Sa MF,
Quezado de Magalhaes M,
Silva MS,
Silva SM,
Dias SC,
Nakasu EY,
Brunetta PS,
Oliveira GR,
Neto OB,
Sampaio de Oliveira R,
Soares LH,
Ayub MA,
Siqueira HA,
Figueira EL,
( 2007 ) Susceptibility of Anthonomus grandis (cotton boll weevil) and Spodoptera frugiperda (fall armyworm) to a cry1ia-type toxin from a Brazilian Bacillus thuringiensis strain. PMID : 17927912 : Abstract >>
Different isolates of the soil bacterium Bacillus thuringiensis produce multiple crystal (Cry) proteins toxic to a variety of insects, nematodes and protozoans. These insecticidal Cry toxins are known to be active against specific insect orders, being harmless to mammals, birds, amphibians, and reptiles. Due to these characteristics, genes encoding several Cry toxins have been engineered in order to be expressed by a variety of crop plants to control insectpests. The cotton boll weevil, Anthonomus grandis, and the fall armyworm, Spodoptera frugiperda, are the major economically devastating pests of cotton crop in Brazil, causing severe losses, mainly due to their endophytic habit, which results in damages to the cotton boll and floral bud structures. A cry1Ia-type gene, designated cry1Ia12, was isolated and cloned from the Bt S811 strain. Nucleotide sequencing of the cry1Ia12 gene revealed an open reading frame of 2160 bp, encoding a protein of 719 amino acid residues in length, with a predicted molecular mass of 81 kDa. The amino acid sequence of Cry1Ia12 is 99% identical to the known Cry1Ia proteins and differs from them only in one or two amino acid residues positioned along the three domains involved in the insecticidal activity of the toxin. The recombinant Cry1Ia12 protein, corresponding to the cry1Ia12 gene expressed in Escherichia coli cells, showed moderate toxicity towards first instar larvae of both cotton boll weevil and fall armyworm. The highest concentration of the recombinant Cry1Ia12 tested to achieve the maximum toxicities against cotton boll weevil larvae and fall armyworm larvae were 230 microg/mL and 5 microg/mL, respectively. The herein demonstrated insecticidal activity of the recombinant Cry1Ia12 toxin against cotton boll weevil and fall armyworm larvae opens promising perspectives for the genetic engineering of cotton crop resistant to both these devastating pests in Brazil.
|
150. |
Soufiane B,
Xu D,
Côté JC,
( 2007 ) Flagellin (FliC) protein sequence diversity among Bacillus thuringiensis does not correlate with H serotype diversity. PMID : 17578675 : DOI : 10.1007/s10482-007-9173-3 Abstract >>
In Escherichia coli, the fliC gene encodes flagellin, the protein responsible for eliciting the immunological reaction in H serotyping. Here, the presence of the flagellin fliC gene was studied in 86 Bacillus thuringiensis strains encompassing 67 H serotypes. Nineteen strains from four additional species in the B. cereus sensu lato group, B. cereus, B. anthracis, B. mycoides, and B. weihenstephanensis, were added for comparison purposes. The fliC genes were amplified, cloned and their nucleotide sequences determined and translated into amino acid sequences. A bootstrapped neighbor-joining tree was generated from the alignment of the translated amino acid sequences of the amplicons. Although most B. thuringiensis H serotypes had different flagellin amino acid sequences, some different B. thuringiensis serovars shared identical flagellin amino acid sequences. In addition, although serovars from the same H serotype were sometimes found clustered together, several serovars from the same H serotype carried flagellins with sufficiently different amino acid sequences as to be located on distant clusters. No correlations could be established between flagellin (FliC) protein sequence diversity among B. thuringiensis H serotypes and H serotype diversity. These suggest that the B. thuringiensis fliC gene does not code for the flagellin copy responsible for eliciting the immunological reaction in H serotyping. In a previous study, the authors have shown that the B. thuringiensis hag gene codes for the flagellin copy responsible for eliciting the immunological reaction in H serotyping. It is proposed that the B. thuringiensis fliC gene studied here be renamed and that the so-called hag gene studied before be renamed fliC, both in accordance with the E. coli nomenclature.
|
151. |
Liu Y,
Lai Q,
Du J,
Shao Z,
( 2017 ) Genetic diversity and population structure of the Bacillus cereus group bacteria from diverse marine environments. PMID : 28386130 : DOI : 10.1038/s41598-017-00817-1 PMC : PMC5429728 Abstract >>
The phylogenetic diversity of marine bacteria belonged to the Bacillus cereus group has not been well investigated. Here, we present the genetic diversity and population structure of 71 bacteria from diverse marine environments, using a multilocus sequence typing (MLST) approach and the analyses of digital DNA-DNA hybridization (dDDH) and average nucleotide identity (ANI) based on some representative genomic sequences. The MLST analysis demonstrated that these isolates were highly diverse and a wide distribution in marine environments and some of them showed niche specificity to some extent. They were assigned to 27 sequence types (STs) with 23 novel STs. Phylogenetic analysis of 82 bacteria containing 11 type strains based on MLST discriminated them as 20 clusters including 10 new ones. Both the dDDH and ANI results supported the proposition that each of 20 clusters represented one independent species, including 10 putative novel species. Values of 98.3% of MLST similarity and 96.2% of ANI were proposed as the standard for the species definition of this group. In summary, the first insight into the phylogenetic diversity of the group bacteria from marine environments will contribute to better understanding of their ecological role and evolution in contrast with terrestrial environments.
|
152. |
Jung YC,
Mizuki E,
Akao T,
Côté JC,
( 2007 ) Isolation and characterization of a novel Bacillus thuringiensis strain expressing a novel crystal protein with cytocidal activity against human cancer cells. PMID : 17584453 : DOI : 10.1111/j.1365-2672.2006.03260.x Abstract >>
To characterize a novel, unusual, Bacillus thuringiensis strain, to clone its Cry gene and determine the spectrum of action of the encoded Cry protein. The B. thuringiensis strain, referred to as M15, was isolated from dead two-spotted spider mites (Tetranychus urticae Koch; Arthropoda: Arachnida: Tetranychidae). It is an autoagglutination-positive strain and is therefore non-serotypeable. A sporulated culture produces a roughly spherical parasporal inclusion body, the crystal, tightly coupled to the spore. Although the crystal appears to be composed of at least two major polypeptides of 86 and 79 kDa as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Southern hybridization indicates that the corresponding crystal protein gene is likely present in only one copy. The crystal protein gene was cloned and, based on nucleotide sequence homology with an orthologous cry31Aa1 gene, assigned the name cry31Aa2. Although initially isolated from spider mites, B. thuringiensis M15 is non-toxic to spider mites and it does not produce the wide spectrum beta-exotoxin. Assays on mammalian cells, however, reveal that Cry31Aa2, when cleaved with trypsin, is cytocidal to some human cancer cells but not to normal human cells. No cytocidal activity was induced after protease treatment of Cry31Aa2 with either chymotrypsin or proteinase K. Trypsin, chymotrypsin and proteinase K cleavage sites were determined. The B. thuringiensis strain M15 exhibits specific cytocidal activities against some human cancer cells. This study raises questions as to the actual role of this bacterial strain and its crystal protein in the environment. It may be possible to further develop the Cry31Aa2 protein to target specific human cancer cells.
|
153. |
Mahillon J,
Lereclus D,
( 1988 ) Structural and functional analysis of Tn4430: identification of an integrase-like protein involved in the co-integrate-resolution process. PMID : 2842151 : PMC : PMC458404 Abstract >>
The 4149-bp transposon Tn4430 from Bacillus thuringiensis is delineated by 38-bp inverted repeats and codes for a 113-kd protein that shares homology with the transposases (TnpA) of Tn3, Tn21 and Tn501. Through transpositional recombination, this protein generates the formation of co-integrates between both donor and target replicons, with duplication of Tn4430 molecules. These features are characteristic of transposons of the Tn3 family (class II elements). The second step of the transposition process, the co-integrate resolution, is mediated by a 32-kd protein. This protein (TnpI) displays regional similarities with site-specific recombinases of the integrase family, such as Int of bacteriophage lambda, Cre of bacteriophage P1 or TnpA and TnpB of the Tn554 transposon. Moreover, the 250-bp sequence upstream to the tnpI gene contains several structural features that are reminiscent of the attP attachment site of phage lambda. This unique association between the integrase-like TnpI recombinase and the TnpA transposase qualifies Tn4430 as a member of a new group within the class II mobile genetic elements.
|
154. |
Yi W,
Yang K,
Ye J,
Long Y,
Ke J,
Ou H,
( 2017 ) Triphenyltin degradation and proteomic response by an engineered Escherichia coli expressing cytochrome P450 enzyme. PMID : 27907843 : DOI : 10.1016/j.ecoenv.2016.11.012 Abstract >>
Although triphenyltin (TPT) degradation pathway has been determined, information about the enzyme and protein networks involved was severely limited. To this end, a cytochrome P450 hydroxylase (CYP450) gene from Bacillus thuringiensis was cloned and expressed in Escherichia coli BL21 (DE3), namely E. coli pET32a-CYP450, whose dosage at 1gL-1 could degrade 54.6% TPT at 1mgL-1 within 6 d through attacking the carbon-tin bonds of TPT by CYP450. Sequence analysis verified that the CYP450 gene had a 1214bp open reading frame, encoding a protein with 404 amino acids. Proteomic analysis determined that 60 proteins were significantly differentially regulated expression in E. coli pET32a-CYP450 after TPT degradation. The up-regulated proteins enriched in a network related to transport, cell division, biosynthesis of amino acids and secondary metabolites, and microbial metabolism in diverse environments. The current findings demonstrated for the first time that P450 received electrons transferring from NADH could effectively cleave carbon-metal bonds.
|
155. |
Lyngwi NA,
Nongkhlaw M,
Kalita D,
Joshi SR,
( 2016 ) Bioprospecting of Plant Growth Promoting Bacilli and Related Genera Prevalent in Soils of Pristine Sacred Groves: Biochemical and Molecular Approach. PMID : 27111883 : DOI : 10.1371/journal.pone.0152951 PMC : PMC4844137 Abstract >>
Bacillus spp. and related genera native to soils of the pristine sacred groves from Meghalaya, India were characterized using biochemical and 16S rRNA gene analysis which revealed dominance of Bacillus, Paenibacillus, Lysinibacillus and Viridibacillus in the groves. Biochemical estimation was carried out for in vitro testing of plant growth promoting traits present in these isolates. PCR screening were performed for plant growth-promoting related genes involved in the biosynthesis of acid phosphatase (AcPho), indolepyruvate decarboxylase (ipdC), 1-aminocyclopropane-1-carboxylate deaminase (accd) and siderophore biosynthesis protein (asbA). 76% of the sacred grove isolates gave an amplified fragment for AcPho. Three of the isolates gave an amplified fragment for IpdC gene. Apart from 2 isolates, all the other isolates including the reference strains were positive for the amplification of the accd gene indicating their potential to produce ACC deaminase enzyme. 42% of the isolates gave an amplified fragment for asbA gene indicating the potential ability of these isolates to produce the catechol type siderophore, petrobactin. Overall findings indicated multiple PGP genetic traits present in these isolates which suggested that these isolates are capable of expressing multiple PGP traits. Phylogenetic and sequence analysis of accd and asbA genes from the isolates revealed that asbA genes from Paenibacillus taichungiensis SG3 and Paenibacillus tylopili SG24 indicated the occurrence of intergeneric horizontal transfer between Paenibacillus and Bacillus.
|
156. |
Dementiev A,
Board J,
Sitaram A,
Hey T,
Kelker MS,
Xu X,
Hu Y,
Vidal-Quist C,
Chikwana V,
Griffin S,
McCaskill D,
Wang NX,
Hung SC,
Chan MK,
Lee MM,
Hughes J,
Wegener A,
Aroian RV,
Narva KE,
Berry C,
( 2016 ) The pesticidal Cry6Aa toxin from Bacillus thuringiensis is structurally similar to HlyE-family alpha pore-forming toxins. PMID : 27576487 : DOI : 10.1186/s12915-016-0295-9 PMC : PMC5004264 Abstract >>
The Cry6 family of proteins from Bacillus thuringiensis represents a group of powerful toxins with great potential for use in the control of coleopteran insects and of nematode parasites of importance to agriculture. These proteins are unrelated to other insecticidal toxins at the level of their primary sequences and the structure and function of these proteins has been poorly studied to date. This has inhibited our understanding of these toxins and their mode of action, along with our ability to manipulate the proteins to alter their activity to our advantage. To increase our understanding of their mode of action and to facilitate further development of these proteins we have determined the structure of Cry6Aa in protoxin and trypsin-activated forms and demonstrated a pore-forming mechanism of action. The two forms of the toxin were resolved to 2.7 ? and 2.0 ? respectively and showed very similar structures. Cry6Aa shows structural homology to a known class of pore-forming toxins including hemolysin E from Escherichia coli and two Bacillus cereus proteins: the hemolytic toxin HblB and the NheA component of the non-hemolytic toxin (pfam05791). Cry6Aa also shows atypical features compared to other members of this family, including internal repeat sequences and small loop regions within major alpha helices. Trypsin processing was found to result in the loss of some internal sequences while the C-terminal region remains disulfide-linked to the main core of the toxin. Based on the structural similarity of Cry6Aa to other toxins, the mechanism of action of the toxin was probed and its ability to form pores in vivo in Caenorhabditis elegans was demonstrated. A non-toxic mutant was also produced, consistent with the proposed pore-forming mode of action. Cry6 proteins are members of the alpha helical pore-forming toxins - a structural class not previously recognized among the Cry toxins of B. thuringiensis and representing a new paradigm for nematocidal and insecticidal proteins. Elucidation of both the structure and the pore-forming mechanism of action of Cry6Aa now opens the way to more detailed analysis of toxin specificity and the development of new toxin variants with novel activities.
|
157. |
Gowda A,
Rydel TJ,
Wollacott AM,
Brown RS,
Akbar W,
Clark TL,
Flasinski S,
Nageotte JR,
Read AC,
Shi X,
Werner BJ,
Pleau MJ,
Baum JA,
( 2016 ) A transgenic approach for controlling Lygus in cotton. PMID : 27426014 : DOI : 10.1038/ncomms12213 PMC : PMC4960306 Abstract >>
Lygus species of plant-feeding insects have emerged as economically important pests of cotton in the United States. These species are not controlled by commercial Bacillus thuringiensis (Bt) cotton varieties resulting in economic losses and increased application of insecticide. Previously, a Bt crystal protein (Cry51Aa2) was reported with insecticidal activity against Lygus spp. However, transgenic cotton plants expressing this protein did not exhibit effective protection from Lygus feeding damage. Here we employ various optimization strategies, informed in part by protein crystallography and modelling, to identify limited amino-acid substitutions in Cry51Aa2 that increase insecticidal activity towards Lygus spp. by >200-fold. Transgenic cotton expressing the variant protein, Cry51Aa2.834_16, reduce populations of Lygus spp. up to 30-fold in whole-plant caged field trials. One transgenic event, designated MON88702, has been selected for further development of cotton varieties that could potentially reduce or eliminate insecticide application for control of Lygus and the associated environmental impacts.
|
158. |
Huang J,
Guan Z,
Wan L,
Zou T,
Sun M,
( 2016 ) Crystal structure of Cry6Aa: A novel nematicidal ClyA-type �\-pore-forming toxin from Bacillus thuringiensis. PMID : 27381865 : DOI : 10.1016/j.bbrc.2016.07.002 Abstract >>
Crystal (Cry) proteins from Bacillus thuringiensis (Bt) are globally used in agriculture as proteinaceous insecticides. Numerous crystal structures have been determined, and most exhibit conserved three-dimensional architectures. Recently, we have identified a novel nematicidal mechanism by which Cry6Aa triggers cell death through a necrosis-signaling pathway via an interaction with the host protease ASP-1. However, we found little sequence conservation of Cry6Aa in our functional study. Here, we report the 1.90 angstrom (?) resolution structure of the proteolytic form of Cry6Aa (1-396), determined by X-ray crystallography. The structure of Cry6Aa is highly similar to those of the pathogenic toxin family of ClyA-type �\-pore-forming toxins (�\-PFTs), which are characterized by a bipartite structure comprising a head domain and a tail domain, thus suggesting that Cry6Aa exhibits a previously undescribed nematicidal mode of action. This structure also provides a framework for the functional study of other nematicidal toxins.
|
159. |
Jeong H,
Jo SH,
Hong CE,
Park JM,
( 2016 ) Genome Sequence of the Endophytic Bacterium Bacillus thuringiensis Strain KB1, a Potential Biocontrol Agent against Phytopathogens. PMID : 27103716 : DOI : 10.1128/genomeA.00279-16 PMC : PMC4841131 Abstract >>
ITALIC! Bacillus thuringiensisis the most widely known microbial pesticide used in agricultural applications. Herein, we report a draft genome sequence of the endophytic bacterium ITALIC! Bacillus thuringiensisstrain KB1, which exhibits antagonism against phytopathogens.
|
160. |
Zhang Z,
Hao H,
Tang Z,
Zou Z,
Zhang K,
Xie Z,
Babe L,
Goedegebuur F,
Gu X,
( 2015 ) Identification and Characterization of a New Alkaline Thermolysin-Like Protease, BtsTLP1, from Bacillus thuringiensis Serovar Sichuansis Strain MC28. PMID : 25824434 : DOI : 10.4014/jmb.1501.01008 Abstract >>
Thermolysin and its homologs are a group of metalloproteases that have been widely used in both therapeutic and biotechnological applications. We here report the identification and characterization of a novel thermolysin-like protease, BtsTLP1, from insect pathogen Bacillus thuringiensis serovar Sichuansis strain MC28. BtsTLP1 is extracellularly produced in Bacillus subtilis, and the active protein was purified via successive chromatographic steps. The mature form of BtsTLP1 has a molecule mass of 35.6 kDa as determined by mass spectrometry analyses. The biochemical characterization indicates that BtsTLP1 has an apparent Km value of 1.57 mg/ml for azocasein and is active between 20�XC and 80�XC. Unlike other reported neutral gram-positive thermolysin homologs with optimal pH around 7, BtsTLP1 exhibits an alkaline pH optimum around 10. The activity of BtsTLP1 is strongly inhibited by EDTA and a group of specific divalent ions, with Zn(2+) and Cu(2+) showing particular effects in promoting the enzyme autolysis. Furthermore, our data also indicate that BtsTLP1 has potential in cleaning applications.
|
161. |
Ammons DR,
Short JD,
Bailey J,
Hinojosa G,
Tavarez L,
Salazar M,
Rampersad JN,
( 2016 ) Anti-cancer Parasporin Toxins are Associated with Different Environments: Discovery of Two Novel Parasporin 5-like Genes. PMID : 26563301 : DOI : 10.1007/s00284-015-0934-3 Abstract >>
Cry toxins are primarily a family of insecticidal toxins produced by the bacterium Bacillus thuringiensis (Bt). However, some Cry toxins, called parasporins (PSs), are non-insecticidal and have been shown to differentially kill human cancer cells. Based on amino acid homology, there are currently six different classes of parasporins (PS1-6). It is not known what role parasporins play in nature, nor if certain PSs are associated with Bt found in particular environments. Herein, we present ten parasporin-containing isolates of Bt from the Caribbean island of Trinidad. Genes coding for PS1 and PS6 were found in isolates associated mainly with artificial aquatic environments (e.g., barrels with rain water), while Bt possessing two novel PS5-like genes (ps5-1 and ps5-2), were isolated from manure collected directly from the rectum of cattle. The amino acid sequences inferred from the two PS5-like genes were 51 % homologous to each other, while being only 41 or 45 % similar to PS5Aa1/Cry64Aa, the only reported member of the parasporin five class. The low level of amino acid homology between the two PS5-like genes and PS5Aa1 indicate that the two PS5-like genes may represent a new class of parasporins, or greatly expand the level of diversity within the current parasporin 5 class.
|
162. |
Sellami S,
Jemli S,
Abdelmalek N,
Dabbéche E,
Jamoussi K,
( 2016 ) Localization and in silico study of the vegetative insecticidal proteins Vip2S-Vip1S of Bacillus thuringiensis. PMID : 27264647 : DOI : 10.1016/j.ijbiomac.2016.06.003 Abstract >>
The Bacillus thuringiensis S1/4 strain was previously found to harbour vip1S, vip2S, and vip3 genes. Its plasmid curing led to the obtaining of four partially cured strains S1/4-2, S1/4-3, S1/4-7, and S1/4-9 (vip2S-vip1S (-), vip3 (+)), one strain S1/4-4 (vip2S-vip1S (+), vip3 (-)), and S1/4-0 strain lacking the three genes. Using these derivative strains as templates, PCR amplification and southern blot assay revealed that vip2S-vip1S operon and vip3 gene were localized on two different large plasmids. Bioinformatics studies showed that vip2S (1.356 kb), and vip1S (2.637 kb) genes are encoding by an operon consisting of two ORFs separated by an intergenic spacer of 4bp. Using the InterPro tool, Vip2S was found to belong to the family of Binary exotoxin A and Vip1S to bacterial exotoxin B. In silico modeling indicated that the 3D structure of Vip2S is a mixed �\/�] protein and proposed 3D-model of Vip1S. Bioassays of the partially cured strains supernatants showed a weak toxicity of S1/4-4 to the lepidopteran Spodoptera littoralis comparing to a better effect of S1/4-2, S1/4-3, S1/4-7, and S1/4-9, suggesting its eventual contribution to the toxicity. Nevertheless, the concentrated supernatant of S1/4-4 strain was not toxic against the coleopteran Tribolium castaneum.
|
163. |
Castaneda-Alvarez C,
Prodan S,
Rosales IM,
Aballay E,
( 2016 ) Exoenzymes and metabolites related to the nematicidal effect of rhizobacteria on Xiphinema index Thorne & Allen. PMID : 26541369 : DOI : 10.1111/jam.12987 Abstract >>
To identify enzymes and metabolites in the rhizobacteria filtrates that have a nematicidal effect on Xiphinema index and perform molecular characterization of the strains evaluated. A series of four bacteria selected for their nematicidal potential were considered for in vitro, biochemical and molecular studies. The direct effect of the bacterial filtrates was evaluated in vitro on X. index juveniles and adults. Hydrogen sulphide and hydrogen cyanide liberation and protease, chitinase, collagenase and lipase activity were verified in the strains. Up to five housekeeping genes and one ITS 16S-23S rRNA were analysed. All bacterial filtrates presented 54-100% mortality when evaluated during up to 72 h of nematode exposure. Strains presented protease activity; two of them (strains FB833T and FR203A) showed reliable collagenase and chitinase activities, respectively, and three of them showed strong lipolytic activity (FB833T, FR203A and FS213P). Strain Bacillus megaterium FB133M had no lipase activity and presented the lowest nematicidal effect. Bacillus amyloliquefaciens FR203A had the largest lethal effect. The rhizobacteria strains evaluated in this study possess nematicidal compounds, which may offer an interesting alternative for X. index control. This is the first report of exoenzymes and metabolites associated with nematicidal effect of rhizobacteria on X. index, which can be a possible alternative for control of this plant-parasitic nematode.
|
164. |
Zhang F,
Peng D,
Cheng C,
Zhou W,
Ju S,
Wan D,
Yu Z,
Shi J,
Deng Y,
Wang F,
Ye X,
Hu Z,
Lin J,
Ruan L,
Sun M,
( 2016 ) Bacillus thuringiensis Crystal Protein Cry6Aa Triggers Caenorhabditis elegans Necrosis Pathway Mediated by Aspartic Protease (ASP-1). PMID : 26795495 : DOI : 10.1371/journal.ppat.1005389 PMC : PMC4721865 Abstract >>
Cell death plays an important role in host-pathogen interactions. Crystal proteins (toxins) are essential components of Bacillus thuringiensis (Bt) biological pesticides because of their specific toxicity against insects and nematodes. However, the mode of action by which crystal toxins to induce cell death is not completely understood. Here we show that crystal toxin triggers cell death by necrosis signaling pathway using crystal toxin Cry6Aa-Caenorhabditis elegans toxin-host interaction system, which involves an increase in concentrations of cytoplasmic calcium, lysosomal lyses, uptake of propidium iodide, and burst of death fluorescence. We find that a deficiency in the necrosis pathway confers tolerance to Cry6Aa toxin. Intriguingly, the necrosis pathway is specifically triggered by Cry6Aa, not by Cry5Ba, whose amino acid sequence is different from that of Cry6Aa. Furthermore, Cry6Aa-induced necrosis pathway requires aspartic protease (ASP-1). In addition, ASP-1 protects Cry6Aa from over-degradation in C. elegans. This is the first demonstration that deficiency in necrosis pathway confers tolerance to Bt crystal protein, and that Cry6A triggers necrosis represents a newly added necrosis paradigm in the C. elegans. Understanding this model could lead to new strategies for nematode control.
|
165. |
Lechner M,
Kupke T,
Stefanovic S,
Götz F,
( 1989 ) Molecular characterization and sequence of phosphatidylinositol-specific phospholipase C of Bacillus thuringiensis. PMID : 2548063 : DOI : 10.1111/j.1365-2958.1989.tb00209.x Abstract >>
The gene encoding monophosphatidylinositol inositol phosphohydrolase (PI-specific phospholipase C, PI-PLC) of Bacillus thuringiensis was cloned in Staphylococcus carnosus TM300. The complete coding region comprises 987 base pairs corresponding to a precursor protein of 329 amino acids (molecular weight, 38,095). The NH2-terminal sequence of the purified enzyme from Escherichia coli indicated that the mature PI-PLC consists of 299 amino acid residues with a molecular weight of 34,586. Polyacrylamide gel electrophoresis revealed the same molecular weight for the purified enzyme isolated from the DNA-donor strain of B. thuringiensis and from the E. coli clone. By computer analysis, the secondary structure was predicted. The enzyme from the E. coli recombinant shows no activity on other phospholipids and sphingomyelin. The cleaving specificity of PI-PLC was examined by thin layer chromatography.
|
166. |
Baranek J,
Kaznowski A,
Konecka E,
Naimov S,
( 2015 ) Activity of vegetative insecticidal proteins Vip3Aa58 and Vip3Aa59 of Bacillus thuringiensis against lepidopteran pests. PMID : 26146224 : DOI : 10.1016/j.jip.2015.06.006 Abstract >>
Vegetative insecticidal proteins (Vips) secreted by some isolates of Bacillus thuringiensis show activity against insects and are regarded as insecticides against pests. A number of B. thuringiensis strains harbouring vip3A genes were isolated from different sources and identified by using a PCR based approach. The isolates with the highest insecticidal activity were indicated in screening tests, and their vip genes were cloned and sequenced. The analysis revealed two polymorphic Vip protein forms, which were classified as Vip3Aa58 and Vip3Aa59. After expression of the vip genes, the proteins were isolated and characterized. The activity of both toxins was estimated against economically important lepidopteran pests of woodlands (Dendrolimus pini), orchards (Cydia pomonella) and field crops (Spodoptera exigua). Vip3Aa58 and Vip3Aa59 were highly toxic and their potency surpassed those of many Cry proteins used in commercial bioinsecticides. Vip3Aa59 revealed similar larvicidal activity as Vip3Aa58 against S. exigua and C. pomonella. Despite 98% similarity of amino acid sequences of both proteins, Vip3Aa59 was significantly more active against D. pini. Additionally the effect of proteolytic activation of Vip58Aa and Vip3Aa59 on toxicity of D. pini and S. exigua was studied. Both Vip3Aa proteins did not show any activity against Tenebrio molitor (Coleoptera) larvae. The results suggest that the Vip3Aa58 and Vip3Aa59 toxins might be useful for controlling populations of insect pests of crops and forests.
|
167. |
Palma L,
Muñoz D,
Berry C,
Murillo J,
Caballero P,
( 2014 ) Bacillus thuringiensis toxins: an overview of their biocidal activity. PMID : 25514092 : DOI : 10.3390/toxins6123296 PMC : PMC4280536 Abstract >>
Bacillus thuringiensis (Bt) is a Gram positive, spore-forming bacterium that synthesizes parasporal crystalline inclusions containing Cry and Cyt proteins, some of which are toxic against a wide range of insect orders, nematodes and human-cancer cells. These toxins have been successfully used as bioinsecticides against caterpillars, beetles, and flies, including mosquitoes and blackflies. Bt also synthesizes insecticidal proteins during the vegetative growth phase, which are subsequently secreted into the growth medium. These proteins are commonly known as vegetative insecticidal proteins (Vips) and hold insecticidal activity against lepidopteran, coleopteran and some homopteran pests. A less well characterized secretory protein with no amino acid similarity to Vip proteins has shown insecticidal activity against coleopteran pests and is termed Sip (secreted insecticidal protein). Bin-like and ETX_MTX2-family proteins (Pfam PF03318), which share amino acid similarities with mosquitocidal binary (Bin) and Mtx2 toxins, respectively, from Lysinibacillus sphaericus, are also produced by some Bt strains. In addition, vast numbers of Bt isolates naturally present in the soil and the phylloplane also synthesize crystal proteins whose biological activity is still unknown. In this review, we provide an updated overview of the known active Bt toxins to date and discuss their activities.
|
168. |
Zhao C,
Jurat-Fuentes JL,
Abdelgaffar HM,
Pan H,
Song F,
Zhang J,
( 2015 ) Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae. PMID : 25795679 : DOI : 10.1128/AEM.00379-15 PMC : PMC4421046 Abstract >>
Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with (125)I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution.
|
169. |
Adams LF,
Visick JE,
Whiteley HR,
( 1989 ) A 20-kilodalton protein is required for efficient production of the Bacillus thuringiensis subsp. israelensis 27-kilodalton crystal protein in Escherichia coli. PMID : 2644205 : DOI : 10.1128/jb.171.1.521-530.1989 PMC : PMC209617 Abstract >>
The 27-kilodalton (kDa) mosquitocidal protein gene from Bacillus thuringiensis subsp. israelensis has been cloned as a 10-kilobase (kb) HindIII fragment from plasmid DNA; efficient expression in Escherichia coli KM1 depends on a region of DNA located approximately 4 kb upstream (K. McLean and H. R. Whiteley, J. Bacteriol. 169:1017-1023, 1987). We have cloned the upstream DNA region and show that it contains a complete open reading frame (ORF) encoding a protein with a molecular mass of 19,584 Da. Sequencing of adjacent stretches of DNA revealed two partial ORFs: one has 55.2% identity in an overlap of 319 amino acids to the putative transposase of IS231 of B. thuringiensis subsp. thuringiensis, and the other, a 78-codon partial ORF, may be the carboxyl terminus of the 67-kDa protein previously observed in maxicells of strain KM1. A 0.8-kb fragment containing only the 20-kDa protein gene greatly enhanced the expression of the 27-kDa protein in E. coli. The introduction of nonsense codons into the 20-kDa protein gene ORF abolished this effect, indicating that the gene product, not the mRNA or DNA, is required for the enhancement. The effect of the 20-kDa protein gene on various fusions of lacZ to the 27-kDa protein gene suggests that the 20-kDa protein acts after the initiation of translation of the 27-kDa protein gene.
|
170. |
Nouha A,
Sameh S,
Fakher F,
Slim T,
Souad R,
( 2015 ) Impact of Q139R substitution of MEB4-Cry2Aa toxin on its stability, accessibility and toxicity against Ephestia kuehniella. PMID : 26321422 : DOI : 10.1016/j.ijbiomac.2015.08.058 Abstract >>
The Bacillus thuringiensis subsp. kurstaki strain MEB4 was previously found to be highly toxic to Ephestia kuehniella. SDS-PAGE analysis of the recombinant strain DH5�\ (pBS-cry2Aa-MEB4) showed that Cry2Aa-MEB4 delta-endotoxins were forming inclusion bodies, and were 2.75 fold more toxic towards E. kuehniella than those of Cry2Aa-BNS3. Besides to the 65kDa active toxin, proteolysis activation of Cry2Aa-BNS3 protein with E. kuehniella midgut juice generated an extra proteolysis form of 49kDa, which was the result of another chymotrypsin cleavage located in Leu144. The amino acid sequences alignment of Cry2Aa-MEB4 and Cry2Aa-BNS3 showed that among the different 15 amino acids, the Q139R substitution was found to be interesting. In fact, due to its presence within the loop �\3-�\4, the chymotrypsin-like protease was unable to access to its site in Cry2Aa-MEB4, resulting to the production of only the 65kDa form. The accessible surface and the stability studies of the structure model of the Cry2Aa-BNS3-49 form showed a lower hydrophobicity surface due to the omission of 144 amino acids from the N-terminal comparing with the active Cry2Aa-MEB4 protein. All these features caused the diminishing of Cry2Aa-BNS3 toxicity towards E. kuehniella.
|
171. |
Xin B,
Zheng J,
Xu Z,
Song X,
Ruan L,
Peng D,
Sun M,
( 2015 ) The Bacillus cereus group is an excellent reservoir of novel lanthipeptides. PMID : 25548056 : DOI : 10.1128/AEM.03758-14 PMC : PMC4325169 Abstract >>
Lantibiotics are ribosomally synthesized peptides that contain multiple posttranslational modifications. Research on lantibiotics has increased recently, mainly due to their broad-spectrum antimicrobial activity, especially against some clinical Gram-positive pathogens. Many reports about various bacteriocins in the Bacillus cereus group have been published, but few were about lantibiotics. In this study, we identified 101 putative lanthipeptide gene clusters from 77 out of 223 strains of this group, and these gene clusters were further classified into 20 types according to their gene organization and the homologies of their functional genes. Among them, 18 types were novel and have not yet been experimentally verified. Two novel lantibiotics (thuricin 4A-4 and its derivative, thuricin 4A-4D) were identified in the type I-1 lanthipeptide gene cluster and showed activity against all tested Gram-positive bacteria. The mode of action of thuricin 4A-4 was studied, and we found that it acted as a bactericidal compound. The transcriptional analysis of four structural genes (thiA1, thiA2, thiA3, and thiA4) in the thuricin 4A gene cluster showed that only one structural gene, thiA4, showed efficient transcription in the exponential growth phase; the other three structural genes did not. In addition, the putative transmembrane protein ThiI was responsible for thuricin 4A-4 immunity. Genome analysis and functional verification illustrated that B. cereus group strains were a prolific source of novel lantibiotics.
|
172. |
Xu C,
Chinte U,
Chen L,
Yao Q,
Meng Y,
Zhou D,
Bi LJ,
Rose J,
Adang MJ,
Wang BC,
Yu Z,
Sun M,
( 2015 ) Crystal structure of Cry51Aa1: A potential novel insecticidal aerolysin-type �]-pore-forming toxin from Bacillus thuringiensis. PMID : 25957471 : DOI : 10.1016/j.bbrc.2015.04.068 Abstract >>
The structures of several Bacillus thuringiensis (Bt) insecticidal crystal proteins have been determined by crystallographic methods and a close relationship has been explicated between specific toxicities and conserved three-dimensional architectures. In this study, as a representative of the coleopteran- and hemipteran-specific Cry51A group, the complete structure of Cry51Aa1 protoxin has been determined by X-ray crystallography at 1.65 ? resolution. This is the first report of a coleopteran-active Bt insecticidal toxin with high structural similarity to the aerolysin-type �]-pore forming toxins (�]-PFTs). Moreover, study of featured residues and structural elements reveal their possible roles in receptor binding and pore formation events. This study provides new insights into the action of aerolysin-type �]-PFTs from a structural perspective, and could be useful for the control of coleopteran and hemipteran insect pests in agricultures.
|
173. |
Bi Y,
Zhang Y,
Shu C,
Crickmore N,
Wang Q,
Du L,
Song F,
Zhang J,
( 2015 ) Genomic sequencing identifies novel Bacillus thuringiensis Vip1/Vip2 binary and Cry8 toxins that have high toxicity to Scarabaeoidea larvae. PMID : 25081556 : DOI : 10.1007/s00253-014-5966-2 Abstract >>
The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), which has previously been shown to encode the cry8Ga toxin gene, is active against both Holotrichia oblita and Holotrichia parallela. Recombinant Cry8Ga however is only weakly toxic to these insect pests suggesting the involvement of additional toxins in the native strain. We report that through the use of Illumina sequencing three additional, and novel, genes, namely vip1Ad1, vip2Ag1, and cry8-like, were identified in this strain. Although no protein corresponding to these genes could be identified by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the HBF-18 proteome, reverse transcription (RT)-PCR indicated that all three genes were transcribed in the native strain. The two vip genes were cloned and expressed and, as with other Vip1/2 toxins, appeared to function as a binary toxin and showed strong activity against H. oblita, H. parallela and Anomala corpulenta. This is the first report to demonstrate that the Vip1/Vip2 binary toxin is active against these Scarabaeoidea larvae. The cry8-like gene appeared to be a C-terminally truncated form of a typical cry8 gene and was not expressed in our usual recombinant Bt expression system. When however the missing C-terminal region was replaced with the corresponding sequence from cry8Ea, the resulting hybrid expressed well and the toxin was active against the three test insects.
|
174. |
Mathur H,
O'Connor PM,
Cotter PD,
Hill C,
Ross RP,
( 2014 ) Heterologous expression of thuricin CD immunity genes in Listeria monocytogenes. PMID : 24709257 : DOI : 10.1128/AAC.00090-14 PMC : PMC4068476 Abstract >>
Bacteriocins are ribosomally synthesized peptides that can have a narrow or broad spectrum of antimicrobial activity. Bacteriocin producers typically possess dedicated immunity systems that often consist of an ATP-binding cassette (ABC) transporter system and/or a dedicated immunity protein. Here we investigated the genes responsible for immunity to thuricin CD, a narrow-spectrum two-peptide sactibiotic produced by Bacillus thuringiensis DPC6431. Heterologous expression of putative thuricin CD immunity determinants allowed us to identify and investigate the relative importance of the individual genes and gene products that contribute to thuricin CD immunity. We established that TrnF and TrnG are the individual components of an ABC transporter system that provides immunity to thuricin CD. We also identified a hitherto overlooked open reading frame located upstream of trnF predicted to encode a 79-amino-acid transmembrane protein. We designated this newly discovered gene trnI and established that TrnI alone can provide protection against thuricin CD.
|
175. |
Palma L,
Muñoz D,
Berry C,
Murillo J,
de Escudero IR,
Caballero P,
( 2014 ) Molecular and insecticidal characterization of a novel Cry-related protein from Bacillus thuringiensis toxic against Myzus persicae. PMID : 25384108 : DOI : 10.3390/toxins6113144 PMC : PMC4247256 Abstract >>
This study describes the insecticidal activity of a novel Bacillus thuringiensis Cry-related protein with a deduced 799 amino acid sequence (~89 kDa) and ~19% pairwise identity to the 95-kDa-aphidicidal protein (sequence number 204) from patent US 8318900 and ~40% pairwise identity to the cancer cell killing Cry proteins (parasporins Cry41Ab1 and Cry41Aa1), respectively. This novel Cry-related protein contained the five conserved amino acid blocks and the three conserved domains commonly found in 3-domain Cry proteins. The protein exhibited toxic activity against the green peach aphid, Myzus persicae (Sulzer) (Homoptera: Aphididae) with the lowest mean lethal concentration (LC?? = 32.7 �gg/mL) reported to date for a given Cry protein and this insect species, whereas it had no lethal toxicity against the Lepidoptera of the family Noctuidae Helicoverpa armigera (H?bner), Mamestra brassicae (L.), Spodoptera exigua (H?bner), S. frugiperda (J.E. Smith) and S. littoralis (Boisduval), at concentrations as high as ~3.5 �gg/cm?. This novel Cry-related protein may become a promising environmentally friendly tool for the biological control of M. persicae and possibly also for other sap sucking insect pests.
|
176. |
El Khoury M,
Azzouz H,
Chavanieu A,
Abdelmalak N,
Chopineau J,
Awad MK,
( 2014 ) Isolation and characterization of a new Bacillus thuringiensis strain Lip harboring a new cry1Aa gene highly toxic to Ephestia kuehniella (Lepidoptera: Pyralidae) larvae. PMID : 24715255 : DOI : 10.1007/s00203-014-0981-3 Abstract >>
The aim of this study was to characterize new Bacillus thuringiensis strains that have a potent insecticidal activity against Ephestia kuehniella larvae. Strains harboring cry1A genes were tested for their toxicity, and the Lip strain showed a higher insecticidal activity compared to that of the reference strain HD1 (LC50 of Lip and HD1 were 33.27 and 128.61 �gg toxin/g semolina, respectively). B. thuringiensis Lip harbors and expresses cry1Aa, cry1Ab, cry1Ac, cry1Ad and cry2A. DNA sequencing revealed several polymorphisms in Lip Cry1Aa and Cry1Ac compared to the corresponding proteins of HD1. The activation process using Ephestia kuehniella midgut juice showed that Lip Cry1A proteins were more stable in the presence of larval proteases. Moreover, LipCry1A proteins exhibited higher insecticidal activity against these larvae. These results indicate that Lip is an interesting strain that could be used as an alternative to the worldwide used strain HD1.
|
177. |
Zhang C,
Liu Y,
Xue N,
Wang X,
Xie X,
Xu Q,
Chen N,
( 2014 ) [Characterization of recombinant L-isoleucine-4-hydroxylase from Bacillus thuringiensis and its application in 4hydroxyisoleucine biosynthesis]. PMID : 25345020 : Abstract >>
L-isoleucine-4-hydroxylase (IDO) encoding gene ido from Bacillus thuringiensis TCCC 11826 was cloned and expressed, followed by enzyme characterization. In addition, recombinant strain was tested for its 4-Hydroxyisoleucine (4-HIL) biotransformation. Ido gene was amplified from B. thuringiensis TCCC 11826 genomic DNA and expressed in BL-IDO. Recombinant IDO was extracted, purified and characterized. Recombinant strain used for biotransformation of 4-HIL was constructed. Composed of 723 nucleotides encoding 240 amino acids (sharing 97.47% and 97.91% identities with that of B. thuringiensis 2-e-2), ido gene was cloned from B. thuringiensis TCCC 11826. The recombinant IDO contained a His1-X-Asp/Glu-Xn-His2 motif that is specific for Fe(II)/alpha-ketoglutarate-dependent hydroxylases and catalyzed L-isoleucine to 4-HIL. Normal hyperbolic kinetics was observed with L-Ile in the reaction by recombinant IDO. Lineweaver-Burk treatment of the data yielded apparent Km and the Vmax was 0.18 mmol/L and 2.10 micromol/min/mg, respectively. The optimum temperature and pH for the recombinant IDO was 35 degrees C and 7.0 respectively; moreover, the relative activity of the enzyme remain 85.10% after 5 h incubation at 35 degrees C. In all, recombinant strain harboring ido transformed 89.28% of L-isoleucine to 4-HIL. In this study, an ido (Accession No. KC884243) with novel sequence was isolated and enzymatic characteristics of recombinant IDO was systematically analyzed. In addition, we successfully achieved the biotransformation of 4-HIL from L-isoleucine. This work will lay theoretical foundation and practical basis on the microbial manufacture technology of 4-HIL and other amino acid derivatives. This work will lay theoretical foundation and practical basis on the microbial manufacture technology of 4-HIL and other amino acid derivatives.
|
178. |
Iatsenko I,
Boichenko I,
Sommer RJ,
( 2014 ) Bacillus thuringiensis DB27 produces two novel protoxins, Cry21Fa1 and Cry21Ha1, which act synergistically against nematodes. PMID : 24632254 : DOI : 10.1128/AEM.00464-14 PMC : PMC4018918 Abstract >>
Bacillus thuringiensis has been widely used as a biopesticide, primarily for the control of insect pests, but some B. thuringiensis strains specifically target nematodes. However, nematicidal virulence factors of B. thuringiensis are poorly investigated. Here, we describe virulence factors of nematicidal B. thuringiensis DB27 using Caenorhabditis elegans as a model. We show that B. thuringiensis DB27 kills a number of free-living and animal-parasitic nematodes via intestinal damage. Its virulence factors are plasmid-encoded Cry protoxins, since plasmid-cured derivatives do not produce Cry proteins and are not toxic to nematodes. Whole-genome sequencing of B. thuringiensis DB27 revealed multiple potential nematicidal factors, including several Cry-like proteins encoded by different plasmids. Two of these proteins appear to be novel and show high similarity to Cry21Ba1. Named Cry21Fa1 and Cry21Ha1, they were expressed in Escherichia coli and fed to C. elegans, resulting in intoxication, intestinal damage, and death of nematodes. Interestingly, the effects of the two protoxins on C. elegans are synergistic (synergism factor, 1.8 to 2.5). Using purified proteins, we determined the 50% lethal concentrations (LC50s) for Cry21Fa1 and Cry21Ha1 to be 13.6 �gg/ml and 23.9 �gg/ml, respectively, which are comparable to the LC50 of nematicidal Cry5B. Finally, we found that signaling pathways which protect C. elegans against Cry5B toxin are also required for protection against Cry21Fa1. Thus, B. thuringiensis DB27 produces novel nematicidal protoxins Cry21Fa1 and Cry21Ha1 with synergistic action, which highlights the importance of naturally isolated strains as a source of novel toxins.
|
179. |
Delecluse A,
Bourgouin C,
Klier A,
Rapoport G,
( 1989 ) Nucleotide sequence and characterization of a new insertion element, IS240, from Bacillus thuringiensis israelensis. PMID : 2543009 : Abstract >>
The nucleotide sequence of two repeated sequences (RS) in opposite orientations flanking the 125-kDa toxin gene of Bacillus thuringiensis israelensis (C. Bourgouin et al., J. Bacteriol. 170, 3575-3583, 1988) is reported in this paper. The analysis of these sequences indicates that these two RS display characteristic features of bacterial insertion sequences (IS) and are therefore referred to as IS240. IS240 B is 865 bp long and has two perfect terminal-inverted repeats of 16 bp; IS240 A is 99% identical to IS240 B. A long open reading frame encoding a polypeptide of 235 amino acids spans almost the entire sequence of both IS240 elements. Both the sequence of the inverted repeats and the putative transposases are homologous to IS26 of Proteus vulgaris, IS15-delta of Salmonella panama, IS431 of Staphylococcus aureus, and ISS1 of Streptococcus lactis.
|
180. |
Johnson SL,
Daligault HE,
Davenport KW,
Jaissle J,
Frey KG,
Ladner JT,
Broomall SM,
Bishop-Lilly KA,
Bruce DC,
Gibbons HS,
Coyne SR,
Lo CC,
Meincke L,
Munk AC,
Koroleva GI,
Rosenzweig CN,
Palacios GF,
Redden CL,
Minogue TD,
Chain PS,
( 2015 ) Complete genome sequences for 35 biothreat assay-relevant bacillus species. PMID : 25931591 : DOI : 10.1128/genomeA.00151-15 PMC : PMC4417687 Abstract >>
In 2011, the Association of Analytical Communities (AOAC) International released a list of Bacillus strains relevant to biothreat molecular detection assays. We present the complete and annotated genome assemblies for the 15 strains listed on the inclusivity panel, as well as the 20 strains listed on the exclusivity panel.
|
181. |
Ekino K,
Okumura S,
Ishikawa T,
Kitada S,
Saitoh H,
Akao T,
Oka T,
Nomura Y,
Ohba M,
Shin T,
Mizuki E,
( 2014 ) Cloning and characterization of a unique cytotoxic protein parasporin-5 produced by Bacillus thuringiensis A1100 strain. PMID : 24945755 : DOI : 10.3390/toxins6061882 PMC : PMC4073135 Abstract >>
Parasporin is the cytocidal protein present in the parasporal inclusion of the non-insecticidal Bacillus thuringiensis strains, which has no hemolytic activity but has cytocidal activities, preferentially killing cancer cells. In this study, we characterized a cytocidal protein that belongs to this category, which was designated parasporin-5 (PS5). PS5 was purified from B. thuringiensis serovar tohokuensis strain A1100 based on its cytocidal activity against human leukemic T cells (MOLT-4). The 50% effective concentration (EC??) of PS5 to MOLT-4 cells was approximately 0.075 �gg/mL. PS5 was expressed as a 33.8-kDa inactive precursor protein and exhibited cytocidal activity only when degraded by protease at the C-terminal into smaller molecules of 29.8 kDa. Although PS5 showed no significant homology with other known parasporins, a Position Specific Iterative-Basic Local Alignment Search Tool (PSI-BLAST) search revealed that the protein showed slight homology to, not only some B. thuringiensis Cry toxins, but also to aerolysin-type �]-pore-forming toxins (�]-PFTs). The recombinant PS5 protein could be obtained as an active protein only when it was expressed in a precursor followed by processing with proteinase K. The cytotoxic activities of the protein against various mammalian cell lines were evaluated. PS5 showed strong cytocidal activity to seven of 18 mammalian cell lines tested, and low to no cytotoxicity to the others.
|
182. |
Baum JA,
Sukuru UR,
Penn SR,
Meyer SE,
Subbarao S,
Shi X,
Flasinski S,
Heck GR,
Brown RS,
Clark TL,
( 2012 ) Cotton plants expressing a hemipteran-active Bacillus thuringiensis crystal protein impact the development and survival of Lygus hesperus (Hemiptera: Miridae) nymphs. PMID : 22606834 : DOI : 10.1603/ec11207 Abstract >>
The plant bugs Lygus hesperus Knight (Hemiptera: Miridae) and L. lineolaris (Palisot de Beauvois) have emerged as economic pests of cotton in the United States. These hemipteran species are refractory to the insect control traits found in genetically modified commercial varieties of cotton. In this article, we report the isolation and characterization of a 35 kDa crystal protein from Bacillus thuringiensis, designated TIC807, which causes reduced mass gain and mortality of L. hesperus and L. lineolaris nymphs when presented in an artificial diet feeding assay. Cotton plants expressing the TIC807 protein were observed to impact the survival and development of L. hesperus nymphs in a concentration-dependent manner. These results, demonstrating in planta activity of a Lygus insecticidal protein, represent an important milestone in the development of cotton varieties protected from Lygus feeding damage.
|
183. |
Arora N,
Sachdev B,
Gupta R,
Vimala Y,
Bhatnagar RK,
( 2013 ) Characterization of a Chitin-Binding Protein from Bacillus thuringiensis HD-1. PMID : 23824872 : DOI : 10.1371/journal.pone.0066603 PMC : PMC3688941 Abstract >>
Strains of Bacillus thuringiensis produce insecticidal proteins. These strains have been isolated from diverse ecological niches, such as soil, phylloplane, insect cadavers and grain dust. To effectively propagate, these strains produce a range of molecules that facilitate its multiplication in a competing environment. In this report, we have examined synthesis of a chitin-binding protein and evaluated its effect on fungi encountered in environment and its interaction with insecticidal proteins synthesized by B. thuringiensis. The gene encoding chitin-binding protein has been cloned and expressed. The purified protein has been demonstrated to interact with Cry insecticidal protein, Cry1Ac by Circular Dichrosim spectroscopy (CD) and in vitro pull down assays. The chitin-binding protein potentiates insecticidal activity of bacillar insecticidal protein, Cry1Ac. Further, chitin-binding protein was fungistatic against several soil fungi. The chitin binding protein is expressed in spore mother cell and deposited along with insecticidal protein, Cry1Ac. It interacts with Cry1Ac to potentiate its insecticidal activity and facilitate propagation of Bacillus strain in environment by inhibiting growth of certain fungi.
|
184. |
Jamoussi K,
Sellami S,
Nasfi Z,
Krichen-Makni S,
Tounsi S,
( 2013 ) Efficiency and midgut histopathological effect of the newly isolated Bacillus thuringiensis KS �_-endotoxins on the emergent pest Tuta absoluta. PMID : 23727813 : Abstract >>
Tuta absoluta (Povolny, 1994) is a devastating moth to the Solanaceae plants. It is a challenging pest to control, especially on tomatoes. In this work, we studied the entomopathogenic activity of the Cry-forming �_-endotoxins produced by Bacillus thuringiensis strain KS and B. thuringiensis kurstaki reference strain HD1 against T. absoluta. These strains carried the cry2, cry1Ab, cry1Aa / cry1Ac, and cry1I genes, and KS also carried a cry1C gene. The �_-endotoxins of KS were approximately twofold more toxic against the third instar larvae than those of HD1, as they showed lower 50% and 90% lethal concentrations (0.80 and 2.70 �gg/cm? (�_-endotoxins/tomato leaf)) compared with those of HD1 (1.70 and 4.50 �gg/cm?) (p < 0.05). Additionally, the larvae protease extract showed at least six caseinolytic activities, which activated the KS and HD1 �_- endotoxins, yielding the active toxins of about 65 kDa and the protease-resistant core of about 58 kDa. Moreover, the histopathological effects of KS and HD1 �_-endotoxins on the larvae midgut consisted of an apical columnar cell vacuolization, microvillus damage, and epithelial cell disruption. These results showed that the KS strain could be a candidate for T. absoluta control.
|
185. |
Vidal-Quist JC,
Rogers HJ,
Mahenthiralingam E,
Berry C,
( 2013 ) Bacillus thuringiensis colonises plant roots in a phylogeny-dependent manner. PMID : 23822207 : DOI : 10.1111/1574-6941.12175 Abstract >>
Although much is known about the pathology of Bacillus thuringiensis against invertebrates, current understanding of its natural ecology is limited. This study evaluated the biodiversity of B. thuringiensis in relation to its interaction with plants. Phylogenetic relationships between 44 reference and field-collected strains, determined using 16S rRNA and gyrB gene sequences, revealed a high degree of variability, similar to that found in databases. An Arabidopsis thaliana in vitro inoculation model was developed to screen the ability of B. thuringiensis to colonise roots. Significant colonisation differences up to 91-fold were observed between strains, and correlation between strain phylogeny and colonisation was found. The genetics and biochemistry of auxin production; presence of the gene encoding indole pyruvate decarboxylase; and the abilities of Bt strains to swarm, grow in rich/minimal media and affect root growth differed between the strains, but only auxin production correlated significantly with ability to colonise roots. Co-inoculation with Burkholderia phytofirmans PsJN or Pseudomonas fluorescens SBW25 produced no effect on B. thuringiensis colonisation levels, regardless of the co-inoculant. Similarly, root colonisation of A. thaliana mutants impaired in plant defences was not significantly higher compared with controls. This is the first systematic and phylogenetic evaluation of B. thuringiensis interaction with plants.
|
186. |
Zhang L,
Yu J,
Xie Y,
Lin H,
Huang Z,
Xu L,
Gelbic I,
Guan X,
( 2014 ) Biological activity of Bacillus thuringiensis (Bacillales: Bacillaceae) chitinase against Caenorhabditis elegans (Rhabditida: Rhabditidae). PMID : 24772534 : DOI : 10.1603/ec13201 Abstract >>
In addition to being used increasingly as a model system in modern molecular biology studies, the free-living nematode Caenorhabditis elegans (Maupas, 1900) is an important pathogen in fungi and straw mushrooms. In this study, Bacillus thuringiensis strain 010 was found to have significantly detrimental activity against C. elegans. To further characterize this activity, the toxicological mechanism was elucidated at molecular level. Genes encoding for crystal protein and chitinase were isolated, cloned, and sequenced. However, the toxicity was detected only in the chitinase. Under transmission electron microscopy, change in the body wall and gut structures of C. elegans was observed, and thus degeneration of body wall and gut in the worms was also investigated. Further bioassay also confirmed the mortality of C. elegans fed with Escherichia coli TB1 strain. These observations suggest great potential for B. thuringiensis 010 as a biocontrol agent against C. elegans and other nematodes.
|
187. |
Ammons DR,
Reyna A,
Granados JC,
Ventura-Suárez A,
Rojas-Avelizapa LI,
Short JD,
Rampersad JN,
( 2013 ) A novel Bacillus thuringiensis Cry-like protein from a rare filamentous strain promotes crystal localization within the exosporium. PMID : 23851091 : DOI : 10.1128/AEM.01206-13 PMC : PMC3754189 Abstract >>
Mutation of a novel cry-like gene (cry256) from Bacillus thuringiensis resulted in a protein crystal, normally located within the spore's exosporium, being found predominately outside the exosporium. The cry256 gene codes for a 3-domain Cry-like protein that does not correspond to any of the known Cry protein holotypes.
|
188. |
Caballero P,
Ferré J,
Van Rie J,
Muñoz D,
Escriche B,
Maeztu M,
Hernández-Martínez P,
Ruiz de Escudero I,
( 2012 ) Vip3C, a novel class of vegetative insecticidal proteins from Bacillus thuringiensis. PMID : 22865065 : DOI : 10.1128/AEM.01360-12 PMC : PMC3457495 Abstract >>
Three vip3 genes were identified in two Bacillus thuringiensis Spanish collections. Sequence analysis revealed a novel Vip3 protein class (Vip3C). Preliminary bioassays of larvae from 10 different lepidopteran species indicated that Vip3Ca3 caused more than 70% mortality in four species after 10 days at 4 �gg/cm(2).
|
189. |
Suguna P,
Selvanayagam P,
Shenbagarathai R,
Abirami P,
Poornima K,
Binuramesh C,
( 2012 ) Phenotypic and genotypic characterization of B.t.LDC-391 strain that produce cytocidal proteins against human cancer cells. PMID : 22715300 : DOI : 10.6026/97320630008461 PMC : PMC3374356 Abstract >>
An indigenous Bacillus thuringiensis strain B.t.LDC-391 producing cytocidal proteins against human colon cancer cell line, HCT-116, was subjected to phenotypic and genotypic characterization to evaluate its relatedness to B.anthracis. The morphological features of this strain were meta-analyzed with data of other parasporin and insecticidal protein producing Bacillus thuringiensis strains. The conventional biochemical analysis and antibiotic sensitivity test proved it as an ampicillin resistant which is a salient feature, absent in B.anthracis Ames. PCR analysis showed the absence of cyt and parasporin related genes in the genome of B.t.LDC-391. But the strain was positive for cap gene. The sequencing and bio-informatic analysis of cap gene and 16S rDNA of B.t.LDC-391 placed it closer to B.thuringiensis and revealed significant divergence from that of any B.anthracis strain. However our strain lacked �]- hemolysis on human erythrocytes which is a common feature of B.anthracis strains and parasporin producers.
|
190. |
Zhang W,
Crickmore N,
George Z,
Xie L,
He YQ,
Li Y,
Tang JL,
Tian L,
Wang X,
Fang X,
( 2012 ) Characterization of a new highly mosquitocidal isolate of Bacillusthuringiensis--an alternative to Bti? PMID : 22137876 : DOI : 10.1016/j.jip.2011.11.003 Abstract >>
The mosquito is a very important vector involved in the worldwide transmission of disease-causing viruses and parasites. Controlling the mosquito population remains one of the best means for preventing the serious infectious diseases of malaria, yellow fever, dengue, filariasis and so on and there has been an increasing interest in developing biopesticides as a useful substitute to chemical insecticides. As a result, Bacillus thuringiensis subsp. israelensis (Bti) has been extensively used due to its specificity and high toxicity to a variety of mosquito larvae. However it is prudent to seek alternatives to Bti with alternative spectra of mosquitocidal activity or that are able to overcome any resistance that might develop against Bti. The Bt S2160-1 strain was isolated from soil samples collected from Southern China and found to have a comparable mosquitocidal activity to Bti. However there were significant differences in terms of their plasmid profiles, crystal proteins produced and cry gene complement. A PCR-restriction fragment length polymorphism identification system was developed and used in order to identify novel cry-type genes and four such genes (cry30Ea, cry30Ga, cry50Ba and cry54Ba) were identified in Bt S2160-1. In conclusion, Bt S2160-1 has been identified as a potential alternative to Bti, which could be used for the control of mosquito populations in order to reduce the incidence of mosquito-borne diseases.
|
191. |
Soufiane B,
Sirois M,
Côté JC,
( 2011 ) Mutually exclusive distribution of the sap and eag S-layer genes and the lytB/lytA cell wall hydrolase genes in Bacillus thuringiensis. PMID : 21611767 : DOI : 10.1007/s10482-011-9590-1 Abstract >>
Recently, two Bacillus thuringiensis strains were reported to synthesize parasporal inclusion bodies made not of the expected crystal (Cry) proteins but rather of the surface layer proteins (SLP) Sap (encoded by sap) and EA1 (encoded by eag), respectively. Whether the presence of the sap and eag genes is restricted to these two B. thuringiensis strains or ubiquitous in B. thuringiensis is unknown. We report here the distribution of the sap and eag genes in B. thuringiensis. Strains in the Bacillus cereus group were added for comparison purposes. We show that sap and eag are either present in tandem in 35% of the B. thuringiensis strains analysed and absent in 65% of the strains. When absent, a different tandem, the lytB/lytA cell wall hydrolase genes, is present. The distribution of the sap and eag S-layer and the lytB/lytA cell wall hydrolase genes is not species-specific in B. thuringiensis, B. cereus and Bacillus weihenstephanensis. Bacillus anthracis and Bacillus mycoides harbor sap and eag but not lytB/lytA. The sap, eag and lytB/lytA genes were absent in Bacillus pseudomycoides. Clearly, the distribution of the sap and eag S-layer and the lytB/lytA cell wall hydrolase genes in B. thuringiensis and in the Bacillus cereus group is mutually exclusive. We also showed that two genes involved in cell wall metabolism, csaA and csaB, are present not only upstream of the sap and eag S-layer genes, but also upstream of the lytB/lytA tandem in strains where sap and eag are absent. Bootstrapped neighbor-joining trees were inferred from the translated amino acid sequences of sap, eag and the tandem lytB/lytA, respectively.
|
192. |
Asokan R,
Swamy HM,
Arora DK,
( 2012 ) Screening, diversity and partial sequence comparison of vegetative insecticidal protein (vip3A) genes in the local isolates of Bacillus thuringiensis Berliner. PMID : 22246044 : DOI : 10.1007/s00284-011-0078-z Abstract >>
Characterization, direct sequencing of the PCR amplicon and phylogenetic relationship was done to discover a novel Vip protein genes of the Bt isolates, to improve the prospects for insect control, more Vip proteins should be sought out and researched to predict their insecticidal activity. Characterization was based on direct sequencing of PCR amplicon using primers specific to vip3A gene was presented here. 12 out of 18 isolates screened were positive for vip gene-specific primers. Homology search for the partial sequences using BLAST showed that 11 isolates had high similarity to vip3Aa gene and only one fragment with vip3Ae gene (25-100% at nucleotide and amino acid level). Phylogenetic analysis showed that the gene sequences were responsible for geographic separation for divergence within vip genes, consistent with the evaluation of distinct bacterial population. Despite the geographical distances, strains harbouring vip genes have originated from common ancestors may significantly contribute to control resistant insect pests. Some strains have evolved to be quite distinct and others remain as members of closely related groups. The reported method is a powerful tool to find novel Vip3A proteins from large-scale Bt strains which is effective in terms of time and cost. Further the Vip proteins produced by different strains of B. thuringiensis are unique in terms of the sequence divergence and hence may also differ in their insecticidal activities.
|
193. |
Zhang J,
van Hung P,
Hayashi M,
Yoshida S,
Ohkusu K,
Ezaki T,
( 2011 ) DnaJ sequences of Bacillus cereus strains isolated from outbreaks of hospital infection are highly similar to Bacillus anthracis. PMID : 21683265 : DOI : 10.1016/j.diagmicrobio.2011.02.012 Abstract >>
Bacillus cereus is becoming an important nomosomial pathogen because of frequent isolation from blood cultures and from severe systemic infections. To differentiate highly pathogenic outbreak strain of B. cereus from other sources of the Bacillus cereus, we attempted to analyze their dnaJ sequences. Assays indicated that dnaJ sequence similarity of all of 52 blood culture isolates of B. cereus ranged from 92.8% to 100%. The distance between B. anthracis and B. cereus except six outbreak isolates ranged from 3.8% to 6.4%. The dnaJ sequences of six outbreak strains of B. cereus (GTC 02891, GTC 02896, GTC 02916, GTC 02917, GTC 03221, and GTC 03222) were closely related to those of B. anthracis (99.2%-99.5% sequence similarity). Ba813 sequences were only found in the six outbreak strains of B. cereus. The other pathogenic factors of B. anthracis were not found in these six outbreak strains, with the exception of GTC 02891 (cap-positive). The six outbreak strains formed clear �]-hemolytic colonies on a sheep blood agar plate. Our findings suggest that outbreak strains of B. cereus isolated from blood cultures are likely to have the risk of causing serious infection, and dnaJ and Ba813 are important markers to identify such strains. Phylogenetic analysis of dnaJ and MLST revealed that the six outbreak strains of B. cereus are closely related to B. anthracis.
|
194. |
Dardenne F,
Seurinck J,
Lambert B,
Peferoen M,
( 1990 ) Nucleotide sequence and deduced amino acid sequence of a cryIA(c) gene variant from Bacillus thuringiensis. PMID : 2216729 : DOI : 10.1093/nar/18.18.5546 PMC : PMC332238 Abstract >>
N/A
|
195. |
Zhou Z,
Peng D,
Zheng J,
Guo G,
Tian L,
Yu Z,
Sun M,
( 2011 ) Two groups of S-layer proteins, SLP1s and SLP2s, in Bacillus thuringiensis co-exist in the S-layer and in parasporal inclusions. PMID : 21615987 : DOI : 10.5483/BMBRep.2011.44.5.323 Abstract >>
We screened four B. thuringiensis strains whose parasporal inclusions contained the S-layer protein (SLP), and cloned two slp genes from each strain. Phylogenetic analysis indicated these SLPs could be divided into two groups, SLP1s and SLP2s. To confirm whether SLPs were present in the S-layer or as a parasporal inclusion, strains CTC and BMB1152 were chosen for further study. Western blots with whole-cell associated proteins from strains CTC and BMB1152 in the vegetative phase showed that SLP1s and SLP2s were constituents of the S-layer. Immunofluorescence utilizing spore-inclusion mixtures of strains CTC and BMB1152 in the sporulation phase showed that SLP1s and SLP2s were also constituents of parasporal inclusions. When heterogeneously expressed in the crystal negative strain BMB171, four SLPs from strains CTC and BMB1152 could also form parasporal inclusions. This temporal and spatial expression is not an occasional phenomenon but ubiquitous in B. thuringiensis strains.
|
196. |
( 1997 ) Identification and characterization of a previously undescribed cyt gene in Bacillus thuringiensis subsp. israelensis. PMID : 9212418 : PMC : PMC168567 Abstract >>
Mosquitocidal Bacillus thuringiensis strains show as a common feature the presence of toxic proteins with cytolytic and hemolytic activities, Cyt1Aa1 being the characteristic cytolytic toxin of Bacillus thuringiensis subsp. israelensis. We have detected the presence of another cyt gene in this subspecies, highly homologous to cyt2An1, coding for the 29-kDa cytolytic toxin from B. thuringiensis subsp. kyushuensis. This gene, designated cyt2Ba1, maps upstream of cry4B coding for the 130-kDa crystal toxin, on the 72-MDa plasmid of strain 4Q2-72. Sequence analysis revealed, as a remarkable feature, a 5' mRNA stabilizing region similar to those described for some cry genes. PCR amplification and Southern analysis confirmed the presence of this gene in other mosquitocidal subspecies. Interestingly, anticoleopteran B. thuringiensis subsp. tenebrionis belonging to the morrisoni serovar also showed this gene. On the other hand, negative results were obtained with the anti-lepidopteran strains B. thuringiensis subsp. kurstaki HD-1 and subsp. aizawai HD-137. Western analysis failed to reveal Cyt2A-related polypeptides in B. thuringiensis subsp. israelensis 4Q2-72. However, B. thuringiensis subsp. israelensis 1884 and B. thuringiensis subsp. tenebrionis did show cross-reactive products, although in very small amounts.
|
197. |
( 1997 ) Contribution of the 65-kilodalton protein encoded by the cloned gene cry19A to the mosquitocidal activity of Bacillus thuringiensis subsp. jegathesan. PMID : 9361431 : PMC : PMC168764 Abstract >>
Two new crystal protein genes, cry19A and orf2, isolated from Bacillus thuringiensis subsp. jegathesan were cloned and characterized. The cry19A gene encodes a 74.7-kDa protein, and the orf2 gene encodes a 60-kDa protein. Cry19A contains the five conserved blocks present in most B. thuringiensis delta-endotoxins. The ORF2 amino acid sequence is similar to that of the carboxy terminus of Cry4 proteins. The cry 19A gene was expressed independently or in combination with orf2 in a crystal-negative B. thuringiensis host. The proteins accumulated as inclusions. Purified inclusions containing either Cry19A alone or Cry19A and ORF2 together were toxic to Anopheles stephensi and Culex pipiens mosquito larvae. They were more toxic to C. pipiens than to A. stephensi. However, inclusions containing Cry19A and ORF2 together were more toxic than inclusions of Cry19A alone but less toxic than the wild-type inclusions of B. thuringiensis subsp. jegathesan.
|
198. |
( 1997 ) Transgenic elite indica rice plants expressing CryIAc delta-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incertulas). PMID : 9122157 : DOI : 10.1073/pnas.94.6.2111 PMC : PMC20049 Abstract >>
Generation of insect-resistant, transgenic crop plants by expression of the insecticidal crystal protein (ICP) gene of Bacillus thuringiensis (Bt) is a standard crop improvement approach. In such cases, adequate expression of the most appropriate ICP against the target insect pest of the crop species is desirable. It is also considered advantageous to generate Bt-transgenics with multiple toxin systems to control rapid development of pest resistance to the ICP. Larvae of yellow stem borer (YSB), Scirpophaga incertulas, a major lepidopteran insect pest of rice, cause massive losses of rice yield. Studies on insect feeding and on the binding properties of ICP to brush border membrane receptors in the midgut of YSB larvae revealed that cryIAb and cryIAc are two individually suitable candidate genes for developing YSB-resistant rice. Programs were undertaken to develop Bt-transgenic rice with these ICP genes independently in a single cultivar. A cryIAc gene was reconstructed and placed under control of the maize ubiquitin 1 promoter, along with the first intron of the maize ubiquitin 1 gene, and the nos terminator. The gene construct was delivered to embryogenic calli of IR64, an elite indica rice cultivar, using the particle bombardment method. Six highly expressive independent transgenic ICP lines were identified. Molecular analyses and insect-feeding assays of two such lines revealed that the transferred synthetic cryIAc gene was expressed stably in the T2 generation of these lines and that the transgenic rice plants were highly toxic to YSB larvae and lessened the damage caused by their feeding.
|
199. |
( 1997 ) A novel delta-endotoxin gene cryIM from Bacillus thuringiensis ssp. wuhanensis. PMID : 9119053 : DOI : 10.1016/s0014-5793(97)00114-2 Abstract >>
A new cryI-related sequence designated cryIM was cloned using an immunoscreening technique from ssp. wuhanensis of Bacillus thuringiensis (BT), previously reported to produce multiple Cry proteins [Chestukhina et al. (1994) Can. J. Microbiol. 240, 1026-1034]. Analysis of the cryIM nucleotide sequence revealed an ORF, BTII-type promoter-like sequence, peculiar for such genes, a translation initiation element and a putative transcription terminator. Nevertheless, its product was not previously found in the crystals of the host strain [Chestukhina et al. (1994) Can. J. Microbiol. 240, 1026-1034] which shows its weak or absent natural expression. The amino acid sequence of 1151 residues encoded by the continuous reading frame of cryIM is not identical but is essentially similar to the other delta-endotoxins of the CryI class. An IS231-like sequence was found 400 bp downstream of the cryIM stop codon and a fragment of the cryIAb gene was located 3 kb upstream of its initiator codon in the same orientation. Artificial expression of the cloned gene in E. coli under the control of the lacZ promoter allowed us to obtain its hypothetical protein product.
|
200. |
( 1997 ) Identification of two sequence elements associated with the gene encoding the 24-kDa crystalline component in Bacillus thuringiensis ssp. fukuokaensis: an example of transposable element archaeology. PMID : 9200224 : DOI : 10.1006/plas.1997.1283 Abstract >>
A 6.5-kb fragment of plasmid DNA from Bacillus thuringiensis (Bt) ssp. fukuokaensis that encodes a 24-kDa crystalline component was analyzed to identify additional open reading frames (orfs). A novel Bt IS240-like element was found upstream of this gene and is considered to be a vestige of a once active insertion sequence due to a stop codon that interrupts the long orf encoding the putative transposase. This element was bounded by 17-bp terminal inverted repeats that defined the length of the insertion sequence as 802 bp. Further upstream of this element two tandem overlapping and out of phase open reading frames (orfX and orfY) were identified which represent the first example of an IS150-like element in Bt containing both orfs. orfX and orfY are not bounded by terminal inverted repeats but are associated with a gene encoding a putative site-specific recombinase of a type found in Staphylococcus aureus Class II transposons but not previously in Bt.
|
201. |
( 1997 ) Cloning of the nprA gene for neutral protease A of Bacillus thuringiensis and effect of in vivo deletion of nprA on insecticidal crystal protein. PMID : 9172350 : PMC : PMC168523 Abstract >>
The nprA gene, encoding Bacillus thuringiensis neutral protease A, was cloned by the use of gene-specific oligonucleotides. The size of neutral protease A deduced from the nprA sequence was 566 amino acids (60,982 Da). The cloned nprA gene was partially deleted in vitro, and the deleted allele, designated nprA3, was used to construct an nprA3 strain (neutral protease A-deficient strain) of B. thuringiensis. Growth and sporulation of the nprA3 strain were similar to those of an isogenic nprA+ strain, although the extracellular proteolytic activity of the nprA3 strain was significantly less than that of the nprA+ strain. The nprA3 strain produced insecticidal crystal proteins that were more stable than those of the isogenic nprA+ strain after solubilization in vitro, and sporulated cultures of the nprA3 strain contained higher concentrations of full-length insecticidal crystal proteins than did those of its isogenic counterpart. The absence of neutral protease A did not affect the insecticidal activity of a lepidopteran-specific crystal protein of B. thuringiensis. These results indicate that crystal protein stability and yield may be improved by deletion of specific proteases from B. thuringiensis.
|
202. |
( 1997 ) Nucleotide sequence and characterization of the cryptic Bacillus thuringiensis plasmid pGI3 reveal a new family of rolling circle replicons. PMID : 9260939 : DOI : 10.1128/jb.179.16.5000-5008.1997 PMC : PMC179355 Abstract >>
The complete nucleotide sequence of plasmid pGI3 from Bacillus thuringiensis subsp. thuringiensis H1.1. was obtained. Although this 11,365-bp molecule contained at least 11 putative open reading frames (ORFs), extensive database searches did not reveal any homologous sequences with the exception of ORF6, which displayed similarity to the largest ORF of pSTK1, a 1,883-bp cryptic plasmid isolated from Bacillus stearothermophilus. Deletion analysis to determine the pGI3 minimal replicon revealed that ORF6 is the rep gene. Replication occurred via a single-stranded DNA (ssDNA) intermediate, as demonstrated by S1 treatment and Southern hybridization in nondenaturating conditions. Interestingly, however, no homology was found between the pGI3 (ORF6) and pSTK1 (ORF3) rep genes and those from other single-stranded DNA plasmids, nor was there any DNA similarity to the double-strand origins of replication characterized so far, indicating that pGI3 and pSTK1 form another, new family of ssDNA plasmids. PCR analysis revealed that the pGI3 rep gene is largely distributed among B. thuringiensis strains but can also be found in B. cereus and B. mycoides strains, albeit at a lower frequency. Finally, segregation experiments performed with B. subtilis and B. thuringiensis showed that the pGI3 derivatives, including the minimal replicon, were segregationally stable at temperatures suitable for B. thuringiensis growth (<43 degrees C).
|
203. |
( 1997 ) Identification of a gene for Cyt1A-like hemolysin from Bacillus thuringiensis subsp. medellin and expression in a crystal-negative B. thuringiensis strain. PMID : 9023925 : PMC : PMC168337 Abstract >>
A gene designated cyt1Ab1, encoding a 27,490-Da protein, was isolated from Bacillus thuringiensis subsp. medellin (H30 serotype) by using an oligonucleotide probe corresponding to the cyt1Aa1 gene. The sequence of the Cyt1Ab1 protein, as deduced from the sequence of the cyt1Ab1 gene, was 86% identical to that of the Cyt1Aa1 protein and 32% identical to that of the Cyt2Aa1 protein from B. thuringiensis subsp. kyushuensis. The cyt1Ab1 gene was flanked upstream by a p21 gene, in the same orientation, encoding a 21,370-Da protein that showed 84% similarity to the putative chaperone P20 protein from B. thuringiensis subsp. israelensis and downstream, on the opposite strand, by a sequence showing 85% identity to the IS240A insertion sequence. The cyt1Ab1 gene was expressed at a high level in a nontoxic strain of B. thuringiensis subsp. israelensis in which large inclusions of the Cyt1Ab1 protein were produced. Purified Cyt1Ab1 crystals were as hemolytic as those of the Cyt1Aa1 protein and were twice as hemolytic as those from the wild-type strain. Mosquitocidal activity toward Aedes aegypti, Anopheles stephensi, and Culex pipiens larvae was assayed. The toxicity of the Cyt1Ab1 protein was slightly lower than that of the Cyt1Aa1 protein for all three mosquito species, and Cyt1Ab1 was 150, 300, and 800 times less active toward Culex, Anopheles, and Aedes larvae, respectively, than were the native crystals from B. thuringiensis subsp. medellin.
|
204. |
( 1993 ) Identification of a promoter for the crystal protein-encoding gene cryIVB from Bacillus thuringiensis subsp. israelensis. PMID : 8299955 : DOI : 10.1016/0378-1119(93)90015-u Abstract >>
The cryIVB gene of Bacillus thuringiensis subsp. israelensis (Bti) codes for a 135-kDa insecticidal crystal protein, which is specifically toxic to dipteran larvae. We have identified a transcription start point (tsp) of cryIVB by a primer extension experiment. The promoter sequence alignment, together with the chronology of appearance of the transcript, suggested that cryIVB is transcribed by RNA polymerase containing sigma 35 (E sigma 35). This was confirmed by investigation of cryIVB transcription in several Bacillus subtilis sporulation mutants. Unlike the lepidopteran-specific crystal protein-encoding genes [cryIA(a) and cryIB], transcription of which is regulated by both sigma 35 and sigma 28, cryIVB transcription was controlled only by the sigma 35-dependent promoter at the midsporulation stage.
|
205. |
( 1993 ) IS231V and W from Bacillus thuringiensis subsp. israelensis, two distant members of the IS231 family of insertion sequences. PMID : 8234486 : DOI : 10.1006/plas.1993.1041 Abstract >>
IS231 constitutes a family of related insertion sequences (IS) from Bacillus thuringiensis. Two new IS231-related elements, IS231V and IS231W, have been isolated from the 72-MDa plasmid of B. thuringiensis subsp. israelensis. These closely related 1964-bp IS are delimited by 22-bp imperfect inverted repeats strongly similar to those of the other iso-IS231. Although the other known IS231 harbor a single long open reading frame (ORF), IS231V and W display two slightly overlapping ORF on the same DNA strand. They show about 50% identity with the transposase of the other iso-IS231. A frameshifting model is proposed for the synthesis of a fusion product which would constitute their active transposase.
|
206. |
( 1993 ) Primary structure of cryX**, the novel delta-endotoxin-related gene from Bacillus thuringiensis spp. galleriae. PMID : 8262221 : DOI : 10.1016/0014-5793(93)81613-5 Abstract >>
A cry-related sequence, designated cryX (EMBL X75019), was localized upstream of cryIG, the delta-endotoxin gene cloned from spp. galleriae of Bacillus thuringiensis and sequenced earlier [(1991) FEBS Lett. 293, 25-28]. Analysis of the cryX complete nucleotide sequence enabled us to explain its virtual crypticity and to reveal the chimeric structure of the genes, cryX and cryIG. The amino acid sequence of 1,151 residues encoded by the continuous reading frame of cryX is similar to the other delta-endotoxins but differs essentially from them.
|
207. |
( 1996 ) Identification of a Bacillus thuringiensis gene that positively regulates transcription of the phosphatidylinositol-specific phospholipase C gene at the onset of the stationary phase. PMID : 8631661 : DOI : 10.1128/jb.178.10.2749-2756.1996 PMC : PMC178008 Abstract >>
A transcriptional analysis of the phosphatidylinositol-specific phospholipase C (plcA) gene of Bacillus thuringiensis indicated that its transcription was activated at the onset of the stationary phase in B. thuringiensis but was not activated in B. subtilis. The B. thuringiensis gene encoding a transcriptional activator required for plcA expression was cloned by using a B. subtilis strain carrying a chromosomal plcA'-'lacZ fusion as a heterologous host for selection. This trans activator (designated PlcR) is a protein of a calculated molecular weight of 33,762 which appears to be distantly related to PreL and NprA, regulator proteins enhancing transcription of neutral protease genes during the stationary phase of a Lactobacillus sp. and B. stearothermophilus, respectively. plcR gene transcription was analyzed in B. thuringiensis and in B. subtilis. PlcR positively regulated its own transcription at the onset of the stationary phase. There is a highly conserved DNA sequence (17 bp) 34 nucleotides upstream from the plcR transcriptional start site and 49 nucleotides upstream from the plcA transcriptional start site. As PlcR positively regulates its own transcription and plcA transcription, this conserved DNA sequence may be the specific recognition target for PlcR activation.
|
208. |
( 1996 ) Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. PMID : 8643585 : DOI : 10.1073/pnas.93.11.5389 PMC : PMC39256 Abstract >>
A novel vegetative insecticidal gene, vip3A(a), whose gene product shows activity against lepidopteran insect larvae including black cutworm (Agrotis ipsilon), fall armyworm (Spodoptera frugiperda), beet armyworm (Spodoptera exigua), tobacco budworm (Heliothis virescens), and corn earworm (Helicoverpa zea) has been isolated from Bacillus thuringiensis strain AB88. VIP3-insecticidal gene homologues have been detected in approximately 15% of Bacillus strains analyzed. The sequence of the vip3A(b) gene, a homologue of vip3A(a) isolated from B. thuringiensis strain AB424 is also reported. Vip3A(a) and (b) proteins confer upon Escherichia coli insecticidal activity against the lepidopteran insect larvae mentioned above. The sequence of the gene predicts a 791-amino acid (88.5 kDa) protein that contains no homology with known proteins. Vip3A insecticidal proteins are secreted without N-terminal processing. Unlike the B. thuringiensis 5-endotoxins, whose expression is restricted to sporulation, Vip3A insecticidal proteins are expressed in the vegetative stage of growth starting at mid-log phase as well as during sporulation. Vip3A represents a novel class of proteins insecticidal to lepidopteran insect larvae.
|
209. |
( 1993 ) Identification of a cryptic gene associated with an insertion sequence not previously identified in Bacillus thuringiensis. PMID : 8293956 : DOI : 10.1016/0378-1097(93)90136-p Abstract >>
After screening several Bt strains with a cryII toxin probe, clones from two strains were found to contain a cryptic cryIIB gene associated with an insertion sequence element belonging to the IS2/IS3 family. The lack of expression of this gene appears to result from mutation of the upstream orf2 gene which has been shown to be necessary for cryII expression.
|
210. |
( 1996 ) A Bacillus thuringiensis insecticidal crystal protein with a high activity against members of the family Noctuidae. PMID : 8572715 : PMC : PMC167775 Abstract >>
The full characterization of a novel insecticidal crystal protein, named Cry9Ca1 according to the revised nomenclature for Cry proteins, from Bacillus thuringiensis serovar tolworthi is reported. The crystal protein has 1,157 amino acids and a molecular mass of 129.8 kDa. It has the typical features of the Lepidoptera-active crystal proteins such as five conserved sequence blocks. Also, it is truncated upon trypsin digestion to a toxic fragment of 68.7 kDa by removal of 43 amino acids at the N terminus and the complete C-terminal half after conserved sequence block 5. The 68.7-kDa fragment is further degraded to a nontoxic 55-kDa fragment. The crystal protein has a fairly broad spectrum of activity against lepidopteran insects, including members of the families Pyralidae, Plutellidae, Sphingidae, and Noctuidae. A 50% lethal concentration of less than 100 ng/cm2 of diet agar was found for diamondback moth, European corn borer, cotton bollworm, and beet armyworm. It is the first insecticidal crystal protein with activity against cutworms. No activity was observed against some beetles, such as Colorado potato beetle. The protein recognizes a receptor different from that recognized by Cry1Ab5 in Ostrinia nubilalis and Plutella xylostella. In Spodoptera exigua and P. xylostella, it binds to a receptor which is also recognized by Cry1Cax but with a lower affinity. In these insects, Cry1Cax probably binds with a higher affinity to an additional receptor which is not recognized by Cry9Ca1. Elimination of a trypsin cleavage site which is responsible for the degradation to a nontoxic fragment did result in protease resistance but not in increased toxicity against O. nubilalis.
|
211. |
( 1994 ) Complete nucleotide sequence of the Bacillus thuringiensis subsp. israelensis plasmid pTX14-3 and its correlation with biological properties. PMID : 8171127 : DOI : 10.1006/plas.1994.1008 Abstract >>
The complete nucleotide sequence of the plasmid pTX14-3 from Bacillus thuringiensis subsp. israelensis has been determined. The circular DNA molecule was 7649 bp and had a G + C content of 35.1%. Twenty-two open reading frames larger than 50 codons were identified. Ten of these open reading frames are suggested to be protein coding regions. The existence of the polypeptides encoded by the mob14-3 and rep14-3 genes were verified by maxi-cells analysis in Escherichia coli. Even though the rep14-3 gene was expressed in E. coli the plasmid pTX14-3 was unable to replicate in this bacterium. The minimal region of the plasmid pTX14-3 required for replication in B. thuringiensis was identified. Potential secondary structures upstream of the rep14-3 gene indicated regulation by antisense RNA and transcription attenuation. Extensive sequence homology with the B. thuringiensis subsp. thuringiensis plasmid pGI2 was found in the last part of the mob14-3 gene, downstream of the rep14-3 gene, and in the region containing the single-strand origin of replication (i.e., the minus origin) of pTX14-3. A sequence of 700 bp containing multiple direct repeats was found in an ORF encoding a glycine and proline rich protein of 35.9 kDa. 1.2 kbp upstream and 0.1 kbp downstream of this ORF was found a large direct repeat of 230 bp (87% identity). The region between this direct repeat was often spontaneously deleted from plasmid derivatives containing the entire pTX14-3.
|
212. |
( 1993 ) [Nucleotide sequence of the toxic domain of an insecticidal protein gene from B. thuringiensis subsp. kurstaki HD-1]. PMID : 8178516 : Abstract >>
Two crystal protein genes, the 5.3kb and 6.6kb class respectively, from Bacillus thuringiensis subsp. kurstaki HD-1 (B. t HD-1) had been cloned previously. Based on the classification system of Hofte and Whiteley, these two genes should belong to Cry I A (b) and Cry I A (c) gene type respectively. The nucleotide sequence of the toxic domain of this Cry I A (c) gene from B. t kurstaki HD-1 is firstly reported here and compared with that of Cry I A (c) gene from B. t HD-73 and Cry I A (b) gene from B. t HD-1.
|
213. |
( 1993 ) Full expression of the cryIIIA toxin gene of Bacillus thuringiensis requires a distant upstream DNA sequence affecting transcription. PMID : 8491716 : DOI : 10.1128/jb.175.10.2952-2960.1993 PMC : PMC204613 Abstract >>
The cryIIIA gene encoding a coleopteran-specific toxin is poorly expressed in Bacillus thuringiensis when cloned in a low-copy-number plasmid. This weak expression is observed when the gene is cloned only with its promoter and its putative terminator. cryIIIA gene expression was analyzed by using deletion derivatives of a larger DNA fragment carrying the toxin gene and additional adjacent sequences. The results indicate that a 1-kb DNA fragment located 400 bp upstream of the promoter strongly enhances CryIIIA production in B. thuringiensis sporulating cells. Similar results were obtained when the low-copy-number plasmid pHT304 carrying transcriptional fusions between upstream regions of cryIIIA and the lacZ gene was used. Analysis of the start sites, the sizes, and the amounts of cryIIIA-specific mRNAs shows that the enhancement occurs at the transcriptional level by increasing the number of cryIIIA-specific transcripts from the onset of sporulation to about 6 h after the onset of sporulation. The nucleotide sequence of the 1-kb activating fragment and of the 700 bp containing the promoter region and the 5' end of cryIIIA were determined. No potential protein-coding sequences were found upstream of the promoter. The major characteristic of the 1-kb activating fragment is the presence of a 220-bp A + T-rich region.
|
214. |
Yoshisue H,
Ihara K,
Nishimoto T,
Sakai H,
Komano T,
( 1995 ) Cloning and characterization of a Bacillus thuringiensis homolog of the spoIIID gene from Bacillus subtilis. PMID : 7867944 : DOI : 10.1016/0378-1119(94)00822-a Abstract >>
The SpoIIID protein of Bacillus subtilis (Bs) is a small DNA-binding protein that is essential for gene expression of the mother cell compartment during sporulation. We have cloned a DNA fragment from Bacillus thuringiensis (Bt) that showed a specific hybridization with the Bs spoIIID gene. Sequence analysis found an open reading frame encoding 90 amino acids (aa), which are 89% identical to the deduced aa sequence of Bs spoIIID. Upstream from the transcription start point (tsp), a nucleotide sequence highly homologous to the consensus sequence motif for the sigma 35-recognized promoters was found. Northern blot analysis has indicated that the expression of the gene is induced only at the midsporulation stage, and that the gene constitutes an operon with a downstream gene, mreB. The Bs strain carrying the spoIIID delta erm or spoIIID83 mutation completely restored sporulation ability upon introduction of the spoIIID homologous gene from Bt. These results strongly suggest that the gene we have cloned is a Bt homolog of spoIIID.
|
215. |
Adams LF,
Mathewes S,
O'Hara P,
Petersen A,
Gürtler H,
( 1994 ) Elucidation of the mechanism of CryIIIA overproduction in a mutagenized strain of Bacillus thuringiensis var. tenebrionis. PMID : 7830581 : DOI : 10.1111/j.1365-2958.1994.tb01298.x Abstract >>
NB176 is a Bacillus thuringiensis mutant derived by gamma-irradiation of NB125 Bacillus thuringiensis var. tenebrionis (Krieg). It exhibits two interesting phenotypes: (i) oligosporogeny and (ii) twofold to threefold overproduction of the CryIIIA protein. Southern profiles of the NB176 strain showed an additional copy(s) of the cryIIIA gene located on a 4 kb HindIII fragment, in addition to the expected cryIIIA gene on a 3 kb HindIII fragment. Each cryIIIA gene-bearing HindIII fragment was cloned from NB176. The restriction map of the 3 kb HindIII fragment was identical to that published by Donovan and coworkers. Sequencing of the 4 kb HindIII fragment showed no alterations in the promoter region of the cryIIIA gene but did show replacement of the region immediately following the cryIIIA open reading frame with a sequence encoding a transposase with 50% amino acid homology to that of Tn1000. These findings suggest that the overproduction phenotype of NB176 results from extra copies of the cryIIIA gene produced from a transposition event(s) induced or stabilized by gamma-irradiation. Integration of additional copies of the cryIIIA gene into the native 90 MDa plasmid of the wild-type B. thuringiensis var. tenebrionis strain resulted in strains that made enormous crystals, many possessing greatly enhanced insecticidal activity.
|
216. |
Masson L,
Lu YJ,
Mazza A,
Brousseau R,
Adang MJ,
( 1995 ) The CryIA(c) receptor purified from Manduca sexta displays multiple specificities. PMID : 7657602 : DOI : 10.1074/jbc.270.35.20309 Abstract >>
The kinetic binding characteristics of four Bacillus thuringiensis CryI insecticidal crystal proteins to a Cry-binding protein, purified from Manduca sexta brush-border vesicles, were analyzed by an optical biosensor. This 120-kilodalton binding protein, previously determined to be aminopeptidase N, was converted to a 115-kilodalton water-soluble form by removing the attached glycosylphosphatidylinositol anchor with phospholipase C. The solubilized form recognized the three major subclasses of CryIA toxins but not CryIC even though all four CryI proteins are toxic to larvae of M. sexta. CryIA(a) and CryIA(b) toxins bound to a single site on the solubilized aminopeptidase N molecule whereas CryIA(c) bound to two distinct sites. Apparent kinetic rate constants were determined for each binding reaction. All three CryIA toxins exhibited moderately fast on rates (approximately 10(-5) M-1 s-1) and a slow reversible off rate (approximately 10(-3) s-1). Although the second CryIA(c)-binding site retained a moderately fast association rate, it was characterized by a rate of dissociation from the amino-peptidase an order of magnitude faster than observed for the other CryIA-binding sites. CryIA(c) binding to both sites was strongly inhibited in the presence of N-acetylgalactosamine (IC50 = 5 mM) but not N-acetylglucosamine, mannose, or glucose. CryIA(a) and CryIA(b) binding were unaffected in the presence of the same sugars. Our results serve to illustrate both the complexity and the diverse nature of toxin interactions with Cry-binding proteins.
|
217. |
Li X,
Li R,
( 1994 ) Coleopterancidal delta-endotoxin and constructing its genomic library. PMID : 7803692 : Abstract >>
The composition of crystal proteins and plasmid patterns in five new coleopterancidal strains of Bacillus thuringiensis were investigated. Larvae of Plagiodera versicolora were chosen as a model insect in bioassay. Strain YM-03 had the highest toxicity. Plasmid patterns were detected by rapid agarose gel electrophoresis. It was demonstrated that plasmid patterns of five Bt strains were quite different. The partial amino acid sequences of the N-terminal of crystal protein from YM-03 were analyzed by amino acid analyzer. A genomic library of delta-endotoxin of YM-03 was constructed. The EcoRI fragments (20-30 kb) from the total DNA were ligated with the vector DNA of pLAFRI. Thirteen clones which contained both of pLAFRI and foreign DNA fragments were obtained from 17 recombined plasmids. The frequency of recombinant clones was 76%. Three positive clones, LE392 (pBYM2), LE392 (pBYM3) and LE392 (pBYM4) were detected from 1200 resistant clones by using a synthesized 18bp probe from a coleopterancidal delta-endotoxin gene. It was shown that LE392 (pBYM3) and LE392 (pBYM4) had the same EcoRI digestion patterns and that they all contained coleoptera-specific delta-endotoxin gene but showed a different level of expression.
|
218. |
Masson L,
Mazza A,
Gringorten L,
Baines D,
Aneliunas V,
Brousseau R,
( 1994 ) Specificity domain localization of Bacillus thuringiensis insecticidal toxins is highly dependent on the bioassay system. PMID : 7715447 : DOI : 10.1111/j.1365-2958.1994.tb01321.x Abstract >>
The Bacillus thuringiensis crylA(a) and crylA(c) gene specificity regions were probed by creating and testing hybrid toxins both in vivo and in vitro against cultured insect cells or dissociated midgut epithelial cells. Toxin threshold dose determinations revealed that CrylA(c) is highly active against cultured Choristoneura fumiferana cells (CF-1) whereas CrylA(a) is nontoxic. In live insect bioassays, a reversed order of toxicity was observed. Hybrid analysis revealed that the CrylA(c) toxicity-determining region is located between codons 258 and 510. Two smaller subsections of this region (residues 258-358 and 450-510) were able to confer toxicity, although at lower levels, and one region (358-450) was present where progressive substitutions of crylA(a) with crylA(c) sequences had no effect. Exchanging the non-homologous N-terminal regions of CrylA(c) with CrylE suggested that the N-terminus does not play a role in specificity. One hybrid clone, MP80, displays a 99.3% homology to CrylA(b) but shows an 800-fold increase in toxicity to CF-1 cells relative to that shown by CrylA(b). Direct comparison between live Bombyx mori bioassays and a newly developed in vitro lawn assay using dissociated midgut epithelial cells from the same insect revealed striking differences in toxicity. The toxicity-determining region for B. mori larvae was determined to be between codons 283 and 450, although the 450-620 codon region may exert an influence on toxicity. In general, native or hybrid toxins showing little or no insect intoxication were very active against the epithelial cells, suggesting that factors other than toxin amino acid sequence play an important role in determining toxin specificity.
|
219. |
Dervyn E,
Poncet S,
Klier A,
Rapoport G,
( 1995 ) Transcriptional regulation of the cryIVD gene operon from Bacillus thuringiensis subsp. israelensis. PMID : 7730255 : DOI : 10.1128/jb.177.9.2283-2291.1995 PMC : PMC176882 Abstract >>
The CryIVD protein is involved in the overall toxicity of the Bacillus thuringiensis subsp. israelensis parasporal inclusions and is one of the four major components of the crystals. Determination of the DNA sequence indicated that the cryIVD gene is the second gene of an operon which includes three genes. The first one encodes a 19-kDa polypeptide and has sequence homology with the orf1 gene of the Bacillus thuringiensis cryIIA and cryIIC operons. The second and third genes have already been identified and encode the CryIVD crystal protein and the P20 polypeptide, respectively. The promoter region was located by deletion analysis, and the 5' end of the mRNA was determined by primer extension mapping. Transcription of the cryIVD gene in B. thuringiensis subsp. israelensis strains is induced 9 h after the beginning of sporulation. Sequence analysis indicated two potential promoters, a strong one and a weak one, recognized respectively by the RNA polymerase associated with the sigma 35 or the sigma 28 factor of B. thuringiensis (sigma E and sigma K of Bacillus subtilis, respectively). Transcriptional lacZ fusion integrated in single copy into the chromosome of various B. subtilis sporulation mutants confirmed the sigma E dependence of cryIVD gene transcription.
|
220. |
Udayasuriyan V,
Nakamura A,
Mori H,
Masaki H,
Uozumi T,
( 1994 ) Cloning of a new cryIA(a) gene from Bacillus thuringiensis strain FU-2-7 and analysis of chimaeric CryIA(a) proteins for toxicity. PMID : 7764972 : Abstract >>
We cloned the cryIA(a) gene from Bacillus thuringiensis strain FU-2-7, one of the toxin genes encoding lepidopteran-specific protoxins. Sequence analysis of the gene showed two amino acid differences (Pro77 to Leu and Phe965 to Ser) from the CryIA(a) of B. thuringiensis strain HD-1. We constructed chimaeric cryIA(a) genes using FU-2-7 and HD-1 cryIA(a) genes and isolated the chimaeric protoxins, as well as the parental ones, from Escherichia coli cells harboring the recombinant plasmids to examine the effects of the two amino acid variations on the toxicity. FU-2-7 CryIA(a) protein was about half as toxic against the smaller tea tortrix, Adoxophyes sp., and one-third as toxic against the silkworm, Bombyx mori, as that of HD-1. On the other hand, a chimaeric CryIA(a) protein with a single replacement of Phe965 to Ser had nearly the same toxicity as the HD-1 CryIA(a) against the smaller tea tortrix and one-third the toxicity against silkworm as that of HD-1. This improved property of the chimaeric CryIA(a) protoxin may be useful for widening its application to crop protection in sericultural countries.
|
221. |
Zhang MY,
Lövgren A,
( 1995 ) Cloning and sequencing of a beta-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis. PMID : 7789815 : DOI : 10.1016/0378-1119(95)00089-o Abstract >>
A beta-lactamase (Bla)-encoding gene (bla) from Bacillus thuringiensis (Bt) was cloned and the nucleotide (nt) sequence was determined. Both the nt sequence and deduced amino acid sequences reveal that the Bt Bla is very similar to that of B. cereus and other group A Bla. The transcription start point was also determined. Comparison of the upstream region of Bt bla with that of other genes suggested the presence of three sequence elements that might be involved in promoter function: the -10 (TCGGTGAT) and -35 (TTAT) sequences, an A+T-rich region (5'TACTAGCTATAATTTTTTAGT) and an inverted repeat sequence (5'-GAGATAGAGGC[GCTACTATCTC).
|
222. |
Brown KL,
( 1993 ) Transcriptional regulation of the Bacillus thuringiensis subsp. thompsoni crystal protein gene operon. PMID : 7504667 : DOI : 10.1128/jb.175.24.7951-7957.1993 PMC : PMC206974 Abstract >>
The two predominant polypeptides of the Bacillus thuringiensis subsp. thompsoni crystal are encoded by the cry40 and cry34 genes. These crystal protein genes are located in an operon. Western analysis (immunoblotting) demonstrated that the operon promoter activity was located in the region upstream of the cry40 gene. The Cry34 protein was expressed only when the upstream promoter region was present. The crystal protein genes are the only cistrons in the operon, and they are expressed during sporulation, with the highest transcript levels detected early in sporulation (1.5 to 3 h after the onset of sporulation). Transcription initiates from two adjacent sites located 84 and 85 bases upstream of the cry40 translational start codon. The B. thuringiensis subsp. thompsoni crystal protein gene operon promoter aligned with other crystal protein gene promoters, which are activated from early to midsporulation and transcribed in vitro by the B. thuringiensis RNA polymerase E sigma 35.
|
223. |
Baum JA,
( 1994 ) Tn5401, a new class II transposable element from Bacillus thuringiensis. PMID : 7514590 : DOI : 10.1128/jb.176.10.2835-2845.1994 PMC : PMC205437 Abstract >>
A new class II (Tn3-like) transposable element, designated Tn5401, was recovered from a sporulation-deficient variant of Bacillus thuringiensis subsp. morrisoni EG2158 following its insertion into a recombinant plasmid. Sequence analysis of the insert revealed a 4,837-bp transposon with two large open reading frames, in the same orientation, encoding proteins of 36 kDa (306 residues) and 116 kDa (1,005 residues) and 53-bp terminal inverted repeats. The deduced amino acid sequence for the 36-kDa protein shows 24% sequence identity with the TnpI recombinase of the B. thuringiensis transposon Tn4430, a member of the phage integrase family of site-specific recombinases. The deduced amino acid sequence for the 116-kDa protein shows 42% sequence identity with the transposase of Tn3 but only 28% identity with the TnpA transposase of Tn4430. Two small open reading frames of unknown function, designated orf1 (85 residues) and orf2 (74 residues), were also identified. Southern blot analysis indicated that Tn5401, in contrast to Tn4430, is not commonly found among different subspecies of B. thuringiensis and is not typically associated with known insecticidal crystal protein genes. Transposition was studied with B. thuringiensis by using plasmid pEG922, a temperature-sensitive shuttle vector containing Tn5401. Tn5401 transposed to both chromosomal and plasmid target sites but displayed an apparent preference for plasmid sites. Transposition was replicative and resulted in the generation of a 5-bp duplication at the target site. Transcriptional start sites within Tn5401 were mapped by primer extension analysis. Two promoters, designated PL and PR, direct the transcription of orf1-orf2 and tnpI-tnpA, respectively, and are negatively regulated by TnpI. Sequence comparison of the promoter regions of Tn5401 and Tn4430 suggests that the conserved sequence element ATGTCCRCTAAY mediates TnpI binding and cointegrate resolution. The same element is contained within the 53-bp terminal inverted repeats, thus accounting for their unusual lengths and suggesting an additional role for TnpI in regulating Tn5401 transposition.
|
224. |
?zdemir F,
Arslan S,
( 2019 ) Molecular Characterization and Toxin Profiles of Bacillus spp. Isolated from Retail Fish and Ground Beef. PMID : 30690739 : DOI : 10.1111/1750-3841.14445 Abstract >>
Bacillus species are common in the environment due to their spore-forming ability and nutritional versatility and cause food contamination. Bacilli play a significant role in foodborne illnesses and food spoilage. In this study, 52 Bacillus isolates from retail fish and ground beef were identified and differentiated based on 16S rRNA, gyrB, and rpoB gene sequencing. The presence of genes encoding emetic toxin (ces), hemolytic enterotoxin hemolysin BL (hbl), nonhemolytic enterotoxin (nhe) and cytotoxin K (cytK1) was assessed in all Bacillus isolates. The ability of the Bacillus isolates to produce several extracellular enzymes that contribute to pathogenicity and food spoilage was investigated. The 16S rRNA, rpoB, and gyrB gene sequence similarities of the Bacillus isolates tested were 96.1%, 83.2%, and 77.5%, respectively. The gyrB gene demonstrated a higher degree of sequence variation than the 16S rRNA and rpoB genes. The prevalence of Bacillus isolates producing at least two of the genes of the HBL and NHE complexes was 23.1% and 15.4%, respectively. Of the B. cereus isolates, 10 (41.7%) possessed two or more enterotoxin genes. None of the isolates carried the ces and cytK1 genes. All isolates were positive for the production of enzymes such as protease, lipase, gelatinase, and DNase. However, only 92.3% of the tested isolates were positive for amylase. In conclusion, our results revealed that the presence of genes involved in toxin production and enzyme production in meat-originated B. cereus and other Bacillus isolates may cause spoilage of food and pose a health risk for consumers. PRACTICAL APPLICATION: Bacillus species can be found in various foods due to their ubiquitous nature. Bacillus spp., especially B. cereus, are associated with food poisoning and other infections in humans. Toxins and many extracellular enzymes produced by Bacillus spp. are the causative agents of foodborne outbreaks, food spoilage, and low-quality food with significantly reduced edibility. This study highlights the characterization of Bacillus spp. and presence of potentially pathogenic Bacillus species in meats.
|
225. |
Jing X,
Yuan Y,
Wu Y,
Wu D,
Gong P,
Gao M,
( 2019 ) Crystal structure of Bacillus thuringiensis Cry7Ca1 toxin active against Locusta migratoria manilensis. PMID : 30506755 : DOI : 10.1002/pro.3561 PMC : PMC6371223 Abstract >>
Insecticidal crystal (Cry) proteins produced by Bacillus thuringiensis (Bt) are widely used as environmentally friendly insecticides. As the only known Cry protein with insecticidal activity against Locusta migratoria manilensis, a locust subspecies that causes extensive destruction of crops, the Cry7Ca1 protein from Bt strain BTH-13 identified in our previous study is of particular interest to locust prevention and control. However, the three-dimensional structure of Cry7Ca1 toxin (the active form of the Cry7Ca1 protein) and the mechanisms of the Cry7Ca1 insecticidal specificity remain largely elusive. Here, we report a 2.3 ? crystal structure of the Cry7Ca1 toxin and carry out a systematic comparison of all available Cry toxins structures. A cluster of six loops in Cry toxin domain II, named Apex here, are the most variable structural elements and were documented to contribute in insecticidal specificity. The Cry7Ca1 toxin Apex loops are different from those of other Cry toxins in length, conformation, and sequence. Electrostatic potential analysis further revealed that Cry7Ca1 is the only structure-available Cry toxin that does not have a high contrast of surface electrostatic potentials in the Apex. We further suggest that the L1/L2 loops in the center of the Cry7Ca1 Apex may be worthy of attention in future efforts to unravel the Cry7Ca1 insecticidal specificity as they exhibit unique features not found in the corresponding regions of other Cry toxins. Our work highlights the uniqueness of the Apex in the Cry7Ca1 toxin and may assist exploration of the insecticidal mechanism of the Cry7Ca1 against Locusta migratoria manilensis.
|
226. |
Juárez-Hernández EO,
Casados-Vázquez LE,
Brieba LG,
Torres-Larios A,
Jimenez-Sandoval P,
Barboza-Corona JE,
( 2019 ) The crystal structure of the chitinase ChiA74 of Bacillus thuringiensis has a multidomain assembly. PMID : 30796308 : DOI : 10.1038/s41598-019-39464-z PMC : PMC6385353 Abstract >>
There is no structural information about any chitinase synthesized by Bacillus thuringiensis, the most successful microbial insect larvicide used worldwide. In this study, we solved the 3D structure of the chitinase ChiA74 at 2.26 ?. The crystal structure shows that ChiA74 is composed of a modular arrangement formed by (i) a catalytic region (CD), (ii) a chitinase insertion domain (CID), (iii) a fibronectin type III domain (FnIII), and (iv) a chitin binding domain (CBD). The location of the CBD with respect to the CD has no structural similarity to other chitinases with known structures. The activity of a ChiA74 lacking its secretion signal peptide (ChiA74�Gsp) and a truncated version lacking its CBD/FnIII domains (ChiA74�Gsp-50) did not have statistical differences in activity against colloidal chitin. However, ChiA74�Gsp exhibits 4.5 and 2.0 higher activity than versions lacking the CBD (ChiA74�Gsp-60) and CBD/FnIII domains (ChiA74�Gsp-50), respectively, when crystalline chitin was used as substrate. Our data suggest that the CBD might plays a significant role in crystalline chitin hydrolysis. We also demonstrated the importance of the catalytic E211 in the CD, as mutants ChiA74�GspE211N and ChiA74�GspD207N, E211N were inactive against colloidal and crystalline chitins, chitosan and 4-MU-GlcNAc3. ChiA74 has a processive activity producing oligosaccharides with degree of polymerization (DP) of 1 (GlcNAc) and 2 (GlcNAc2).
|
227. |
Mahillon J,
Seurinck J,
( 1988 ) Complete nucleotide sequence of pGI2, a Bacillus thuringiensis plasmid containing Tn4430. PMID : 3211758 : DOI : 10.1093/nar/16.24.11827 PMC : PMC339127 Abstract >>
N/A
|
228. |
Henner DJ,
Yang M,
Chen E,
Hellmiss R,
Rodriguez H,
Low MG,
( 1988 ) Sequence of the Bacillus thuringiensis phosphatidylinositol specific phospholipase C. PMID : 3194218 : DOI : 10.1093/nar/16.21.10383 PMC : PMC338883 Abstract >>
N/A
|
229. |
Wang Y,
Liu Y,
Zhang J,
Crickmore N,
Song F,
Gao J,
Shu C,
( 2018 ) Cry78Aa, a novel Bacillus thuringiensis insecticidal protein with activity against Laodelphax striatellus and Nilaparvata lugens. PMID : 30017953 : DOI : 10.1016/j.jip.2018.07.007 Abstract >>
Transgenic plants expressing insecticidal proteins originating from Bacillus thuringiensis (Bt) have successfully been used to control lepidopteran and coleopteran pests with chewing mouthparts. However, only a handful of Bt proteins have been identified that have bioactivity against sap sucking pests (Hemiptera), including aphids, whiteflies, plant bugs and planthoppers. A novel Bt insecticidal protein with significant toxicity against a hemipteran insect pest is described here. The gene encoding the 359 amino acid, 40.7 kDa protein was cloned from strain C9F1. After expression and purification of the toxin, its median lethal concentration (LC50) values against Laodelphax striatellus and Nilaparvata lugens were determined as 6.89 �gg/mL and 15.78 �gg/mL respectively. Analysis of the toxin sequence revealed the presence of both Toxin_10 and Ricin_B_Lectin domains.
|
230. |
Fragoso P,
Armijo A,
Gómez D,
Gómez C,
Bugueño M,
Sánchez G,
Venegas J,
( 2018 ) Molecular Characterization of the cry Gene profile of Bacillus thuringiensis Isolated from a Caribbean Region of Colombia. PMID : 30015421 : DOI : 10.5604/01.3001.0011.6138 Abstract >>
In order to characterize native strains of Bacillus thuringiensis of the Colombian Caribbean with toxic effect against insect vectors, 28 samples of bacteria identified as B. thuringiensis were isolated from different soils and muds around the city of Valledupar. Using a biological test, five isolates of B. thuringiensis showed toxic effect against larvae of Aedes aegypti. PCR methods were used to detect cry1, cry2, cry4B, cry10 and cyt1 genes. Cry1 and cry2 genes were detected in 35.7% and 32.1% of the 28 isolates analyzed, respectively. Surprisingly, reduced lengths of cry4B gene segments were detected in 28.6% of B. thuringiensis samples. The presence of cry10 or cyt1 was not detected in any of the 28 samples of B. thuringiensis, despite the high sensitivity of the assays used. The results show that B. thuringiensis samples from the Colombian Caribbean have atypical characteristics compared to those of Latin America and elsewhere in the world, which is consistent with the idea that the geographic origin of B. thuringiensis samples is associated with their biological and genetic characteristics.
|
231. |
Beaudoin GAW,
Li Q,
Folz J,
Fiehn O,
Goodsell JL,
Angerhofer A,
Bruner SD,
Hanson AD,
( 2018 ) Salvage of the 5-deoxyribose byproduct of radical SAM enzymes. PMID : 30082730 : DOI : 10.1038/s41467-018-05589-4 PMC : PMC6079011 Abstract >>
5-Deoxyribose is formed from 5'-deoxyadenosine, a toxic byproduct of radical S-adenosylmethionine (SAM) enzymes. The degradative fate of 5-deoxyribose is unknown. Here, we define a salvage pathway for 5-deoxyribose in bacteria, consisting of phosphorylation, isomerization, and aldol cleavage steps. Analysis of bacterial genomes uncovers widespread, unassigned three-gene clusters specifying a putative kinase, isomerase, and sugar phosphate aldolase. We show that the enzymes encoded by the Bacillus thuringiensis cluster, acting together in vitro, convert 5-deoxyribose successively to 5-deoxyribose 1-phosphate, 5-deoxyribulose 1-phosphate, and dihydroxyacetone phosphate plus acetaldehyde. Deleting the isomerase decreases the 5-deoxyribulose 1-phosphate pool size, and deleting either the isomerase or the aldolase increases susceptibility to 5-deoxyribose. The substrate preference of the aldolase is unique among family members, and the X-ray structure reveals an unusual manganese-dependent enzyme. This work defines a salvage pathway for 5-deoxyribose, a near-universal metabolite.
|
232. |
Böhringer N,
Fisch KM,
Schillo D,
Bara R,
Hertzer C,
Grein F,
Eisenbarth JH,
Kaligis F,
Schneider T,
Wägele H,
König GM,
Schäberle TF,
( 2017 ) Antimicrobial Potential of Bacteria Associated with Marine Sea Slugs from North Sulawesi, Indonesia. PMID : 28659904 : DOI : 10.3389/fmicb.2017.01092 PMC : PMC5469899 Abstract >>
Nudibranchia, marine soft-bodied organisms, developed, due to the absence of a protective shell, different strategies to protect themselves against putative predators and fouling organisms. One strategy is to use chemical weapons to distract predators, as well as pathogenic microorganisms. Hence, these gastropods take advantage of the incorporation of chemical molecules. Thereby the original source of these natural products varies; it might be the food source, de novo synthesis from the sea slug, or biosynthesis by associated bacteria. These bioactive molecules applied by the slugs can become important drug leads for future medicinal drugs. To test the potential of the associated bacteria, the latter were isolated from their hosts, brought into culture and extracts were prepared and tested for antimicrobial activities. From 49 isolated bacterial strains 35 showed antibiotic activity. The most promising extracts were chosen for further testing against relevant pathogens. In that way three strains showing activity against methicillin resistant Staphylococcus aureus and one strain with activity against enterohemorrhagic Escherichia coli, respectively, were identified. The obtained results indicate that the sea slug associated microbiome is a promising source for bacterial strains, which hold the potential for the biotechnological production of antibiotics.
|
233. |
Shi X,
Miyakawa T,
Nakamura A,
Hou F,
Hibi M,
Ogawa J,
Kwon Y,
Tanokura M,
( 2017 ) Engineering a short-chain dehydrogenase/reductase for the stereoselective production of (2S,3R,4S)-4-hydroxyisoleucine with three asymmetric centers. PMID : 29057974 : DOI : 10.1038/s41598-017-13978-w PMC : PMC5651801 Abstract >>
Fenugreek is a dietary supplement for anti-aging and human health. (2S,3R,4S)-4-hydroxyisoleucine (4-HIL), which is extracted from fenugreek seeds, is expected to be a promising orally active drug for diabetes and diabetic nephropathy because of its insulinotropic effect. Although several chemical synthesis methods of 4-HIL have been proposed, these methods require multistep reactions to control the stereochemistry of 4-HIL. In this study, we modified the key enzyme 4-HIL dehydrogenase (HILDH) to overcome the biggest limitation in commercial-scale production of 4-HIL. As a result, an effective one-step carbonyl reduction to produce (2S,3R,4S)-4-HIL was successfully accomplished with strict stereoselectivity (>99% de). Mass production of (2S,3R,4S)-4-HIL by our synthetic method could have a significant contribution to the prevention of diabetes, dyslipidemia, and Alzheimer's disease. (120 words/200 words).
|
234. |
( 2013 ) Expression of cry3A gene and its toxicity against Asian Gray Weevil Myllocerus undecimpustulatus undatus Marshall (Coleoptera: Curculionidae). PMID : 23456617 : DOI : 10.1002/jobm.201200272 Abstract >>
Coleopterans are the most damaging pests of many agricultural and forestry crops; there is an urgent need to develop effective biopesticides against these insects. Enhancers of Bt toxicity typify an opportunity to improve currently available commercial products into more effective control agents against diverse pests. A 1.9 kb DNA fragment, PCR amplified from native isolates of Bt using cry3A gene specific primers was cloned in expression vector pQE-80L and then used for transformation of Escherichia coli M15 cells. The sequence of the cloned crystal protein gene showed almost complete homology with a Coleopteran active Cry3A toxin gene with 117 mutations scattered in different domain regions encoding a protein of 645 amino acid residues in length, with a predicted molecular mass of 77.4 kDa. Phylogenetic analysis could be compulsive for new/novel Bacillus thuringiensis strains, allowing them to be grouped with related Cry proteins. The toxicity of Bt protein was determined against Myllocerus undecimpustulatus undatus Marshall (Coleoptera: Curculionidae) LC50 152 ng cm(-2). Genes coding for Coleopteran active Cry3A proteins have been isolated and their efficient expression will provide the tools necessary to increase the efficacy of Cry-based biopesticide against economically important beetles.
|
235. |
( 2013 ) Characterization of the chitinase gene in Bacillus thuringiensis Mexican isolates. PMID : 23456349 : DOI : 10.1007/s12223-013-0233-y Abstract >>
The chitinase gene was molecularly characterized in five Bacillus thuringiensis Mexican isolates, MR10, MR11, MR21, MR33, and RN52. The proteins derived from these genes were tested for their chitinase activity using fluorogenic chitin derivatives. In order to verify if chitinase genes were functional, they were cloned, and enzymatic activity of recombinant chitinases was also tested. Results indicated that enzymes exhibited endochitinase activity. The highest hydrolytic activity shown against the chitin tetrameric derivative occurred at pH value of 6.5, and the optimum activity temperature was around 60 �XC. The recombinant endochitinases showed a molecular mass of ?77 kDa with isoelectric points from 6.5 to 7.0. Analysis of the nucleotide sequences showed highly conserved sequences among all isolates (97-99 %). Gene sequence analysis revealed a putative promoter (-35 TTGAGA and -10 TTAATA) and a Shine-Dalgarno sequence (5?-AGGAGA-3?) upstream from the open reading frame. The deduced amino acid sequence revealed that the proteins are modular enzymes composed by a family 18 glycosyl hydrolase domain located between amino acids 134 and 549, a fibronectin-binding domain (580 through 656), and a chitin-binding domain (664 through 771). The deduced amino acid sequences of our isolates showed a similarity close to 100 % respect to the sequences reported in the GenBank database.
|
236. |
( 2013 ) Discrimination between mesophilic and psychrotolerant strains in the Bacillus cereus group based on the PstI digestion of the pycA gene. PMID : 23475137 : DOI : 10.1007/s00284-013-0339-0 Abstract >>
A simple and rapid assay for the detection of Bacillus weihenstephanensis isolates and other psychrotolerant strains in the Bacillus cereus group was developed. It is based on the presence of a nucleotide substitution at position 795 on the housekeeping pycA gene in all B. weihenstephanensis strains. This mutation creates a PstI recognition site. It is absent in mesophilic strains in the B. cereus group. The pycA gene is amplified by PCR and the amplicons submitted to PstI digestions. In mesophilic strains, a single band of 1,718 bp in length is visualised on an agarose gel. In B. weihenstephanensis strains and in all other psychrotolerant strains from the B. cereus group, the amplicons are cleaved and two bands of 1,175 and 543 bp, respectively, are visualised. This method could be used for the screening of B. cereus collections and for the identification of psychrotolerant and mesophilic isolates from different environments.
|
237. |
( 2013 ) Characterization of cry9Da4, cry9Eb2, and cry9Ee1 genes from Bacillus thuringiensis strain T03B001. PMID : 23455566 : DOI : 10.1007/s00253-013-4781-5 Abstract >>
Three cry9 genes, cry9Da4, cry9Eb2, and cry9Ee1, were cloned from Bacillus thuringiensis strain T03B001 using a high-resolution melting analysis method. All three cry9 genes were overexpressed in Escherichia coli Rosetta (DE3), and the expressed products Cry9Eb2 and Cry9Ee1 were shown to be toxic to Plutella xylostella and Ostrinia furnacalis, but not to Helicoverpa armigera or Colaphellus bowringi. The bioassay of Cry9Eb2 and Cry9Ee1 against Cry1Ac-resistant P. xylostella strains indicated that both novel Cry9 toxins exhibited no cross-resistance with Cry1Ac. Cry9Eb2 and Cry9Ee1 can be applied not only for P. xylostella and O. furnacalis control, but also for the Cry1Ac-resistance management of pests.
|
238. |
Zack MD,
Sopko MS,
Frey ML,
Wang X,
Tan SY,
Arruda JM,
Letherer TT,
Narva KE,
( 2017 ) Functional characterization of Vip3Ab1 and Vip3Bc1: Two novel insecticidal proteins with differential activity against lepidopteran pests. PMID : 28894249 : DOI : 10.1038/s41598-017-11702-2 PMC : PMC5593919 Abstract >>
In this work, we characterized 2 novel insecticidal proteins; Vip3Ab1 and Vip3Bc1. These proteins display unique insecticidal spectra and have differential rates of processing by lepidopteran digestive enzymes. Furthermore, we have found that both proteins exist as tetramers in their native state before and after proteolysis. In addition, we expressed truncated forms and protein chimeras to gain a deeper understanding of toxin specificity and stability. Our study confirms a role for the C-terminal 65 kDa domain in directing insect specificity. Importantly, these data also indicate a specific interaction between the 20 kDa amino terminus and 65 kDa carboxy terminus, after proteolytic processing. We demonstrate the C-terminal 65 kDa to be labile in native proteolytic conditions in absence of the 20 kDa N-terminus. Thus, the 20 kDa fragment functions to provide stability to the C-terminal domain, which is necessary for lethal toxicity against lepidopteran insects.
|
239. |
( 2013 ) Structural basis for the activation mechanism of the PlcR virulence regulator by the quorum-sensing signal peptide PapR. PMID : 23277548 : DOI : 10.1073/pnas.1213770110 PMC : PMC3549096 Abstract >>
The quorum-sensing regulator PlcR is the master regulator of most known virulence factors in Bacillus cereus. It is a helix-turn-helix (HTH)-type transcription factor activated upon binding of its cognate signaling peptide PapR on a tetratricopeptide repeat-type regulatory domain. The structural and functional properties of PlcR have defined a new family of sensor regulators, called the RNPP family (for Rap, NprR, PrgX, and PlcR), in Gram-positive bacteria. To fully understand the activation mechanism of PlcR, we took a closer look at the conformation changes induced upon binding of PapR and of its target DNA, known as PlcR-box. For that purpose we have determined the structures of the apoform of PlcR (Apo PlcR) and of the ternary complex of PlcR with PapR and the PlcR-box from the plcA promoter. Comparison of the apoform of PlcR with the previously published structure of the PlcR-PapR binary complex shows how a small conformational change induced in the C-terminal region of the tetratricopeptide repeat (TPR) domain upon peptide binding propagates via the linker helix to the N-terminal HTH DNA-binding domain. Further comparison with the PlcR-PapR-DNA ternary complex shows how the activation of the PlcR dimer allows the linker helix to undergo a drastic conformational change and subsequent proper positioning of the HTH domains in the major groove of the two half sites of the pseudopalindromic PlcR-box. Together with random mutagenesis experiments and interaction measurements using peptides from distinct pherogroups, this structural analysis allows us to propose a molecular mechanism for this functional switch.
|
240. |
( 2013 ) Microbial control of the cotton leafworm Spodoptera littoralis (Boisd.) by Egyptian Bacillus thuringiensis isolates. PMID : 22983675 : DOI : 10.1007/s12223-012-0193-7 Abstract >>
Four local Bacillus thuringiensis (Bt) isolates that had been serologically identified as Bt var. kurstaki (Btk2, Btk3, and Btk66) and Bt var. mexicanensis (Btm27), in addition to two reference strains (4D20 and 4AC1), were laboratory assayed as microbial control agents against the Egyptian cotton leafworm Spodoptera littoralis (Boisd.). Polymerase chain reaction (PCR) amplification analysis revealed that each of the six experimental strains carries, at least, a cry1 type gene which expresses a protein toxin active against lepidopterous insects. Additionally, PCR amplification results demonstrated that 4D20 and Btk66 contain the Lepidoptera- and Diptera-active cry2 type gene and that Btk66 contains Coleoptera-active cry7 and cry8 genes. Among the six strains, Btk66 and Btm27 were the most promising microbial control agents against S. littoralis. The present findings were the first to report that Btm27 (classified as B. thuringiensis var. mexicanensis) is a very potent microbial control agent against S. littoralis-tested larvae. For more characterization of these two isolates, the sspO gene was investigated as a molecular chronometer. The DNA sequencing results proved that Btk66 and Btm27 carry sspO open reading frames with identical nucleotide sequences, suggesting a strong phylogenetic relationship between the two strains.
|
241. |
( 2013 ) Screening and identification of a Bacillus thuringiensis strain S1/4 with large and efficient insecticidal activities. PMID : 22915162 : DOI : 10.1002/jobm.201100653 Abstract >>
The bacterium Bacillus thuringiensis was recognized for its entomopathogenic activities related to Cry and Cyt proteins forming the �_-endotoxins and some extracellular activities like the vegetative insecticidal proteins (VIP) and Cry1I. These activities may act specifically against diverse organisms and some of them typically characterize each strain. Here, we screened a set of 212 B. thuringiensis strains to search the higher insecticidal activities. These strains had bipyramidal and cubic crystal morphologies and 30% of them showed PCR amplification of vip3 internal region, from which five isolates (S1/4, S17, S122, S123, and S144) showed plasmid profile variability. These five strains contained the cry1I, cry1Aa and/or cry1Ac, cry1Ab and cry2 genes, and S1/4 harbored in addition the cry1C, vip1, and vip2 genes. They produced from 25 to 46 ?g �_-endotoxin per 10(7) spores. Their �_-endotoxins displayed distinct lethal concentrations 50% against either Spodoptera littoralis or Ephestia kuehniella larvae with the lowest one for S1/4, which was also active against Tuta absoluta. Fortunately, the analysis of the culture supernatants revealed that S1/4 had the higher toxicity towards these lepidopteron but it did not show any toxicity against the Tribolium castaneum coleopteran larvae; additionally, S1/4 displayed an antibacterial activity. S1/4 is a good candidate for agricultural pest control, as it is more efficient than the reference strain HD1.
|
242. |
( 2013 ) Parasporin 1Ac2, a novel cytotoxic crystal protein isolated from Bacillus thuringiensis B0462 strain. PMID : 23306354 : DOI : 10.1007/s00284-013-0301-1 Abstract >>
Two novel parasporin (PS) genes were cloned from Bacillus thuringiensis B0462 strain. One was 100 % identical even in nucleotide sequence level with that of parasporin-1Aa (PS1Aa1) from B. thuringiensis A1190 strain. The other (PS1Ac2) showed significant homology (99 % identity) to that of PS1Ac1 from B. thuringiensis 87-29 strain. The 15 kDa (S(113)-R(250)) and 60 kDa (I(251)-S(777)) fragments consisting of an active form of PS1Ac2 were expressed as His-tag fusion. Upon purification under denaturing condition and refolding, the recombinant polypeptides were applied to cancer cells to analyze their cytotoxicities. 3-(4,5-Dimethyl-2-thiazoyl)-2,5-diphenyl-2H-tetrazolium bromide assay revealed that either of 15 or 60 kDa polypeptide exhibited no cytotoxicity to HeLa cells, but they became cytotoxic upon mixed together. Our results suggested that PS1Ac2 was responsible for the cytotoxicity of B. thuringiensis B0462 strain, and that the formation of hetero-dimer of 15 and 60 kDa polypeptide was required for their cytotoxicity.
|
243. |
( 2012 ) phoR sequences as a phylogenetic marker to differentiate the species in the Bacillus subtilis group. PMID : 23145827 : DOI : 10.1139/w2012-106 Abstract >>
Bacillus subtilis and its closely related species are indistinguishable from one another by morphological characteristics and 16S rDNA sequences. In this study, the partial phoR sequence was tested to determine the phylogenetic relationship of species in the B. subtilis group. Degenerate primers were developed according to the relatively conserved nucleotide sequences of phoR and the linked gene phoP in the B. subtilis group. The primers amplified a 1100 bp phoR fragment from strains representative of 6 species in the B. subtilis group. Based on the sequenced fragments, 26 type strains comprising these 6 species were clearly distinguished. At the intraspecies level, the phoR sequence similarities were 90%-100%, but at the interspecies level, the phoR sequence similarities were 32.8%-75%. Compared with the gyrB sequence, the phoR sequences showed a larger divergence especially at the interspecies levels. Therefore, the phoR sequence may be an efficient alternative marker for phylogenetic and taxonomic analysis of species in the B. subtilis group. Twenty-three Bacillus undomesticated isolates were tested for identification and phylogenetic analysis based on the phoR and gyrB sequences. The 23 isolates could be clearly delineated into 4 distinct groups, 10 as B. subtilis, 3 as B. mojavensis, 2 as B. atrophaeus, and 8 as B. amyloliquefaciens.
|
244. |
( 1998 ) Localization of putative virulence genes on a physical map of the bacillus thuringiensis subsp. gelechiae chromosome PMID : 9732531 : Abstract >>
The insect pathogen Bacillus thuringiensis (Bt) has earlier been shown to possess virulence factors in addition to the crystal toxins. Bt subsp. gelechiae strain Bt13 lacks crystals but is still virulent to lepidopteran insects. Among the virulence co-expressed genes are two phospholipases; phosphatidylinositol-specific phospholipase C (PI-PLC) and phosphatidylcholine-degrading phospholipase C (PC-PLC), flagellin, and beta-lactamase I. In addition to these putative virulence factors the toxic neutral metalloprotease immune inhibitor A (InA) has been identified. In this paper we report a circular 5.9 Mb combined physical and genetic map of the of the Bt subsp. gelechiae chromosome. The genes encoding PI-PLC, PC-PLC, InA, flagellin, and beta-lactamase I are shown to be scattered over the chromosome. The PLC-encoding genes have been cloned from Bt13, and DNA sequencing showed that the Bt subsp. gelechiae PLC genes are >90% identical to their previously cloned equivalents from Bt or B. cereus. An HD-1 crystal toxin (cryIA) gene probe was found to hybridize to the Bt13 chromosome, but not to extrachromosomal elements.
|
245. |
( 1995 ) Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spo0A mutant. PMID : 9634751 : Abstract >>
The spo0A gene of Bacillus subtilis encodes the key factor involved in the initiation of sporulation. It was previously shown that the B. thuringiensis (Bt) cryIIIA gene, encoding a toxin active against coleopteran larvae, is overexpressed in an spo0A mutant of B. subtilis. In this paper we describe the construction of a Bt spo0A mutant strain and its use to produce insecticidal crystal proteins. The spo0A gene of Bt was cloned and identified by its ability to transform a B. subtilis spo0A mutant to prototrophy. Its nucleotide sequence is homologous to the B. subtilis gene. The spo0A gene was replaced in the Bt genome with a disrupted copy to give an Spo- strain unable to initiate sporulation. When the cryIIIA gene was cloned in the Bt spo0A mutant, large amounts of toxins were produced and accumulated to form a large crystal inclusion which remained encapsulated within the ghost cell. These encapsulated toxins were highly active against coleopteran larvae. We anticipate that the cryIIIA expression system and the Bt spo0A mutant will provide a convenient process to generate novel formulations of stabilized and environmentally safe Bt-based biopesticides.
|